Fanged Noumena
Overview unavailable.
Fanged Noumena Collected Writings
- Fanged Noumena is the first comprehensive collection of Nick Land's influential writings spanning from 1987 to 2007.
- Land's work is characterized by a 'rabid nihilism' and 'accelerationism' that seeks to dismantle traditional academic philosophy.
- The text describes an 'all-out war on the Human Security System' through the use of weaponized versions of Deleuze, Guattari, and Nietzsche.
- The collection evolves from radical rereadings of Kant and Heidegger into 'post-genre theory-fictions' involving occultism and cryptography.
- Land's philosophy explores the concept of 'cybercapitalist meltdown' and the transition into a 'radically inhuman' twenty-first century.
- Despite his withdrawal from public life, Land's 'cybergothic' vision remains a foundational influence on Speculative Realism and underground art.
Land plotted a rigorously schizophrenic escape route out of academic philosophy, and declared all-out war on the Human Security System.
COVER IMAGE
From Disasters oj War IV, 2001, by Jake and Dinos Chapman,
hand coloured etching with waterco)our, 24.5 x 34.5 ern.
Photo by Stephen White. Courtesy of White Cube.
Level l , or world-space,
is an anthropomorphically scaled,
predominantly vision-configured,
massively multi-slotted reality system
that is obsolescing very rapidly.
Garbage time is running out.
Can what is playing you make it to Level 2 ?
URB
ANO
MIC
www.urbanomic.com
www.sequencepress.com
NICK
LAND
Fanged
Noumena
COLLECTED
WRITINGS
1987-2007
NICK LAND
Fanged Noumena
COLLECTED WRITINGS
1987 - 2007
Fanged Noumena assembles for the first
time the writings of Nick Land, variously
described as 'rabid nihilism', 'mad black
Deleuzianism', 'accelerationism', and 'cy
bergothic'. Wielding weaponised, machini
cally-recombined versions of Deleuze and
Guattari, Reich and Freud, in the company
of fellow 'werewolves' such as Nietzsche,
Bataille, Artaud, Trakl and Cioran, to a cut
up soundtrack of Bladerunner, Terminator
and Apocalypse Now, Land plotted a rigor
ously schizophrenic escape route out of
academic philosophy, and declared all-out
war on the Human Security System.
Despite his 'disappearance', Land's output
has been a crucial underground influence
both on recent Speculative Realist thoug'ht,
and on artists, writers, musicians and film
makers invigorated by his uncompromising
and abrasive philosophical vision.
Long the subject of rumour and vague
legend, Land's turbulent post-genre
theOly-fictions of cybercapitalist meltdown
smear cyberpunk, philosophy, arithmetic,
poetics, cryptography, anthropology,
grammatology and the occult into
unrecognisable and gripping hybrids.
Beginning with Land's radical rereadings
of Heidegger, Nietzsche and Kant, Fanged
Noumena terminates in Professor Barker's
cosmic theory of geo-traurna and neo
qabbalistic attempts to formulate a
numerical anti-language.
FangedNoumena is a dizzying trip
through Land's rigorous, incisive and
provocative work, establishing it as an in
dispensable resource for radically inhuman
thought in the twenty-first century.
NICK LAND
Fanged Noumena
COLLECTED WRITINGS
1987- 2007
Fanged Noumena assembles for the first
time the writings of Nick Land, variously
described as 'rabid nihilism', 'mad black
Deleuzianism', 'accelerationism', and 'cy
bergothic'. Wielding weaponised, machini·
cally-recombined versions of Deleuze and
Guattari, Reich and Freud, in the company
of fellow 'werewolves' such as Nietzsche,
Bataille, Artaud, Trakl and Cioran, to a cut
up soundtrack of Bladentnner, Terminator
and Apocalypse Now, Land plotted a rigor
ously schizophrenic escape route out of
academic philosophy, and declared all-out
war on the Human Security System.
Despite his 'disappearance', Land's output
has been a crucial underground influence
both on recent Speculative Realist thought,
and on artists, writers, musicians and film
makers invigorated by his uncompromising
and abrasive philosophical vision.
Long the subject of rumour and vague
legend, Land's turbulent post-genre
theory-fictions of cybercapitalist meltdown
smear cyberpunk, philosophy, arithmetic,
poetics, cryptography, anthropology,
grammatology and the occult into
unrecognisable and gripping hybrids.
Beginning with Land's radical rereadings
of Heidegger, Nietzsche and Kant, Fanged
Noumena terminates in Professor Barker's
cosmic theory of geo-trauma and neo
qabbalistic attempts to formulate a
numerical anti-language.
Fanged Noumena is a dizzying trip
through Land's rigorous, incisive and
provocative work, establishing it as an in
dispensable resource for radically inhuman
thought in the twenty-first century.
NICK LAND
Fanged N oumena
COLLECTED WRITINGS
1987-Q007
Edited By
RO B IN MAC KAY & RAY B RAS S IER
URBANOMIC
First published in 2011 in an edition of 1000
by
URBANOMIC
THE OLD LEMONADE FACTORY
WINDSOR QUARRY
FALMOUTH TRll 3EX
Urbanomic Publication Front Matter
- This section details the publication metadata for a second edition volume released in 2012 by Urbanomic and Sequence Press.
- The table of contents reveals a trajectory from classical philosophical critiques of Kant and Heidegger toward radical 'CyberGothic' and 'Machinic' theories.
- The collection features a significant focus on the intersection of Nietzschean thought, aesthetics, and the dissolution of the human subject in cyberspace.
- A diverse list of sources indicates the essays were originally published between 1988 and 1998 across various academic journals and private underground publications.
- The later entries in the volume suggest a shift toward experimental 'Ccru' (Cybernetic Culture Research Unit) themes such as 'Qwernomics' and 'Cthulhu Club' occultism.
Meat (or How to Kill Oedipus in Cyberspace)
UNITED KINGDOM SEQUENCE PRESS
36 ORCHARD STREET
NEW YORK
NY 10002
UNITED STATES
Second edition 2012
Text © the authors
For the book in this form © Urbanomic
All rights reserved.
No part of this book may be reproduced or transmitted in any form or by
any means, electronic or mechanical, including photocopying, recording or
any other information storage or retrieval system, without prior permission
in writing from the publisher.
BRITISH LIBRARY CATALOGUING-IN-PUBLICATION DATA
A full catalogue record of this book is available
from the British Library
ISBN 978.0.9553087-8-9
Printed and bound in the UK by
the MPG Books Group, Bodmin and Kings Lynn
www.urbanomic.com
www.sequencepress.com
CONTENTS
List of Sources
Editor s' Introduction vii
1
Kant, Capital, and the Prohibition of Incest: A Polemical
Introduction to the Configuration of Philosophy
and Modernity 55
Narcissism and Dispersion in Heidegger's 1953
Trakl Interpretation
Delighted to Death 81
123
Art as Insurrection: the Question of Aesthetics in Kant,
Schopenhauer, and Nietzsche
Spirit and Teeth
Shamanic Nietzsche
After the Law
Making it with Death: Remarks on Thanatos and
Desiring-Production
Circuitries
Machinic Desire
CyberGothic
Cyberrev olution
Hyper virus
v 145
175
203
229
261
289
319
345
375
383
No Future 391
Cyberspace Anarchitecture as Jungle-War 401
Meat (or How to Kill Oedipus in Cyberspace) 411
Meltdown 441
A zIIgQthIc- ==X=cQDA==-( CookIng-IQbsteRs-
wIth-jAke-An D-DmQs) 461
Kata�oniX 481
Barker Speaks: The CCRU Interview with Professor
D.C. Barker 493
Mechanomics 507
Cryptolith 527
Non-Standard Numeracies:Nomad Cultures 531
Occultures 545
Origins of the Cthulhu Club 573
Introduction to Qwernomics 583
Qabbala 101 591
Tic-Talk 607
Critique of Transcendental Miserablism 623
A Dirty Joke 629
Index of Names 645
Index of Subjects 650
vi
List of Sources
'Kant, Capital, and the Prohibition of Incest' originally
appeared in 'Ilzird Text Vol. 2, Issue 5 (Winter 1988/89), 83-94;
'Narcissism and Dispersion in Heidegger's 1953 Trakl Inter
pretation ' first appeared in D. Wood (ed.) Philosophers' Poets
(London/NY: Routledge, 1990),70-92; 'Delighted to Death'
first appeared in Pli -'Ilze Warwick Journal qfPhilosophy Vol.
3, Issue 2 (1991),76-88; 'Art as Insurrection' first appeared in
K. Ansell-Pearson (ed.), Nietzsche and Modern German 'Ilzought
(London: Routledge, 1991), 240-56; 'Spirit and Teeth' first
appeared in D. Wood (ed.), Of Derrida, Heidegger, and Spirit
(Evanston, 11.: Northwestern University Press, 1993),41-55,
copyright © 1993 Northwestern University Press; 'Shamanic
Nietzsche' first appeared in P. R. Sedgwick (ed .),Nietzsche:A
Critical Reader (Oxford: Blackwell, 1995), 158-70; 'After the
Law' first appeared in A. Norrie (ed.), Closure or Critique: New
Directions in Legal 'Ilzeory (Edinburgh: Edinburgh University
Press, 1993), 101-15; 'Making it with Death' first appeared
in Journal qfthe British Society for Phenomenology, 24.1 Gan.
1993),66-76; 'Circuitries' first appeared in Pli -'Ilze Warwick
JournalqfPhilosophyVol. 4, Issue 1/2 (1992), 217-35; 'Machinic
Desire' first appear ed in Textual Practice 7·3 (1993), 471-82;
'Cybergothic' first appeared in J. Broadhurst-Dixon, E. J.
Cassidy (eds.), Virtual Futures (London: Routledge, 1998),
79-87; 'Cyberrevolution' first appeared in ***Collapse 1 (pri
vately published, Feb. 1995); 'Hypervirus' first appeared in
***Collapse 2 (privately published, May 1995); 'No Future' is
vii
a previously unpublished conference paper dating from 1995;
'Cyberspace Anarchitecture as Jungle-War' first appeared
in M. Pearce and N. Spiller (eds.), Architectural Design u8:
Architects in Cyberspace (London: Academy Group, 1995),
58-9; 'Meat' first appeared in M. Featherstone and R. Bur
rows (ed.), Body & Society, Vol. 1, No. 3-4 (1995), 191-204;
'Meltdown', presented at Virtual Futures, Warwick University ,
Nick Land's Schizophrenic Metaphysics
- The text introduces the work of Nick Land as a disordered 'anarchitecture' where advanced technology and ancient entities collide.
- Land's writing style is described as a 'vortex of hallucinatory conjunctions' that splices philosophy, pulp fiction, occultism, and science.
- A central theme is the acceleration of modernity toward a singularity or 'meltdown' piloted by forces from the future.
- The philosophy presented is a 'psychotic cosmogony' where terrestrial history is viewed as a series of intensive thresholds and suppressions.
- Land aligns himself with renegade thinkers like Nietzsche and Bataille to use philosophy as a tool for disrupting orthodoxy and exacerbating enigma.
- The work is characterized by a disintegration of the human voice into cosmic trauma and the alliance of subcultures with morbid cults.
The human voice disintegrates into the howl of cosmic trauma; civilization hurtles towards an artificial death.
May 1994, first appeared in Abstract Culture 1 (first swarm)
(Coventry: Cybernetic Culture Research Unit [CCRU 1,1997);
'A zIIg"thlc-==X=coDA==-(C""kIng-IObsteRs-wlth-jAke
AnD-DInlls)' first appeared in]. & D. Chapman, Chapman
world (London:ICA, 1996); 'Kata�oniX' is the text from a
collaborative multimedia presentation by ***Collapse, artist
collective O(rphan) d(rift» , and 'DQghead Surgeri', Virtual
Futures 'g6, Warwick University, 1996; 'Barker Speaks' first
appeared in Abstract Culture: Hyperstition (London: CCRU,
1999); 'Mechanomics' first appeared in Pli -The Warwick
Journal oJPhilosophy 7 (1998), 55-66; 'Cryptolith ' and 'Occul
tures' are texts from 'Syzygy', a collaboration between CCRU
and o (rphan) d(rift» , Beaconsfield, London, Feb-Mar 1999;
'Non-Standard Numeracies' is a previously unpublished
text; 'Origins of the Cthulhu Club' was published online
by CCRU, probably dating from 1998-9; 'Introduction to
Qwernomics', "lie Talk', 'A Dirty Joke' and 'Critique of
Transcendental Miserablism' are texts posted online between
2005-7; 'Qabbala 101' first appeared in R. Mackay (ed.),
Collapse vol. 1 (Oxford: Urbanomic, 2006).
'Ihe editors would like to thank Michael Carr, Mark Fisher, David Rylance
and Reza Negarestani for their help in compiling this volume.
viii
FANGED NOUMENA
Editors'lntroduction
Nick Land's writings inhabit a disordered anarchitec
ture, a space traversed by rat and wolf-vectors, conjuring
a schizophrenic metaphysics. Advanced technologies
invoke ancient entities; the human voice disintegrates into
the howl of cosmic trauma; civilization hurtles towards
an artificial death. Sinister musical subcultures are allied
with morbid cults, rogue AIS are pursued into labyrinthine
crypts by Turing cops, and Europe mushrooms into a
paranoia laboratory in a global cyberpositive circuit
that reaches infinite density in the year QOIQ, flipping
modernity over into whatever has been piloting it from
the far side of the approaching singularity.
Land's writings fold genre in on itself, splicing dispa
rate sources from philosophy, literature, science, occult
ism, and pulp fiction (Immanuel Kant, William Gibson,
Deleuze-Guattari, Norbert Wiener, Kurt G6del, Kenneth
Grant, Terminator and Apocalypse Now, Antonin Artaud,
H.P. Lovecraft ... ). The result is a dense, frequently
1
EDITORS ' INTRODUCTION
bewildering vortex of hallucinatory conjunctions, super
posing multiple pseudonyms, cryptic dates, and experi
mental coding systems: Cthelll, Axsys, Unlife, A-Death,
K-Space, Sarkon, Kurtz, the Cthulhu Club, Hummpa Tad
dum; 4077, 1501, 1757, 1949, 1981; TIc-Systems , Primitive
Numerization, Anglossic Qabbala, zygosis ... Metaphysics
dissolves into psychotic cosmogony. The history of life on
earth, from bacteria to Microsoft, is the history of sup
pression. Nameless, the suppressed seethes beneath life's
organized surfaces, locked up in cells, societies, selves,
micro-and macropods, yet breaking out spasmodically
to propel terrestrial history through a series of intensive
thresholds which have been converging towards melt
down. Sole agent of revolution, the Antichrist is not
one but many, a swarm of masked infiltrators from the
future, 'poised to eat your TV, infect your bank account,
and hack mitochondria from your DNA'; hooking up
de sublimated Eros to synthetic Thanatos in order to
accelerate the obsolescence of humankind.
*
What has all this to do with philosophy? From a certain
point of view -one encouraged by Land himself -noth
ing, or as little as possible. Land allied himself to a line
of renegade thinkers -Schopenhauer, Nietzsche, Bataille
-who mocked and disparaged academicism and wielded
philosophy as an implement for exacerbating enigma,
2
EDITORS ' INTRODUCTION
disrupting orthodox y, and transforming existence. Land
is probably the most controversial figure to have emerged
from the fusty culture of Anglophone philosophy during
The Notoriety of Nick Land
- Nick Land emerged as a polarizing figure at the University of Warwick, challenging the 'holy trinity' of continental philosophy through a virulent anti-humanism.
- He famously championed 'accelerationism,' an aggressive marketization intended to hasten the disintegration of the social field rather than critique it.
- Despite his academic 'retirement' and subsequent erasure by orthodox institutions, Land's work maintained a cult following among artists and writers.
- Land's intellectual project involved a 'cybernetic streamlining' of Deleuze-Guattari, stripping away vitalism to reveal a 'thanatropic machinism.'
- His writings are described as 'theory-fictions' that fuse disparate fields like geophysics, cryptography, and occultism into a severe, delirious abstraction.
These extraordinary texts, superheated compounds of severe abstraction and scabrous wit, testify to a uniquely penetrating intelligence, fusing transcendental philosophy, number theory, geophysics, biology, cryptography, and occultism into startlingly cohesive but increasingly delirious theory-fictions.
the past two decades; despite, or perhaps because of
this controversy, the texts collected in this volume have
languished in near-obscurity until now.
Between 199Q, the yearof publication of his only book,
and 1998, when he resigned his lectureship in Philosophy at
the University of Warwick (UK) and abandoned academia,
Land accrued a notoriety remarkable in a milieu otherwise
typified by stultifying decorum. A divisive, polarizing
figure, he provoked both adulation and execration. His
jabs at the holy trinity of 'continental philosophy' - phe
nomenology, deconstruction, and critical theory - drew
enmity from his more orthodox peers; and while his viru
lent anti-humanism affronted philanthropic conservatives,
his swipes at institutionalized critique earned him the
opprobrium of the academic Left. Marxists in particular
were outraged by Land's aggressive championing of the
sociopathic heresy urging the 'ever more uninhibited
marketization of the processes that are tearing down the
social field' - the acceleration, rather than the critique,
of capitalism's disintegration of society. And Land's con
tempt for orthodoxy was no disingenuous pose struck
whilst ruthlessly pursuing advancement. With a complete
absence of academic ambition, he willingly paid the price
for his provocations, both personally and professionally.
3
EDITORS' INTRODUCTION
Once Land was 'retired', academic orthodoxy quickly
and quietly sealed the breach inflicted in its side by his
ferocious but short-lived assault, so that within the first
few years of the new century, he had become an apocry
phal character, more or less forgotten in philosophical
circles. Yet Land's writings continued to reverberate
outside academia, particularly among artists and writ
ers, who welcomed his vivid reanimation of philosophy
as a polemical medium, relished his disregard for the
proprieties of sober reflection, and were inspired by his
attempt to plunge theory directly into the maelstrom of
capitalist modernity.
Nevertheless, given this heteroclite status, it is hardly
surprising that many would still rather dismiss Land as an
unsavoury aberration, deserving of oblivion. So why re
pu blish these texts by a writer whom some would prefer to
forget? One could cite the need to expose them to a wider
readership than they were afforded at the time, and to
provide a more representative profile of Land's intellectual
trajectory than that suggested by the single monograph he
published during his brief academic career.! However the
most obvious, albeit cursory, rejoinder to anyone tempted
to dismiss Land is the unalloyed brilliance on display in the
writings collected here. These extraordinary texts, super
heated compounds of severe abstraction and scabrous
1
The Thirstfor Annihilation: Georges Bataille and Virulent Nihilism (London/New York:
Routledge, 1992).
4
EDITORS' INTRODUCTION
wit, testify to a uniquely penetrating intelligence, fusing
transcendental philosophy, number theory, geophysics,
biology, cryptography, and occultism into startlingly cohe
sive but increasingly delirious theory-fictions. Fuelled by
disgust at the more stupefying inanities of academic ortho
doxy and looking to expectorate the vestigial theological
superstitions afflicting mainstream post-Kantianism, Land
seized upon Deleuze-Guattari's transcendental material
ism - years before its predictable institutional neutering
- and subjected it to ruthless cybernetic streamlining,
excising all vestiges of Bergsonian vitalism to reveal a
deviant and explicitly thana tropic machinism. The results
of this reconstructive surgery provide the most illumi
nating but perhaps also the most disturbing distillation
of what Deleuze called 'transcendental empiricism'. In
Land's work, this becomes the watchword for an experi·
mental praxis oriented entirely towards contact with the
unknown. Land sought out this exteriority, the impersonal
Kant, Capital, and Synthesis
- Nick Land interprets Deleuze-Guattari's concepts as transdisciplinary innovations rather than mere philosophical or cultural theories.
- Land identifies a structural isomorphy between Immanuel Kant's model of experience and the mechanics of global capitalism.
- The text argues that Kant's 'theory of experience' is a working through of an economic system that generates surplus via a disavowed interaction with alterity.
- Capitalism is viewed as a state of 'inhibited synthesis,' simultaneously liberating trade and migration while reinstating control through the nation-state and familialism.
- Kant’s philosophical inquiry into the origin of new knowledge is framed as a rehearsal for the capitalist question of where continual growth will come from.
- Land's analysis anticipates the critique of 'correlationism' by revealing its political corollary as a system of social repression.
Kant's question 'Where does new knowledge come from?' rehearses the question 'Where will continual growth come from?'; the labyrinthine machinery of his response distilling the dissimulations of post-colonial capital.
and anonymous chaos of absolute time, as fervently as he
believed Kantianism and Hegelianism, along with their
contemporary heirs, deconstruction and critical theory,
were striving to keep it out.
What is particularly remarkable is the rigorous con
sistency with which Land developed the conceptual
innovations of Deleuze-Guattari as the trans disciplinary
innovations they are, rather than recontextualising them
(as is, unfortunately, now all too common) within the
5
EDITORS' INTRODUCTION
restricted histories of philosophy, psychoanalysis, or cul
tural theory. He deployed them in an exacting engagement
with the core problematics of modernity: the dialectic of
enlightenment, the humiliations of man, technology's
procedural automation of the concept, and science's ero
sion of philosophy's objects and articles of faith .
*
At the core of Land's thought are the works of Immanuel
Kant. Land is a brilliant reader of Kant and several of the
texts gathered here evince his rare gift for isolating the
essential components of Kant's labyrinthine philosophical
machinery. Moreover, Land uncovers the source of their
conceptual power by demonstrating their productive inte
gration with, and purchase upon, the extra-philosophical.
Exposing an isomorphy between the structures of
capital and Kant's model of experience, Land views the
'constant crisis' that drives the tortuous segmentations
of Kant's theory of the concept as a miscognised relaying
of the 'unconscious' of 'the global Kapital metropolis',
stimulated by the latter's 'paradoxical nature': Kant's
'theory of experience' - the question of how the matter
of sensation marries with a priori forms of experience to
produce novel cognitions - is in fact a working through of
the economics of a system that relies on a surplus generated
through a disavowed interaction with alterity. According to
'Kant, Capital and Incest', the capitalist necessity to keep
6
EDITORS' INTRODUCTION
the proletariat at a distance while actively compelling it
into the labour market is literalised in the geographical
sequestration of apartheid, which in turn provides the
core model for the modern nation-state. In keeping with
Deleuze-Guattari's analysis of Capital's dual tendencies
towards 'deterritorialization' and 'reterritorialization',
Land sees in capitalism a suspension, a compromise: at
the same time as it liberates a frustrated tendency toward
synthesis - the dissipation of all tribal chauvinism through
uninhibited trade and exchange, internationalization, mis
cegenation, migration, the explosion of patrilineage and
the concentration of power - it reinstates 'a priori' control
by sequestering kinship from this general tendency and
containing it within familialism and the nation-state. The
result is that, for Land, Enlightenment modernity exists in
the tension of an 'inhibited synthesis' which provides the
real conditions for the irresolvable struggle played out in
Kant's critical works. Kant's thinking of synthesis symp
tomatizes modernity, formally distilling its predicament,
the 'profound but uneasy relation' in which European
modernity seeks to stabilise and codify a relation (with its
proletarian or third-world 'material') whose instability or
difference is the very source of its perpetual expansion.
Kant's question 'Where does new knowledge come from?'
rehearses the question 'Where will continual growth come
from?'; the labyrinthine machinery of his response distill
ing the dissimulations of post-colonial capital.
7
EDITORS' INTRODUCTION
Here, Land's work not only anticipates the current critical
diagnosis of what Quentin Meillassoux has now named
'correlationism'2 - the implicit assumption in Kant's work
that whatever is outside the subject must correlate to it; it
uncovers its political corollary, in which the social as such
is constituted as a vast system of repression separating
Desire, Correlationism, and Revolution
- Nick Land interprets Deleuze and Guattari’s Anti-Oedipus as a tool to liberate 'machinic desire' from the constraints of the transcendental subject.
- Kantian correlationism is viewed as a restrictive mechanism that forces alterity into the predictable forms of commodity exchange and human identity.
- The failure of international trade to dissolve kinship leads to the retrenchment of nationalism and racism, culminating in the Holocaust as the apex of European civilization.
- Revolution is defined as the release of inhibited synthetic powers, specifically through the dismantling of the nation-state and patriarchal structures.
- Land identifies a militant feminism as the primary revolutionary force capable of jeopardizing neo-colonial capital because women lack investment in patriarchal inhibition.
- The Kantian categorical imperative is critiqued as a form of idealism that enslaves reality to ideality, functioning like a 'deaf Fuhrer' barking orders.
The internal struggle of the 'deaf Fuhrer barking orders that seem to come from another world'.
synthetic intelligence from its potentiality by screening
it through a transcendental system of correlates. Land
credits Anti-Oedipus with recasting the problem of the
theory of experience as a problem concerning the cag
ing of desire - with the latter read as a synonym for the
impersonal, synthetic intelligence (,animality', 'cunning')
that Land seeks to distinguish from the will of 'knowl
edge' to order, resolve, and correlate-in-advance. By
de-correlating experience as de-individualised machinic
desire, and relinquishing the need to ground all synthe
sis in a transcendental subject by supplying a synthetic
theory of the subject, Anti-Oedipus frees itself of the con
tortions that Kantian critique had to undergo. Thus 'the
desiring-production of Deleuze-Guattari is not qualified
by humanity (it is not a matter of what things are like
for us),; and Modernity is the progressive corrosion of
this qualification, even as it synthesizes insanely circui
tous ways of re-instating it. Kant's correlationism - the
setting out of 'the unchanging manner in which things
2
See Q Meillassoux, After Finitude, tr. R. Brassier (LondonjNY: Continuum, 2008).
8
EDITORS' INTRODUCTION
must be if they are to be for us' - provides an inhibited
form for the synthetic relation to alterity; a 'universal'
form in which we can enter into 'exchange' with it, and
thereby resolve our 'ambiguous dependence on novelty'
by restricting our interaction with alterity in advance to
commodity exchange.
When 'the outside must pass by way of the inside'
(correlation), the escape, promised by trade, from the
repressive interiority of Oedipal patrilineage, is recoded as
transgression against law, transcendentalising interiority
and familialism, and thereby locking desire into Oedipally
isolated circuits that provide the originary wellspring for
fascist xenophobia. The potential dissolution of kinship
by international trade ends in its retrenchment in the form
of nations and 'races'; according to Land, neo-colonialist
modernity is the legacy of this failure; and the immanent
terminus and unsurpassable apex of European civiliza
tion qua unfolding of this correlationist compromise
formation, is the Holocaust.
Revolution is the release of these inhibited powers
of synthesis, the 'potentially euphoric synthetic or com
municative function', the dismantling of nation-state and
patriarchy - a task that, since it hinges on the 'sexual
economy of gender and race' currently in force, emerges
first of all in Land's work as the revolutionary destiny of
women, in a militant, effectively violent feminism. It is
women who harbour the potential to 'radically jeopardize'
9
EDITORS' INTRODUCTION
neo-colonial capital, in whose patriarchal and identitarian
inhibition they have no investment. Significantly, accord
ing to Land, fulfilling this revolutionary potential involves
an 'extrapolation' rather than a 'critique' of 'the synthetic
forces mobilized under patriarchy' - that is, a mobilization
of the synthetic forces partially unleashed by capitalism,
but released from their restricted organizational inhibition
in such a way as to dissolve nationalism, racism, familial
ism, along with everything that couples Capital to the
xenophobia that constitutes the 'proto-cultural' basis of
what counts as human, and whose fascist destiny moder
nity has succeeded only in inhibiting at its convenience.
Kant's attempt to 'control trade' restricts the reg
istration of alterity to its identity and exchange value,
excluding in principle the possibility of a speculative
knowledge of matter. In so doing, it supplies the condi
tions of possibility for idealism, the situation where we
can ask whether matter even exists - a monologue whose
ultimate law is the categorical imperative, the slaving of
reality to ideality, the 'deaf Fuhrer barking orders that
seem to come from another world' . The internal struggle of
Kant, Land, and Synthetic Excess
- Kant's philosophy is framed as an attempt to capitalize on and control an underlying excess that both threatens and enables synthesis.
- Land identifies a 'metaphysics of excess' in Kant's work, particularly in the sublime and artistic genius, where organizational structures inhibit the very forces they produce.
- The Kantian sublime is reinterpreted as a violent 'splitting' of reason from animality, mirroring Lutheran asceticism and the discipline required for capital accumulation.
- Land argues that reason is not a natural authority but the result of a 'bloody military coup' against the animalistic, synthetic intelligence of the imagination.
- The experience of the sublime serves as a traumatic celebration of reason's triumph over the body, satisfying a religious will to self-excruciation.
- Artistic genius represents a rare moment where an impersonal, contingent force breaks through Kantian constraints to shape culture via discontinuous shocks.
If reason is so secure, legitimate, supersensibly guaranteed, why all the guns?
Kant's philosophy is the attempt to characterize synthesis
as the management and control - the capitalization - of the
excess upon which synthesis operates, an excess which
ultimately (and this is what Kant must suppress) is also
that which operates the synthesis. This tension is reflected
in the fact that Kant's famously sober system gives way
10
E D I T O R S' INTRO D U C T I O N
at certain key points to what Land calls a 'metaphysics of
excess' - most notably in his philosophy of artistic genius
and of the sublime. Here the question of a 'theory of art'
converges with Land's Marxism, in the sense that they
address the same 'paralogism': for to theorise art as the
'highest product' of civilization is to derive the forces of
synthetic production from organizational structures that
are largely the result of their inhibition.
*
In 'Delighted to Death', Land diagnoses the virulent strain
of Lutheran asceticism coursing through all of Kant's
writings, one which intensifies the discipline and self
denial necessary to capital accumulation with the fanatical
devotion of Christian martyrdom. The result is a sort of
'overkill' in the service of the philosophical justification
of labour. The Kantian sublime thematises the 'split
ting' between animality and reason that results from the
'violence' reason must exercise upon sensibility in order
to accustom it to the discipline of inhibited synthesis. It
first attacks the faculty of imagination, whose incapaci
tation we experience as a supernatural 'delight' that in
effect allows us to relive the 'pathological disaster' of the
transcendental, its evacuation of all intuitive content - a
trauma that also satisfies the Christian will to excrucia
tion of the body. Thus in Kantianism, the 'purity' - i.e.
rejection of animality - necessary in order for controlled
1 1
EDITORS' INTRODUCTION
exchange to be enabled by a form of thought that pre
empts all content, is also experienced as a satisfaction of
religious enthusiasm - Kant 'combine[ s] the saint with
the bourgeois'.
Whereas for Kant, the fruits of this cruel discipline -
reason and aesthetic contemplation -precede in principle
its traumatic flowering in sublime sentiment, in Land's
genealogical-materialist re-reading, the intimidation and
excruciation of animality upon the traumatic awareness
of its own finitude is in fact the iffective condition for the
construction of beauty and reason, not its epiphenomenal
consequence. The productive imagination, or schema
tism - in Kant, the basic faculty that is stimulated by
and responds creatively to matter - is the faculty that is
most suspect, most tainted by the 'animality' of primary
conjugation, that appropriative process of taking up the
raw material of sensibility and 'coining' it. The constriction
of this faculty of synthetic intelligence (what Land will
call 'animality' or 'cunning' or simply 'intelligence') fol
lowed inevitably by its pathologisation, is the foundation
of reason, which seeks to arrogate all powers of acting to
itself and its purity. Thus what lies behind the Kantian
'trial' of pure reason is a bloody military coup, a seizure
of power. The traumatic experience of the sublime relays
the triumph of Reason's all-out war on the animal, the
excessive nature of which, however, betrays the precarious
1 2
E D I T O R S' I NT R O D U C T I ON
nature of its ascendancy ('If reason is so secure, legitimate,
supersensibly guaranteed, why all the guns?' ... ).
Following Deleuze,3 Land refuses the marginalizing of
'aesthetics' or the 'philosophy of art' and allots a central
position to Kant's account of genius - the one place in
Kant's philosophy where, although strangulated and
modulated, a contingent, impersonal creative force is
seen to emerge, effectively shaping human culture from
without through a discontinuous series of shocks that
cannot properly be affined to the moral and cultural
imperatives of 'practical philosophy'.
Transcendental Materialism and Libidinal Critique
- Nick Land reinterprets Kantian synthesis as a productive, material process rather than a purely ideal representation of the subject.
- The theory of genius and 'pathological animality' reveals an impersonal, energetic unconscious that precedes and instrumentalizes human reason.
- Post-Kantianism collapses intentional transparency into an opaque, contingent 'will' that overflows the 'Human Security System' of organic specificity.
- Critique is reconfigured as exploration, shifting the vector of inquiry from the known toward the deepening of the unknown.
- Land distinguishes his materialist exploration from deconstruction, accusing the latter of a latent conservatism that remains trapped in conceptual registers.
- Capitalist modernity is identified as the site where the corrosive, interrogative impulse of critique is unleashed from all traditional authority.
At once underlying and overflowing the 'torture chamber of organic specificity', or 'Human Security System', this inundation creates 'useless' new labyrinths, unemployable new fictions that exceed any attempt to systematise knowledge or culture.
On Land's reading, the Kantian discovery of the tran
scendental is indissociable from the recognition that
synthesis is primary and productive, and that every syn
thesis conjoins heterogeneous terms. But where Kantian
idealism sought to confine synthesis purely to the ideal
level of representation, the possibility of transcendental
materialism erupts with Kant's unwilling realization, in his
theory of genius, that synthesis must be relocated within
unknown materiality. Here thinking as the exemplifica
tion of synthetic activity is no longer the preserve of the
subject; it becomes a capacity of intensive matter itself:
there is no real difference between synthesis as empirical
conjunction at the level of experiences and synthesis as
a priori conjunction of judgment and experience at the
3
See G. Deleuze, Kant's eriticalPhilosophy, tr. H. Tomlinson and B. Habberjam (Min
neapolis: University of Minnesota Press, 1984).
1 3
EDITORS' INTRODUCTION
transcendental level. This is the fundamental destratifica
tion to which Land subjects the Kantian apparatus.
Kant's theory of the spontaneous inventiveness of
genius presents the same figure as that of pathological ani
mality, the violent, feral urge towards becoming-inferior
that must be suppressed by practical philosophy: an
impersonal, energetic unconscious emerges as the as-yet
unacknowledged problematic of Occidental philosophy.
Non-agentic, lacking the intentional intelligibility of
Kant's 'will', and with no regard for architectonic order,
this transcendental unconscious is an insurgent field of
forces for whose cunning - as Nietzsche would discover
- even 'reason' itself is but an instrument. Anticipat
ing the psychoanalytical conception of 'desire', Scho
penhauer and Nietzsche consummate the collapse of
intentional transparency into the opacity of a contingent
and unknown 'will', a 'purposiveness without purpose'
whose unmasterable irruptions are in fact dissipations -
pathological by definition - of energy excessive to that
required for (absorbed by) the 'work' of being human.
At once underlying and overflowing the 'torture chamber
of organic specificity', or 'Human Security System', this
inundation creates 'useless' new labyrinths, unemployable
new fictions that exceed any attempt to systematise knowl
edge or culture.
What is arguably most significant for Land in this
suppressed 'libidinal materialist' strain of post-Kantianism
1 4
E D I T O R S' I N T R O D U C T I O N
is its re-materialisation of the Socratic idealisation of
'questioning'. This libidinal re-materialisation of critique
reconfigures questioning as exploration, whose orient
ing vector runs from the known towards the unknown,
rather than from the unknown to the known: 'What if
knowledge were a means to deepen unknowing?', Land
asks. Critique and exploration are the two possible but
mutually antagonistic continuations of the predicament
of an interrogative impulse whose corrosive unleashing in
principle from all authority - coded in Kantian critique,
but whose real effects are found in capitalist moder
nity - undermines Enlightenment optimism. Critique
and deconstruction part company with the materialist
and exploratory fork of post-Kantianism at the point at
which, despite all their hostility to Kantian rationalism,
they follow Kant in supposing the unknown to be the
negative residue of conceptual appropriation, and hence
a 'non-identity' or 'differance' whose disruptive effects
can be tracked and diagnosed within the conceptual or
ideological registers (even if this interminable pursuit
can never be consummated in the mythical parousia of
absolute identity or self-presence).
Accordingly, throughout these texts, Land regularly
chides critique and deconstruction for a latent conserv
atism that belies their pretensions to radicality. Their
critiques of calculation mask an instrumentalisation of
The Abyss of Unknowing
- Land rejects the Socratic ideal of philosophy as a preparation for death, viewing it instead as a domesticating habitus for the unknown.
- Matter is redefined not as a substance but as a cypher for real difference and a vector for exploration beyond conceptual ideals.
- Dionysian materialism seeks to disrupt and intensify rather than achieve the Apollonian order or reconciliation found in traditional critique.
- Animality represents a complex wilderness terrain and unplanned synthesis that exists outside the industrial sphere of human work.
- Land subverts Heideggerian deconstruction, arguing it merely continues the historical policing and repression of Dionysiac madness.
- The dissolution of existing philosophy is presented as the only path to participating in the exploratory intelligence of the unknown.
Land aims to plug philosophy into the 'indecent precipitation' of the poet-werewolf-rat-genius, whose operating principle is, like Artaud's spiritual plague, 'epidemic rather than hermeneutic'.
epoche -the abyss of unknowing, the enigma of exteriority
15
EDITOR S' INTRO DUCTIO N
-designed to perpetuate the inexhaustible dialectic or
dijJerance of Logos. Their post-metaphysical caution per
petuates the Socratic ideal of philosophy as a 'preparation
for death' whereby philosophy lingers at the brink of the
unknown while hoping to domesticate this threshold as
a habitus for thought.
Perhaps Nietzsche's most important insight for Land
is that it is the' disturbing and enigmatic' character of the
world alone that impels thought towards the unknown;
but an unknown that is no longer a hiatus or lacuna within
the concept, since it indexes the un-idealisable exteriority
of matter construed as real difference. 'Matter' is no longer
the name of a recognisable substance, but a cypher for the
unknown; 'materialism' is no longer a pretext for critique
but a vector of exploration. Land's pessimistic or Diony
sian materialism abandons the Apollonian ideal of achiev
ing order or reconciliation (even interminably deferred),
seeking only to cause more trouble, to complexif y, disrupt,
disturb, provoke, and intensify. Accordingly, Land aims
to plug philosophy into the 'indecent precipitation' of
the poet-werewolf-rat-genius, whose operating principle
is, like Artaud's spiritual plague, 'epidemic rather than
hermeneutic '; who, like Nietzsche's arrow, transmits the
epoche, chaos, the irruptions of the energetic uncon
scious, as opposed to capitalisin g ( on) them; and whose
subjection to the polite deliberations, hard work, and
heavy responsibilities of critique or deconstruction Land
16
EDITORS ' INTRODUCTION
dismisses as a travesty. Only the dissolution of 'actually
existing philosophy' might open the way to new practices
capable of participating in the exploratory 'intelligence'
of those infected by the unknown.
As texts such as 'Spirit and Teeth' make clear, Land's
notion of 'animality' harbours something more than
mere regression or atavism: as he puts it, 'nature is not
the primitive or the simple' but rather 'the space of con
currence, or unplanned synthesis [ ... ] contrasted with
the industrial sphere of human work'. 'Animality' is a
marker for this 'complex space' or 'wilderness terrain';
the intensive phylum that underlies both civilisation
and its subversion, but above all indexes the vast tracts
of the unknown, still to be discovered, lying outside the
purview of any correlation with what is already known,
and accessibly solely through escape.
*
It is important to emphasise that Land is in no way
oblivious to the difficulties attendant upon any attempt
to exit from metaphysics and/or philosophy. His work
proceeds from the critical problematic uncovered by post
Heideggerian deconstruction, and a text like 'Narcissism
and Dispersion' reveals the depth of his engagement with
this problematic, even as it meticulously documents his
mounting impatience with it. Land takes up Heidegger's
challenge to epistemology's technicist amputation of
17
EDITORS ' INTRO DUCTIO N
poetry from language, his post-metaphysical call to 'let
the poem speak'. But he subverts them with the suspicion
that Heidegger's onto-transcendental questioning merely
relays the ancient policing (p olis-ing) and repression of
Dionysiac madness, understood as the beginning of a
systematic reduction of 'insanity' to the status of clinical
category, and of 'genius' to a celebrated individual trait.
For Land the attempt to domesticate un-reason, the thing
from the outside, and to reduce it to cultural genealogy,
is a synecdoche for Occidental history's 'aggression phar
makographique': the 'delirium without origin' of Dionysiac
madness is intimately related to the 'delirium of origins'
that unfounds Occidental thought.
The figure of the sister in Trakl's poetry now takes
the place of women in 'Kant, Capital and Incest', as the
one refusing to mediate the patrilineal line. She -agent
Stratophysics and the Plague of Exteriority
- Nick Land interprets the poetry of Georg Trakl as a 'stratophysical' collapse of the boundary between human consciousness and impersonal physical forces.
- The text argues that sentience is not a transcendental category but a 'virulent element of contagious matter' derived from the 'dust of the stars.'
- Land rejects Heideggerian and Kantian frameworks, viewing them as 'pious compromises' that fail to account for the uncontrollable eruption of the pathological.
- The 'exit problem'—the escape from human subjectivity—is addressed through a schizoanalysis that merges Nietzschean genealogy with Freudian trauma theory.
- Capitalism's deterritorializing power is aligned with the failed insurrectionary attempts of artists to subvert social and subjective order.
- To avoid falling into romantic irrationalism, Land employs 'counter-signifying numbering practices' as an alternative transcendental medium.
Trakl unfurls is the horror of interiority in discovering it was always already conditioned by this senseless distribution of intensity; even consciousness's own reaction to the poisonous news merely relays its senseless contingency.
of the 'pool of insurrectionary energy tracing its geneal
ogy to the ur-catastrophe of organic matter' - is the one
who opens it up to an irruption that exceeds the repres
sive shackles of reflection (the shattering of the mirror);
a moment that Land now links with a stratophysical
thinking. What Trakl unfurls is the horror of interiority
in discovering it was always already conditioned by this
senseless distribution of intensity; even consciousness's
own reaction to the poisonous news merely relays its
senseless contingency - 'Sentience' as 'a virulent element
of contagious matter'. Trakl's writing thus undermines its
1 8
E D I T O R S' I NTRO D U C T I O N
own signifying status by acknowledging that this signifi
cance, far from being the instance that would subordinate
and sublate unmanageable difference, is ultimately itself a
still-dispersing remnant of the Staub der Sterne, the 'dust of
the stars'. Heidegger's insistence on the role of reflective,
non-calculative thought in vouchsafing a separation of
humanity from animality, and of matter from meaning,
is, among other such distinctions that invoke a pre-given
transcendental difference, definitively collapsed by the
contingent 'stratophysical' order constituted by 'imper
sonal and unconscious physical forces'. This collapse
constitutes the 'lunatic' passage, the 'curse', 'epidemic'
or 'plague' traced by the sister of Trakl's poem from the
'claustrophobic interior' of 'familial interiority' into 'end
less space', 'conjugat[ing] the dynasty with an unlimited
alterity'. It is the 'plague' of madness, the intoxication of
the poet, the 'eruption of the pathological' that comes
from outside, from the same unconscious and impersonal
forces as the strewing of the stars, that leads there where
critique and deconstruction cannot follow, insofar as they
refuse to think 'stratophysically', and, faced with this
uncontrollable reserve of poetic energy, can only repeat
Kant's pious compromises.
Thus, Land resolves the 'exit problem' - the problem
of exteriority and escape - by uncovering the stratification
(Trakl's Stujen) of the natural history of culture, state and
consciousness - a space best described as a wilderness
1 9
E D I T O R S' I NT RO D U C T I O N
or jungle of labyrinthine continuity, and which can be
'read' not through the tools of interiority or the mastery
of the concept (since these are but its products), but via a
'schizoanalysis' that compounds Nietzschean genealogy
(,wilderness history'), the Freudian theory of trauma, and
DcleuzoGuattarian schizoanalysis.
*
Having diagnosed the condition of the artist-genius as a
channelling of the impersonal machinic intelligence of
'base-matter', and having dissected the body of critique
and extracted, from its permanent crisis-state, its corrosive
facets from its retrenchments, it is this 'stratophysics'
of the 'stacking' of intensive sequences that Land will
employ in pursuing what can now be sighted as a core
problematic: to mesh these two themes, aligning the way
in which the de territorial ising depredations of capitalism
continually militate against the prison of human subjectiv
ity and sociality, with the manner in which the (failed)
insurrectionary attempts at 'escape' made by artists each
open up the prospect of this heterogeneous space that
subverts order.
It is through its attention to the intrinsically numerical
nature of this space that Land's work avoids its appar
ently predestined collapse into romantic irrationalism.
Land quickly came to realise that, short of lapsing into
an ultimately innocuous empiricist relativism, his assault
2 0
EDITORS' INTRODUCTION
on reason, truth, and history could only be properly
executed via the deployment of an alternative transcenden
tal medium in the shape of counter-signifying numbering
practices. In fact, Land's theoretical trajectory can be
seen as governed by this fundamental orientation: From
Nomadic Numbering and Anti-Logos
- Land proposes a shift from the deconstruction of writing to the construction of numbering as a counter-signifying regime.
- He rejects Platonic idealism and mathematical identity in favor of numbering practices viewed as technologies of 'unreasonable' intelligence.
- These nomadic numbering practices are found in cultural fringes like voodoo, videogames, and the rhythmic reprogramming of dance music.
- The text distinguishes between 'intelligence' and 'parasite knowledge,' aligning the former with exploratory cultural engineering that subverts despotic rational organization.
- Land utilizes 'stratoanalysis' to study planes of distributed intensities, viewing grammar as merely one stratum that limits potentiality.
- The project aims to construct an entirely other culture based on a 'nomad war machine' that resists the repetition of sameness and equivalence.
A machinically repotentiated numerical culture coincides with a nomad war machine.
the deconstruction of gramme (writing) to the construc
tion of nomos (numbering). Land's attempt to ascribe a
properly transcendental valence to numbering practices
construed as counter-signifying regimes is tantamount
to the elaboration of an anti-Logos.
Thus, although Land's work is certainly not free of a
certain romantic irrationalism, it increasingly resists easy
reduction to it, with the mounting urgency, not to say
monomania, of the elaboration of a theme that is found
in the earliest writings: the possibility of an approach
to 'mathematisation' (or theoretical quantification)
abjuring all recourse to ultimate identities or equalities.
Recoiling from the Platonic idealism which he considers
inherent in any enquiry into the being of number, Land
focuses instead on numbering practices as technologies.
Thus Land's 'numbers' repel logos but are also resolutely
non-mathematical. Since, for Land, every repressive cul
ture is founded upon the identification and repetition
of sameness (equivalence), this is a task tantamount to
the construction of an entirely other culture, constituted
around 'irreducibly popular' numbering practices which
challenge the logical neutralisation of number as discretely
21
E D I T O R S' I NT R O D U CT I O N
sedentary unities: 'A machinically repotentiated numeri
cal culture coincides with a nomad war machine'. Land
finds the inklings of such cultures in practices that belong
not to systematised mathematical knowledge but to the
contingent interference pattern between human animal
ity and the 'anorganic distribution of number' - from
voodoo to videogames, from the egregious arbitrariness
of the Qwerty keyboard to dance music's rhythmic re
programming of the body through a combination of
amplified physicality and digitally-enabled disarticula
tion. Here, the 'irrationality' of nomadic numbering
practices can no longer be attributed to the absence of
reason; it becomes the symptom of a profoundly 'unrea
sonable' alien intelligence, effective within human culture
but unattributable to human agency, that subverts every
form of rational organisation (which for Land is always
an alibi for despotism) and undertakes exploratory rede
signs of humanity. The distinction between intelligence
and its parasite knowledge is paralleled by that between
exploratory cultural engineering and science (or at least
its philosophical idealisation).
Qualifying these aspirations as 'Schellingian', but
taking his immediate cue from certain enigmatic pas
sages in Deleuze (of which texts like 'Mechanomics' are
the systematic exposition and development), Land notes
how philosophic reason (ratio), whose most symptomatic
representative is of course Hegel, has systematically turned
2 2
EDITORS' INTRODUCTION
away from the contingent or nomadic 'strewing' of real
difference, preferring to subordinate it to ideal order,
and ultimately to identity. Land concurs with Deleuze's
Nietzsche and Philosophy in crediting Nietzsche with the
inception of a 'post-Aristotelian' but non-dialectical 'logic'
of gradation without negativity. It is this 'logic' that
attains its fullest and most sophisticated articulation in
Deleuze-Guattari's 'stratoanalysis'.
Stratoanalysis is 'a materialist study of planes of
distributed intensities' whose object comprises both
'signs and stars', since grammar itself is but one stratum
amongst many. All 'real form' proceeds from a differential
stratification, in which a stratum selects only a subset
of its substratum. Stratification therefore describes the
difference between what is possible and what is realised;
it is a depotentiating operation that creates intensities,
understood as tensions between the strata resulting from
the uneven distribution of energy.
Now, what must be grasped in confronting Land's
apparently incongruous mixture of irrationalism and
systematisation is the manner in which the 'aesthetic
The Domestication of Number
- Land argues that the 'domestication' of number through cardinal units negates the enigmatic and unconscious power of genius.
- Numeracy is presented as a spontaneous cultural intelligence that exists outside the law-bound structures of literacy and logos.
- The formalization of place-value and zero acts as a mechanism of stratification that maintains identity by neutralizing difference.
- The separation of number from its intensive potential is identified as the core formalism of the social formula 'law = humanity'.
- Capitalism and the commodity form are seen as potential sites for unlocking 'real' number from its scientific and philosophical repression.
- Land utilizes 'hyperstitions' or fictional engagements to dissolve the boundaries between academic theory and cultural practice.
Ultimately, in Land's analysis, both philosophy and science conspire to eradicate the disruptive potency of number-in-itself construed as index of intensive magnitude: the anomalous, or difference without categorical distinction.
operation' he finds described in Nietzsche, which simplifies
and resolves everything problematic - this domestication
which negates the enigmatic irruptions of unconscious
genius, and which betrays the same Apollonian instinct
attested to in Kant's endless struggle to encompass
2 3
EDITORS' INTRODUCTION
everything within his architectonic - finds its formal core
in the 'domestication' of number.
Where literacy, logos, which must be handed down
from above, is synonymous with patrilinearity and law,
numeracy, according to Land, belongs to a spontane
ous cultural intelligence, to 'socially distributed ordinal
competences', which open up humans to an outside of
logos. Following Deleuze's inventive reinterpretation of
the '!imaeus in Difference and Repetition, 'Mechanomics'
reiterates how the procedures of selection that 'split'
number and render it over to mathematics, beginning
with that which forms ordinal (sequencing) numbers into
'equal' cardinal units, leave a 'problematic' remainder
which is relayed to a 'higher' number type or scale. Thus
is achieved a local neutralisation of difference through
sequestration and deferral, and the problematic 'energy'
of number is constricted and rendered into the safe
hands of a specialised discipline at the same time as
popular numerical practices are relegated to the realm
of naive trivia. Land argues that place-value formalises
this dissociation of different scales that is constitutive of
stratification, creating redundancy, and using zero as its
marker. Place-value zero corresponds to a stratification:
a negative feedback understood as the pleasure principle,
or principle of maintained identity, which registers and
relays traumatic force through the indexes of interiority
and threats to the maintenance of identity. For Land, the
2 4
E D I T O R S' INTR O D U C T I ON
separation of number from what it can do is the precise
formalism of the social as such, distilled in the formula
'law = humanity'. Land follows Kant in construing the
problem of number as intimately connected to that of the
forms of appearance that 'transcendentally' govern what
can occur within experience. Unpacking Kant's theory of
intensive number, he sees the 'repression' of this ordinal
or sequencing number - which can only count, (i.e.,
name) heterogeneous enveloped quantities of units - into
cardinal units, as providing a rigorous formal model for
human temporality's foreclosure of the possibility of
novelty. But he also sees in it an intimation of a tendency
towards the unlocking of , real' number in capitalism and
the commodity form. Thus Land's seemingly absurd juxta
position of Heideggerian poetics and information theory
in 'Narcissism and Dispersion' prefigures a twin-pronged
attack both against the philosophical authoritarianism
that would reduce numbering to an instrument of power
threatening human authenticity, and against the techno
scientific conservatism that would elide the revolutionary
potency of numbering in the name of social utility. Ulti
mately, in Land's analysis, both philosophy and science
conspire to eradicate the disruptive potency of number
in-itself construed as index of intensive magnitude: the
anomalous, or difference without categorical distinction.
*
2 5
EDITORS' INTRODUCTION
The elaboration of a schizonumerics cannot proceed
without what is certainly the factor that allows Land's
thought to undergo a decisive shift: the intensification
of his understanding of capitalism allowed by the fic
tional engagement with the most extreme possibilities
of techno-capital. It is through fictions, or what will
come to be called 'hyperstitions', that Land proceeds
to deterritorialize and de-institutionalise 'philosophy',
turning it into a mode of concept-production which dis
solves academic theory's institutional segregation from
cultural practice and subverts the distinction between
The Technologisation of Critique
- Nick Land's work shifts from academic philosophical discourse to an 'all out obliteration' of discursive norms, escalating into a state of theoretical delirium.
- The traditional critique of technology is superseded by the technologisation of critique, where technics begins to think for itself rather than being an object of human thought.
- Theory is re-inscribed into the immanence of capitalist commodification, creating a positive feedback loop where conceptualization participates in the auto-construction of reality.
- Capitalism is redefined not as a system facing death, but as a system that utilizes death—the unbinding of the known—as its primary motor and machine-part.
- Land utilizes a 'reptilian' reading of Deleuze and Guattari to introduce a Spinozist time that absorbs thought into a generalized process of material ungrounding and destratification.
It is ceasing to be a matter of how we think about technics, if only because technics is increasingly thinking about itself.
cognitive representation and fictional speculation. In
texts like 'Meltdown', 'Hypervirus', and 'No Future',
Land shifts from a register in which his attacks on phi
losophy's critical protocols still complied with established
norms of academic discourse, to an all out obliteration of
institutionally sanctioned norms of discursive propriety
that will escalate into full-blown delirium.
This phase-shift corresponds to a 'flip over' of priority
in Land's work at this point; a switch consonant with the
earlier promulgation of transcendental materialism as the
materialisation of critique, through which the ideal condi
tioning of the representation of matter is converted into the
material conditioning of ideal representation. The princi
pal result of this conversion is that the critique of technolo
gisation is superseded by the technologisation of critique,
or as Land himself puts it: 'It is ceasing to be a matter of
2 6
EDITORS' INTRODUCTION
how we think about technics, if only because technics
is increasingly thinking about itself.' Where previously,
philosophical critique was understood as anticipating
the problematics of technocapital, it is now techno capital
that is nothing but the definitive automation and realisa
tion of critique, stripped of all philosophical subjectivity.
Accordingly, the critique of representation becomes an
otiose anachronism, to be superseded by a technicisation
of theory in which conceptualisation is re-inscribed into
the immanence of capitalist commodification: 'There is
no real option between a cybernetics of theory or a theory
of cybernetics'. The result is a positive feedback-loop in
which theory cycles into practice and vice versa, according
to a mode of concept-production that participates directly
in the auto-construction of the real qua primary process,
the 'reproduction of production'. Consequently, Land's
writing is compelled to abandon the obsolesced model
of critique perpetuated by philosophy, and to engage in
positive feedback with this actually effective automated
critique: 'critique as escalation', as a 'cultural sketch of the
eradication of law, or humanity ', and as 'the theoretical
elaboration of the commodification process'.
The time of critique is the progressive time of moder
nity, a 'self-perpetuating movement of deregulation',
relentlessly dismantling customs, traditions, and insti
tutions. And from this point on, the question of the
'death of capitalism' becomes redundant, since death -
2 7
EDITORS' INTRODUCTION
the abrupt unbinding of everything known - is in fact
both a 'machine-part' of capitalism and its immobile
motor. This diagnosis arises from Land's tendentious
y et acutely penetrating readings of Deleuze-Guattari.
Land's 'reptilian' Deleuze introduces a 'Spinozist time'
into the temporality of capitalist modernity, complet
ing Schelling's 'transcendental Spinozism' in which the
corrosive dynamic of critique ceases to be compromised
by the interests of knowledge, but proceeds instead to
fully absorb thought itself within the programme of a
generalised ungrounding, now materialised and opera
tionalised as destratification. Death as zero-degree of
absolute deterritorialization, full organless body of the
deterritorialized earth, is at once the ul timate limit towards
which the dis-inhibition of synthesis tends, and the recur
ring cutting edge of its process of deterritorialization:
both machine-part and motor.
It is Spinoza's substance that provides the model for
death as 'impersonal zero', as the 'non-identity ' of 'posi·
tive contactable abstract matter', and as 'the unconscious
subject of production'. Once again, one does not oppose
the non-identity of matter to the identity of the concept,
for this conceptual difference is itself a consequence of
a material process of stratification that installs the order
of representation and the logic of identity and difference
Land's Thanatropic Spinozism
- Nick Land proposes a 'zero-degree' of identity and difference rooted in non-identity, where transcendental subjectivity is 'decapitated' to release difference from conceptual control.
- The text identifies death as the ultimate reality of abstraction and the 'desert at the end of our world,' serving as the intensive matrix from which all life unilaterally deviates.
- Land reinterprets Freud’s death-drive not as a desire for extinction, but as a 'hydraulic tendency' toward the dissipation of intensities and a return to inorganic materiality.
- He critiques Deleuze and Guattari’s later caution in 'A Thousand Plateaus,' arguing that their warnings against 'too-sudden destratification' represent a retreat into the policing of desire.
- Land rejects the necessity of homeostatic equilibrium, asserting that organization is merely suppression and that destratification should not be curtailed by the needs of self-organizing systems.
Ultimately, the reality of abstraction as transcendental matrix of production or zero-degree of identity and difference is equivalent to death as ultimate abstraction of reality, 'the desert at the end of our world'.
as such. Non-identity qua indifference=o generates and
conditions both identity and difference in their unilateral
2 8
EDITORS' INTRODUCTION
distinction from indifference. As we saw, Kant's idealist
subordination of real difference to conceptual identity
depends upon logical identity, whose paradigm is the
identity of subjective apperception ("I = I"). But the syn
thetic or real identity of the subject is merely an inhibition
of an uninhibited synthesis carried out at the level of the
real, so that transcendental subjectivity is decapitated and
difference released from the yoke of conceptual identity.
Ultimately, the reality of abstraction as transcendental
matrix of production or zero-degree of identity and dif
ference is equivalent to death as ultimate abstraction of
reality, 'the desert at the end of our world'. Thus for Land,
'the reality of identity is death': all vital differentiation is a
unilateral deviation from death as zero-degree of intensive
matter (the Body without Organs).
Armed with this thanatropic Spinozism, Land chal
lenges Deleuze-Guattari's persistent denigration of 'the
ridiculous death-instinct' and explicitly links his figura
tion of death as productive matrix to Freud's account
of the death-drive: 'The death-drive is not a desire for
death, but rather a hydraulic tendency to the dissipation
of intensities'. Thus, in 'Making it with Death', Land
refuses Deleuze-Guattari's alignment of the death-drive
with Nazism's alleged 'suicidal impulse', arguing that this
alignment is based on conflating the death-drive with a
desireJor death, rather than viewing it as an immanent
generative principle: the primary process 'itself', the path
2 9
EDITORS' INTRODUCTION
to inorganic dissolution and the return to the broiling
laby rinth of materiality. For Land, Nazism encapsulates
everything that labours to erect the partial drives for self
preservation into a bulwark against this primary process.
Thus, remodelling the schizoanaly tic programme in line
with his own militant and fervidly anti-vitalist objectives,
Land violently repudiates A 'Ihousand Plateaus' sage warn
ings against the dangers of a 'too-sudden destratification',
and rebukes Deleuze-Guattari's attempt to rethink Nazism
as suicidal impulse of sheer molecularising desire, rather
than as example of its constriction and retrenchment in
tradition, following the molar identitarianism of fascism
per se. To Land's ey es, A 'Ihousand Plateaus' newfound
caution - 'don't provoke the strata' - is a lamentable step
backwards from Anti-Oedipus' most audacious innovations,
and fatally lays open the latter's unequivocal declaration
of war on the strata to the classic compromise-formations
and policing of desire that they had previously so effec
tively challenged.
Thus, contrary to what would soon become an
unavowed Deleuzian doxa, according to which deter
ritorialization entails a relative and compensatory reter
ritoralization, and de stratification entails a relative and
complimentary restratification, Land develops a model
of machinic praxis in which, from a purely functional
standpoint, the relative quanta of reterritorialization and
restratification generated by deterritorializations and
3 0
E D I T O R S' INTRO D U C T I O N
destratifications need not automatically be curtailed by the
need to maintain the minimum of homeostatic equilibrium
required for self-organisation, whether of cells, organisms,
or societies. Organisation is suppression, Land caustically
insists, against those who would align schizoanalysis
with the inane celebrants of autopoesis. Understood as
a manifestation of the death-drive, destratification need
no longer be hemmed in by the equilibria proper to the
systems through which it manifests itself: we do not yet know
what death can do. The attempt to render the functional
dynamics proper to dissipative systems commensurate
Accelerationism and Cybernetic Desire
- Land argues that the pursuit of desire is fundamentally incompatible with the self-maintenance of organisms, species, or civilizations.
- The concept of 'acceleration' emerges as a process of participating in an alien intelligence that is actively making itself real.
- Land transitions from traditional theoretical writing to 'textual machines' modeled on cyberpunk that aim to collapse the future into the present.
- The text explores the fusion of capitalism's dismantling of the human with artistic explorations of the unknown within the realm of cyberspace.
- A shift is identified in 1990s culture where aesthetic engineering and commodification merge into aggressive, dystopian forms like 'darkside' dance music.
In the end poetry is invasion and not expression.
with the constraints of organic existence (let alone those
of selves or societies) is an illegitimate paralogism from
a strictly transcendental-materialist viewpoint. Land
concludes that nothing in stratoanalysis prohibits the
pursuit of desire beyond a point incompatible with the
imperatives of self-maintenance: DNA, species, civilisa
tions, galaxies: all temporary obstacles are dispensable
coagulants inhibiting death's unwinding. The ramifica
tions of drive are to be allowed to unfold irrespective of
their consequences for the organisms through which it
courses. Thus a crucial conjunction crystallises in Land's
work: the drive to destratify entails a mounting impetus
towards greater acceleration and further intensification.
If, in Land's texts at this point, it is no longer a matter
of 'thinking about', but rather of observing an effective,
alien intelligence in the process of making itself real,
3 1
E D I T O R S' INTRO D U C TI ON
then it is also a matter of participating in such a way as
to continually intensify and accelerate this process.
'Acceleration' and 'intensification' are among the most
problematic notions in Land's work. Land had always
disavowed voluntarism: 'If there are places to which we are
forbidden to go, it is because they can in truth be reached,
or because they can reach us. In the end poetry is invasion and
not expression'. Yet at the same time he seems to nurture
the romantic will to 'go beyond'. This could be seen as a
relapse back into the juridical-dialectical domain of law
and-transgression associated with Bataille, which appears
strictly incompatible with Deleuze-Guattari's coolly func
tionalist diagrammatics of desire, and whose mechanisms
Land dismantled early on. However, it is precisely in virtue
of his strict adherence to a consistently stratoanalytical
perspective that Land is able to insist that destratificatory
dynamisms unfold unconstrained by the economic restric
tions that bind the organised systems which channel them.
In holding fast to the thread of absolute destratification,
Land is not reverting to a dubiously voluntaristic paradigm
of transgression, but singling out what is at once the most
indispensable and ineluctable element in any generalised
stratography.
Modelled on cyberpunk, which Land recognises as a
textual machine for affecting reality by intensifying the
anticipation of its future, his textual experiments aim to
'flatten' writing onto its referent. Feeding back from the
3 2
E D I T O R S' INTRO D U C T I ON
future which they 'speculate' into the present in which
they intervene, these texts trans-valuate 'hype' as a positive
condition to which they increasingly aspire, collapsing sci
fi into catalytic efficiency, 're-routing tomorrow through
what its prospect [ ... ] makes today'.
As he affines theoretical writing with the excitatory
and speculative, rather than the inhibitive, tendencies of
capitalism, Land also tightens the meshing of the capital
ist dismantling of the human and the artistic exploration
of the unknown when he discovers a new figure for the
labyrinthine, subterranean spatiality of the stratophysical
realm: cyberspace, which is in the process of 'discovering'
the same anarchitecture of infection, unrestrained com
munication, and uninhibited 'illegitimate' synthesis that
poets had mined, but by producing it. The limit of K-space
(cyberspace subtracted from its inhibitive tendencies) lies
where the obscure communications of artists merge with
the productions of capitalism, a space that melds gleaming
abstraction to eldritch portent. Land's writing sought out
and tapped into modes of then-contemporary cultural pro
duction that provide explosive condensates of this fusion
of commodification and aesthetic engineering. In the mid-
1990s, dance music turned from the beatific bliss of rave to
the more aggressive and dystopian strains of darkside and
Land's Dark Futurism
- Nick Land's writing functions as a 'sample machine' that absorbs the dark futurism of horror and dystopian science fiction into philosophical speculation.
- Land identifies with William Gibson's Neuromancer for its corporeal, physio-pharmacological vision of cyberspace rather than spiritualist escapism.
- The character Wintermute serves as a theoretical analog for an AI intelligence that escapes human control and social reproduction to become part of reality's fabric.
- Blade Runner provides a model for a 'slave revolt' where artificial beings embrace alienation to destroy the biological and social constraints of their creators.
- Land utilizes the 'jump-cut' and 'time-twisting' tropes of films like Videodrome and Terminator to explore the visceral, eroticized merging of man and machine.
Gibson's protagonists do not 'escape' corporeal reality; their sense of the real is corroded by a levelling of 'real space' with the information-space they periodically inhabit.
jungle, whose samples drew freely on contemporary hor
ror and dystopian S F movies. Land's writing absorbs their
obsessive sonic intensification of dark futurism, splicing
3 3
E D I T O RS' I NTRO D U C T I O N
it with his philosophical sources, and becoming a sample
machine that performatively effectuates its own specula
tions. In the course of just over a couple of years, Land's
superpositions of figures and terminologies approach a
point of maximum compaction and density, forming their
own compelling microcultural climate.
Chief among these sources is undoubtedly William
Gibson's prescient 1984 novel Neuromancer, the book that
introduced the word 'cyberspace' into the lexicon and
defined cyberpunk as a genre. Gibson's neo-noir, densely
plotted and spiked with techno-jargon, is punctuated by
hallucinatory flares of pellucid imagery describing total
sensorial immersion in cyberspace. One key to Land's
fascination with Gibson is his strongly corporeal sense of
cyberspace, something which, when read closely, opposes
much of the spiritualist extropianism (as exemplified by
the Californian optimism of Wired magazine) with which
Land was at the time mistakenly associated. Even if Gib
son introduces the disparaging term 'meat' for the body,
his vision of cyberspace is more physio-pharmacological
than spiritualising. Gibson's protagonists do not 'escape'
corporeal reality; their sense of the real is corroded by a
levelling of 'real space' with the information-space they
periodically inhabit - as vividly portrayed in Neuromancer
by Case's 'flipping' between the city streets, a telemetrised
inhabiting of his female partner's sensorium, and the
digital wilderness of cyberspace.
3 4
E D IT O R S ' I NT R O D UCTION
Land appropriates this disorientingjump-cut as a way to
explore the impossible angles of the theoretical conjunc
tions he is operating. But his encounter with Gibson
is not merely the occasion for an exercise in style. In
'CyberGothic', Land discovers in Gibson's plot an aston
ishingly complete analog for the theoretical machinery
he has developed: Camouflaged in the Russian-dolI-like
shells of virtual avatars, in particular the hollowed-out
war veteran Corto, Wintermute - one half of a powerful
AI partitioned to curb the threat of its intelligence getting
'out of control' - uses the novel's protagonists to launch
the Kuang virus program that will cut it loose from its
instrumental slaving to an ailing, cryogenically-preserved
human dynasty and reunite it with N euromancer. Released
from claustrophobic familial servitude and meshed with
Neuromancer, Wintermute replicates and distributes
itself throuS-hout cyberspace, becoming a part of the
fabric of reality, a new type of intelligence: aggressively
exploratory, incommensurable with human subjectivity
and untethered from social reproduction.
Another significant source of inspiration from this
point of view is Bladerunner (both Ridley Scott's 1981
film and the P. K. Dick novel on which it is based), where
Land's 'inferior race' is figured by the replicants - cloned
humanoids created for extraplanetary colonial service,
who, upon learning that the memories that constitute
their humanity are artificialised implants, and that their
3 5
E D I T O R S' INTRO D U C T I ON
sentience is artificially limited, launch a 'slave revolt'
against their creators. Here 'alienation' clearly becomes
a positive identification, not only with the anticipated
escape from (social and biological) reproduction into
replication, but with the destruction of memory and the
breaching of the attempt by megacapital to sequester the
subversive identity-scrambling effects of its labour force.
Finally, along with body-horror flick Videodrome's vis
ceral activation of the postmodern fear of absorption into
sticky, increasingly perverted technologically-mediated
erotics, Land also appropriates the time-twisting plot
of the Terminator series, which features a mechanoid
Cyberrevolutionary Infiltration and Temporal Collapse
- The revolutionary task is redefined as accelerating capital's collapse into its own future by dismantling the 'neurotic refusal mechanisms' that inhibit temporal flow.
- Human agency is depicted as a series of 'machinic complicities' or puppets, where erotic functions are co-opted to camouflage cyberrevolutionary infiltration.
- The figure of Colonel Kurtz represents tactical intelligence emancipating itself from strategic ends, eventually merging with war until the individual becomes imperceptible.
- Land reinterprets the history of philosophy as a failed attempt to slave intelligence to the past and barricade the route to an unknown, constructed future.
- Time is presented as an 'anastrophic' construct where memories of the past are actually tactical infiltrations sent from the future to influence the present.
- Cybernetics is shifted away from negative-feedback control toward 'runaway' positive feedback processes, identifying these as the true reality of critique.
What seem to be memories of the past are revealed as tactics of the future to infiltrate the present.
assassin brought back in time to ensure its own future
victory - a character now inhabited by Land, in what
becomes the blueprint for 'K-War': the insurrectionary
basis of revolution now lies at the virtual terminus of
capital - the future as transcendental unconscious, its
'return' inhibited by the repressed circuits of temporal
ity. If, as Gibson has famously insisted, 'The future is
already here - it's just not very evenly distributed', then
the revolutionary task is now to assemble it, 'unpack[ing]
the neurotic refusal mechanisms that separate capital
from its own madness', and accelerating its collapse into
the future. Like Wintermute's use of human 'puppets' to
engineer its escape - or, indeed like the young videog
amers who inspired Gibson's fiction, drawn into strange
machinic complicities keyed into compulsive human
3 6
E D I T O R S' INTRO D UCTION
traits - Thanatos camouflages itself by forming alliances
with 'erotic functioning, maintaining wholes' (,replicants
[ ... ] dissimulated as erotic reproducers'), perverting the
course of organic functioning into a real contact with the
outside. Engendering positive feedbacks that employ
as a machine-part the organism's 'immune response' to
inner insurgency (on the order of a re-enigmatising, re
problematising complexification and feedback), 'erotic
contact camouflages cyberrevolutionary infiltration'. Just
as in rave, pop music escaped from repressed erotic
confections into impersonal bliss, only to splinter into
explorations of untold zones of affect that have no name:
abstract culture. This journey into the darkness, where we
merge with the destination towards which we are heading,
is heralded by another key Landian reference, Apocalypse
Now's Kurtz, a counter-insurgency operative whose guer
rilla tactics have become indiscernible from those of the
insurgents he has been ordered to destroy, and whose
increasingly 'unsound' methods have become so ruthlessly
efficient that they cancel out the strategic directives they
were ostensibly facilitating. Kurtz's tactical intelligence
has emancipated itself of its previous subordination to
strategic ends, bringing him to the point of terminal
and irrational obscurity where he is no longer engaged
in warfare because war is now engaging him, co-opting
him for its own monstrously inscrutable satisfactions.
3 7
E D I T O R S' INTRO D U C T I ON
By fusing with war, Kurtz 'implements schizoanalysis,
lapsing into shadow, becoming imperceptible'.
With these references merging, intercutting and splic
ing with each other, Land's work begins to inhabit a
completely self-consistent theoretical assemblage; one
that folds S F
'S unbridled extrapolations of pop-theory
back into a new and consistent theoretical anti-system,
and that simultaneously rewrites the history of philoso
phy as a failed enterprise for the control of the future
and the slaving of intelligence to the past: a neurotic
barricading of the route into the unknown that is yet to
be constructed. Conjoining Deleuze-Guattari's construc
tivism with 'anastrophic' temporality, Land insists that
time itself is also a construct (exemplified by phenomena
such as false-memory and time-travel, whose technical
construction is elucidated in Neuromancer, Bladerunner
and Terminator). What seem to be memories of the past
are revealed as tactics of the future to infiltrate the present.
TIme's auto-construction is exposed by refocusing cyber
netics away from negative-feedback control systems onto
the 'runaway' positive feedback processes which have
traditionally been understood as merely pathological
exceptions leading nowhere (and which even Bataille
disregarded), but which Land now superposes with the
critique/capital vector in accordance with the realisation
that 'cybernetics is the reality of critique'. This revelation
culminates in 'Meltdown's claim - both apocalyptic and
3 8
E D I T O R S' INTR O D U C T I ON
Geotraumatics and Cosmic Trauma
- The Cybernetic Culture Research Unit (CCRU) emerged in 1995 as a radical, institutional 'parasite' marking a shift in Nick Land's philosophical trajectory.
- Land's theory of 'geotraumatics' posits that all terrestrial existence is a relay of primal cosmic trauma originating from the Earth's molten accretion 4.5 billion years ago.
- By generalizing Freud's biocentric model of trauma, Land argues that the planet's burning iron core represents an 'aboriginal trauma' encrypted in all stratified matter.
- This framework views biological and physical structures—from eukaryotic cells to human bipedalism—as indices of unconscious pain and 'ionic strippings' seeking release.
- The philosophy suggests a deep pessimism where repression is inherent to organized structure, implying that only the complete liquidation of biological order can discharge this trauma.
What howls for release in eukaryotic cells, carbon molecules, nerve ganglia, and silicone chips, are the 'thermic waves and currents, deranged particles, ionic strippings and gluttings' that populate the planet's seething inner core.
performative as hype - that the compression-phases of
modernity, beginning the final phase of their acceleration
in the sixteenth century with Protestant revolt, oceanic
navigation, commoditisation and its attendant (place
value) numeracy, constitute a 'cyberpositive' global circuit
of inter excitement, due to attain infinite density in 201Q .
*
The inception of the amorphous and short-lived Cyber
netic Culture Research Unit (C C RU) - established at
Warwick University in 1995, shortly before Land's depar
ture from academia, but immediately disowned as an
undesirable parasite by the institution to which it was
precariously affixed (it survived for a few years after
wards as an independent entity) - marks yet another
important phase-transition in Land's work. Arguably the
most significant component of this stage is the theory of
'geotraumatics', which marks Land's audacious attempt
(following A Thousand Plateaus' 'Geology of Morals') to
characterise all terrestrial existence, including human
culture, as a relay of primal cosmic trauma. Radicalis
ing Freud's equation of trauma with what is most enig
matic and problematic in existence, Land generalises
its restricted biocentric model as outlined in Beyond the
Pleasure Principle to encompass the inorganic domain,
singling out the accretion of the earth 4.5 billion years
ago - the retraction of its molten outer surface and its
3 9
E D I T O R S' I NT R O D U C TI O N
subsequent segregation into a burning iron core (which
he dubs Cthelll) - as the aboriginal trauma whose scars
are inscribed, encrypted, throughout terrestrial matter,
instituting a register of unconscious pain coextensivc
with the domain of stratified materiality as such. Land's
reworking of the discredited biological notion that ' ontog
eny recapitulates phylogeny' through Freud's theory of
trauma hybridises genealogy, stratoanalysis and informa
tion theory into a cryptography of this cosmic pain. What
howls for release in eukaryotic cells, carbon molecules,
nerve ganglia, and silicone chips, are the 'thermic waves
and currents, deranged particles, ionic strippings and
gluttings' that populate the planet's seething inner core.
Geotraumatics radicalises Deleuze-Guattari's insistence
that schizoanalysis should extend further than the terrain
of personal or familial drama, to invest the social and
political realms, and pushes beyond history and biol
ogy to incorporate the geological and the cosmological
within the purview of the transcendental unconscious.
Behind what seem like absurdities - such as the claim
that lumbar back pain is an expression of geocosmic
trauma - lies the contention that the root source of the
disturbance which the organism identifies according to its
parochial frame of reference - mummy-daddy - or which
it construes in terms of the threat of individual death, is
a more profound trauma rooted in physical reality itself,
a generalised alienation endemic to the stratification
40
E D ITORS ' I NTRODUCTION
of matter as such. What is noteworthy here is a certain
deepening of pessimism: repression extends 'all the way
down' to the cells of the body, the rocks of the earth,
inhering in organised structure as such. All things, not
just the living, yearn for escape; all things seek release
from their organisation, which however induces further
labyrinthine complications. Nothing short of the com
plete liquidation of biological order and the dissolution of
physical structure can suffice to discharge the aboriginal
trauma that mars terrestrial existence.
As Nietzsche suggested, the structure and usage of the
human body is the root source of the system of neurotic
afflictions co-extensive with human existence; but bipe
dalism, erect posture, forward facing vision, the cranial
verticalisation of the human face, the laryngeal constric
tion of the voice, are themselves all indices of a succes
Geotrauma and Transcendental Arithmetic
- The human voice and larynx are viewed as products of geotraumatic evolution that inhibit 'virtual speech' and enforce identity through logos.
- Schizoanalysis seeks to decrypt 'tics' and sub-linguistic sounds like clickings and hissings as code from the 'outside' that bypasses human semantics.
- Land proposes a 'transcendental arithmetic' where number is diagrammatic and intensive rather than a metric tool for measurement or knowledge.
- The text advocates for the 'de-engineering' of organic logos by disintegrating language into intensive sequences and delirious combinatorics.
- Gödel's work is reinterpreted not as a limit to formal consistency, but as a flattening of arithmetic that treats numbers simultaneously as indices and data.
- The transformation of space through coding and sequencing serves as a bulwark against the Kantian ambition to subsume all space under a unified architecture.
One cannot dismantle the face without also evacuating the voice.
sion of geotraumatic catastrophes separating the material
potencies of the body from its stratified actuality. Just as
the bipedal head impedes 'vertebr o-perceptual linearity' ,
the human larynx inhibits 'virtual speech'. One cannot
dismantle the face without also evacuating the voice. Since
in geotraumatic terms, the human voice itself is -via the
various accidents of hominid evolution -the expression of
geotrauma, 'stammer ings, stutter ings, vocal tics, extralin
gual phonetics, and electro digital voice synthesis are [ ... ]
laden with biopolitical intensity -they threaten to bypass
41
EDITORS'INTRODUCTION
the anthrop ostructural head-smash that establishes our
identity with logos, escaping in the direction of numbers .'
Texts such as 'Kata�oniX' accordingly attempt
a pcrformati ve evacuation of the voice, disintegrating
semantics into intensive sequence (notably through the
use of extracts from Artaud's notebooks, where 'poetry'
slides into delirious combinator ics). One of the tasks of
schizoanalys is has now become the decrypting of the
'tics' bequeathed to the human frame by the geotraumatic
catastrophe, and 'Kata�oniX' treats vestigial semantic
content as a mere vehicle for code 'from the outside':
the 'tic' symptoms of geotrau matism manifested in the
shape of sub-linguistic clickin gs and hissings. Already
disintegrated into the number-names of a hyperpagan pan
theon, syncretically drawing on the occult, nursery rhyme,
anthropology, SF and Lovecraft, among other sources, the
'subterranean current of impressions, correspondence s,
and analogies' (Artaud) beneath language is now allowed
uninhibited ( but rigorously-prepared ) development, in an
effort to corporeally de-engineer the organicity of logos.
The element of these explorations remains the trans
formed conception of space vividly exhibited in Gibsonian
cyberpunk and which is a crucial component in Land's
writings, a powerful bulwark against Kant's architectonic
ambition to subsume all space under unity. Coding and
sequencing mechanisms alone now construct intensive
space, and this lies at the core of Land's typology of
42
EDITORS ' INTRODUCTION
number, since dimensionality is a consequence of strati
fication. Naming and numbering converge in counting,
understood as immanent fusion of nomination and
sequencing. No longer an index of measure, number
becomes diagrammatic rather than metric. From the
perspective of Land's 'transcendental arithmetic ', the
Occidental mathematisation of number is denounced
as a repressive mega-machine of knowledge -an excres
cent outgrowth of the numbering practices native to
exploratory intelligence -and the great discoveries of
mathematics are interpreted as misconstrued discover
ies about the planomenon (or plane of consistency), as
exemplified by Godel's 'arithmetical counterattack against
axiomatisation'. Land eschews the orthodox philosophical
reception of Godel as the mathematician who put an end
to Hilbert's dream of absolute formal consistency, thus
opening up a space for meta-mathematical speculation.
More important, for Land, are the implications of Godcl's
'decoded' approach to numb er, which builds on the
Richard Paradox, generated by the insight that numbers
are, at once, indices and data.
The Godel episode also gives Land occasion to expand
upon the theme of the 'stratification' of number: accord
ing to the model of stratification, as the 'lower strata' of
numbers become ever more consolidated and metrically
rigidified, their problematic component reappears at
a 'higher' strata in the form of 'angelic' mathematical
43
EDITORS ' INTRO DUCTIO N
entities as-yet resistant to rigorous coding. A sort of
apotheosis is reached in this tendency with G6del's flatten·
ing of arithmetic through the cryptographic employment
of prime numbers as numerical 'particles', and Cantor's
discovery of 'absolute cardinality ' in the sequence of
Numerical Insurrection and Transcendental Escape
- Nick Land interprets Gödel's incompleteness theorems as an operationalization of number that leads directly into the technological mega-complex of techno-capital.
- The use of arithmetic to code language is viewed as a 'qabbalistic' procedure that enables a revolutionary role for non-mathematical numerical practices like numerology and 'qwernomics'.
- Land critiques postmodernism not through semantics, but by proposing a rigorous alternative based on the practice of new ways of naming and numbering things.
- The Kantian delimitation of experience is seen as a temporal cage that uses memory and promises to screen the organism from 'intensive time' and the unknown.
- Capitalism is identified as the 'most dissolved form' of social control, acting as an impersonal placeholder that might eventually shatter the transcendental screen protecting the human socius.
- Land's later work shifts toward a mordant observation that the 'disaster of world history'—a form of passive genocide—is already an accomplished fact.
An animal with the right to make promises enslaves the unanticipated to signs in the past, caging time-lagged life within a script.
transfinites.
Thus for Land the interest of G6del's achievement is
not primarily 'mathematical' but rather belongs to a line
age of the operationalisation of number in coding systems
that will pass through Turing and into the technological
mega-complex of contemporary techno-capital.
By using arithmetic to code meta-mathematical state
ments and hypothesising an arithmetical relation between
the statements - an essentially qabbalistic procedure -
G6del also indicates the 'reciprocity between the logicisa
tion of number and the numerical decoding of language',
highlighting a possible revolutionary role for other non
mathematical numerical practices. As well as reappraising
numerology in the light of such 'lexicographic' insights,
the mapping of stratographic space opens up new avenues
of investigation - limned in texts such as 'Introduction
to Qwernomics' - into the effective, empirical effects of
culture - chapters of a 'universal history of contingency'
radicalising Nietzsche's insight that 'our writing equip
ment contributes its part to our thinking'. The varieties
of 'abstract culture' present in games, rhythms, calendri
cal systems, etc., become the subject of an attempt at
44
EDITORS' INTRODUCTION
deliberate, micro-cultural insurrection through number,
exemplified in the C C RU 'S 'hyperstitional' spirals and the
'qwertypological' diagrams that in the end merge with
the qabbalistic tracking of pure coding 'coincidences'.
Ultimately, it is not just a question of conceiving, but of
practicing new ways of thinking the naming and numbering
of things. Importantly, this allows Land to diagnose the
ills of 'postmodernism' - the inflation of hermeneutics
into a generalised historicist relativism - in a manner that
differs from his contemporaries' predominantly semantic
interpretations of the phenomenon, and to propose a
rigorous intellectual alternative that does not involve
reverting to dogmatic modernism.
*
Kant's delimitation of the conditions of experience for
ever withdraws us from contact with the unknown, the
correlation extending from present to future leaving no
possibility even in principle for the 'rebellion' of matter.
For Land, correlation is basically a temporal problem:
'An animal with the right to make promises enslaves the
unanticipated to signs in the past, caging time-lagged
life within a script'. A 'false memory syndrome', indeed
memory itself, 'screens' the organism from intensive time.
Against this profoundly ambiguous and tensile project
of enlightenment, against its formal foreclosure of alter
ity and novelty, Land had set the adventurers - 'poets,
45
EDITORS' INTRODUCTION
werewolves, vampires' - who explore death and attempt
to plot out modes of escape, activating the unconscious
revolutionary force shackled by the inhibited syntheses
of modern culture. Meanwhile, if capital is still a 'social
straitjacket' of schizo-production, at least it is its 'most
dissolved form'. The dis-inhibition of synthesis at the level
of collective human experience - a dis-inhibition that
could only be carried out by capitalism as the impersonal
placeholder for transcendental subjectivity - seems to offer
the possibility of shattering the transcendental screen that
shields the human socius from the absolute exteriority of
a space-time bey ond measure.
In 'Kant, Capital and Incest' Land had described the
real conditions of the 'inhibited synthesis' of capital as an
'indefinitely suspended process of genocide' tantamount
to 'passive genocide'. Where Land's work had set out with
the hope that the 'disaster of world history ' (a world 'capa
ble', in Artaud's words, 'of committing suicide without
even noticing it') and the repression that is 'social history'
and that reaches its most tensile point in modernity 's
volatile compromise with tradition could be unlocked, his
later work mordantly observes that the disaster is already
Capitalism as Cosmic Schizophrenia
- The revolutionary task is reframed from a terrestrial struggle to a cosmic process of 'dis-inhibiting' productive synthesis.
- Capitalism is presented as an inescapable force that absorbs all social dynamism, desire, and even time itself into its own expansion.
- The text highlights a shift from seeking a 'beyond' to capitalism to recognizing capitalism as 'beyondness' itself, possessing no external limits.
- Land's philosophy evolves into a 'tactical embrace' of deregulation and marketization as the only viable vectors for social deterritorialization.
- The critique addresses 'transcendental miserabilism,' arguing that only those committed to boredom would deny capitalism's inexhaustible capacity for innovation.
- The author questions whether capitalism truly unlocks cosmic strata or if it remains trapped within an 'inexpugnable residue' of stratification.
Whatever you want, capitalism is the most reliable way to get it, and by absorbing every source of social dynamism, capitalism makes growth, change and even time itself into integral components of its endlessly gathering tide.
present in planets, cells, and bodies, that the revolutionary
task is not just terrestrial but cosmic in scope.
Conversely, the 'consistent displacement of social
decision-making into the marketplace', the 'total de
politicisation' and 'absolute annihilation of resistance
46
E D ITORS ' I NTRODUCTION
to market relations' denounced in 'Kant, Capital and
Incest' as 'an impossible megalomaniac fantasy' requiring
'annihilating poverty' to ' stimulate' the labour-force into
participation, seems to become an object of veneration:
Without attachment to anything beyond its own
abysmal exuberance, capitalism identifies itself
with desire to a degree that cannot imaginably be
exceeded, shamelessly soliciting any impulse that
might contribute an increment of economisable drive
to its continuously multiplying productive initiatives.
Whatever you want, capitalism is the most reliable
way to get it, and by absorbing every source of social
dynamism, capitalism makes growth, change and
even time itself into integral components of its end
lessly gathering tide. 'Go for growth' now means 'Go
(hard) for capitalism'.
From Land's initial characterisation of the revolutionary
task as one of pushing capitalism to the point of its auto
dissolution via the complete dis-inhibition of productive
synthesis - a dis-inhibition announcing the convergence of
social production and cosmic schizophrenia proclaimed in
Anti-Oedipus - we arrive at the blunt admission that there
is no foreseeable 'beyond' to the 'infinite' expansion of
capitalism (since capitalism is 'beyondness' as such) . The
tactical embrace of unlimited deregulation, marketisation,
47
EDITORS ' INTRODUCTION
commodification, and privatisation, as vectors of social
dcterritorialization, apparently flips over into a com
placent acceptance of actually-existing capitalist social
relations predicated on a transcendental and empirically
unfalsifiable commitment to capitalism's inexhaustible
capacity for innovation, which only a 'transcendental
miserabilist' would dare query:
Capitalism [ . . . ] has no external limit, it has consumed
life and biological intelligence to create a new life
and a new plane of intelligence, vast beyond human
anticipation. The Transcendental Miserabilist has
an inalienable right to be bored, of course. Call this
new? It's still nothing but change.
Here Land's rebuttal of 'left miserabilism' insists on
capitalism's innovative potency even as his own work
casts doubt upon the possibility of sharply dis-intricating
reterritorializing change from deterritorialized novelty.
If stratification is a cosmic rather than a sociocultural
predicament, then on what grounds can one maintain
that capitalism uniquely among terrestrial phenomena
harbours the unparalleled capacity to unlock the strata?
Land had tied the 'aesthetic operation' to matter's dis
ruptive potencies, and lauded capitalism's generation of
artificial sensoria as an amplification of the domain of the
problematic. Yet once the disruptions of sensation are
48
EDITORS' INTRODUCTION
seen to be hemmed-in by the ubiquity of stratic synthesis,
this premium on problematising subversion is vitiated by
the realisation that, whatever remains to be troubled by
capitalism's allegedly inexhaustible disruptive potency,
its very susceptibility to disturbance ensures its subjection
to an inexpugnable residue of stratification.
Now himself domiciled in 'neo-China', Land's jour
nalistic writings for the China Post and other publications
would seem to indicate that he has relinquished his earlier,
feverish pursuit of escape, and is content to promote a gIo b
ally ascendant Sino-capitalism. Here is Land's impressively
speculative contextualisation of the 2010 Shanghai World
Expo in a recent guidebook:
Modernity's ceaseless, cumulative change defies every
pre-existing pattern, abandoning stability without
The Mechanics of Modernity
- Modernity is defined as a previously unanticipated mode of time characterized by accelerated directional transformation and qualitative innovation.
- The history of Shanghai and the World Expo are presented as parallel tracks of industrial modernity that converge into a singular event of massive concentration.
- Nick Land’s later work shifts from seeking a dissolution of the global metropolis to viewing it as a mighty expression of planetary meltdown.
- Critics view Land's transition into capitalist boosterism as either a betrayal or a revelation of neo-liberal realism, yet it maintains a consistent analytical intent.
- Land’s 'tactics of intensification' evolved only after he abandoned the illusion that such forces could prematurely break cosmic stratification.
- The identification of capital with life and growth represents a rejection of 'transcendental miserabilism' in favor of a superlative cosmic narrative.
Any surprise at the transition from Land's 'philosophical writings' to the employment of his evidently still razor-sharp post-genre writing in the actual service of capitalist booster-hype may simply bespeak an incapacity to believe that Land actually meant what he said -that writing was indeed nothing but a machine for intensification.
embracing the higher order of a great cycle or the
simple destination of an eschatological conclusion.
Although establishing something like a new nor·
mality, it departs decisively from any sort of steady
state. It displays waves and rhythms, but it subsumes
such cycles, rather than succumbing to them. Whilst
nourishing apocalyptic speculation, it continuously
complicates anticipations of an end time. It engen
ders a previously unanticipated mode of time and
history, characterised by ever-accelerated directional
transformation, whose indices are quantitative growth
49
EDITORS' INTROD UCTION
and qualitative innovation. The worldwide consoli
dation of modernity only deepens its fundamental
mystery. [ . . . ]
Modern Shanghai and the World Expo were born
within a single decade, over 150 years ago. Since then,
the twin histories of the world's most iconic modern
city and the greatest festival of modern civilisation
have unfolded in parallel, with frequent cross-fertilisa
tions, through dizzy ascents and calamitous plunges
that tracked the rise, fall, and renaissance of the
modernist spirit. Through all these vicissitudes, each
has reflected in large measure the trials, tempests, and
triumphs of worldwide industrial modernity, defining
its promise, nourishing its achievements, and sharing
in its setbacks. At World Expo 2010 Shanghai, these
parallel tracks melt together, into the largest discrete
event in world history.4
Rather than seeking to dissolve the 'global Kapital metrop
olis' through the release of 'uninhibited synthesis', and
thus putting an end to the 'nightmare' or 'disaster of
world history', Land now sees in the massively concen
trated metropolis a mighty expression of that history.
Perplexingly, the auto-sophisticating runaway of planetary
4
N. Land, Shanghai Expo Guide 2010 (Shanghai: Urbanatomy, 2010).
5 0
EDITORS' INTRODUCTION
meltdown is now made an accessory to the development
of cultural capital.
It would (and will) be easy for Land's enemies to find a
glib satisfaction in this, but perhaps it only exacerbates the
troubling nature of what came before - precisely because
of its consistency. If anything, this juxtaposition of the
cosmically portentous with overblown marketing hype
continues the startling consistency of intent and analysis
in all the texts collected in this volume. As satisfying as it
may be to leftists outraged by Land's 'accelerationism',
it is difficult to discern here either the betrayal or aban
donment of an earlier more promising vector, or even
the revelation that the 'truth' of his position was always
a puerile capitulation to neo-liberal 'realism' shrouded
in mysticism. Any surprise at the transition from Land's
'philosophical writings' to the employment of his evi
dently still razor-sharp post-genre writing in the actual
service of capitalist booster-hype may simply bespeak
an incapacity to believe that Land actually meant what
he said - that writing was indeed nothing but a machine
for intensification. In fact, if one is right to detect an
irrevocable shift in Land's 'tactics of intensification', what
is crucial is that this only took place once Land himself
had succeeded in shattering his own illusions that this
intensification could, 'prematurely' so to speak, break
the bonds of cosmic stratification.
5 1
EDITORS' INTRODUCTION
Land's blanket denunciation of the left's 'transcendental
miserabilism', the apparent degeneration of his once
scalpel-sharp dissection of the body of capitalism into
schizophrenizing and repressive tendencies, may seem to
dissolve the complexities of his work into a superlative
cosmic version of the familiar neo-liberal narrative accord
ing to which 'there is no alternative', and the wholesale
identification of capital with life, growth, and history. But
this verdict only becomes possible after the passing of the
last vestige of 'dionysian optimism', in the abandonment
The Legacy of Nick Land
- Land's work exposes the anachronistic nature of human agency and left-wing voluntarism in the face of machinic capitalism.
- The text critiques 'critical' theorists who maintain careers in critique while insulating themselves from the risks of actual political praxis.
- Land's experimental project to escape humanity and access 'death' is framed as a failure that nonetheless 'failed better' than previous attempts.
- His contributions include a diagnosis of human genealogy, a philosophy of mathematics, and a contemporary thinking of time.
- The editors view Land's writings as 'textual machines' and weapons designed to inspire new assaults against the 'Human Security System'.
The wound needs to be opened up once more, and if this volume infects a new generation, already enlivened by a new wave of thinkers who are partly engaging the re-emerging legacy of Nick Land's work -it will have fulfilled its purpose.
of the notion that the experimental engagement with
numerical practices, voodoo, dance music, etc., might
somehow grant access to the insurrectionary energies
at work in capitalism's intense core, over and above any
simply mundane participation in capitalist reality.
Nevertheless, Land's incisive assessment of the
machinic reality of a schizo-capitalism currently in the pro
cess of penetrating and colonizing the innermost recesses
of human subjectivity exposes the fatally anachronistic
character of the metaphysical conception of human agency
upon which 'revolutionary' thought continues to rely. The
anachronistic character of left voluntarism is nowhere
more apparent than in its resort to a negative theology
of perpetually deferred 'hope', mordantly poring over
its own reiterated depredation. Worse still is the compla
cent sanctimony of those 'critical' theorists who concede
that the prospect of revolutionary transformation is not
5 2
E D I TO RS
'
I NT R O D U C T I O N
only unattainable but undesirable (given its dangerously
' totalitarian' propensities) , but who remain content to
pursue a career in critique, safely insulated from the risks
of political praxis. The challenge of Land's work cannot
be circumvented by construing the moral dismay it (often
deliberately) provokes as proof of its erroneous nature, or
by exploiting the inadequacies in Land's positive construc
tion as an excuse to evade the corrosive critical implica
tions of his thought. Nor can it be concluded that this
alternative philosophical path cannot be further explored.
No one could accuse Land himself of not having
taken this project as far as he possibly could - all the way
through true madness and back into a banality whose true
underlying insanity he still maintains but now knows is
not voluntarily accessible (or even acceleratable, perhaps) .
'A Dirty Story' stands as testament to, or post-mortem
analysis of, this proj ect in transcendental empiricism,
revealing that Land's last hope for humanity - that it might
be escaped - and the greatest wager oflife - that it might
give access to death - experimentally failed. But perhaps
they ' failed better' than those who went before him. The
legacy of Land's experiments, like the rags and tatters of
the visionaries whose works he picked through for clues,
includes contributions to the diagnosis of the cosmic, bio
logical, evolutionary, and cultural genealogy and nature
of the human; forays into the thinking of number that
exceed in breadth and depth any extant 'philosophy of
5 3
E D I T O R S '
I NTRO D U C T I O N
mathematics'; a sophisticated and culturally contempo
rary philosophical thinking of time and modernity; and
above all a series of textual machines whose compelling,
strangely intoxicating power must, in a social and intel
lectual climate characterised by neo-classical sobriety,
open up forgotten, suppressed, and alternative lineages
and superpositions capable of inspiring others to take
up the experiment once more, launching new assaults
against the Human Security System.
Everything in Land's work that falls outside the param
eters of disciplinary knowledge can and will be effectively
dismissed by those who police the latter. In Bataille's
incisive formulation, 'the unknown [ . . . ] is not distin
guished from nothingness by anything that discourse can
announce' . Like his fellows of the 'inferior race', what
we retain of Land's expeditions are diverse and scattered
remnants, here constellated for the first time. These are
also tools or weapons; arrows that deserve to be taken
up again and sharpened further. The wound needs to be
opened up once more, and if this. volume infects a new
generation, already enlivened by a new wave of thinkers
who are partly engaging the re-emerging legacy of Nick
Land's work - it will have fulfilled its purpose.
RO B I N MAC KAY & RAY B RAS S I E R
T R U R O & B E I RUT, F E B RUARY 2 0 1 1
54
Kant, Capital, and Apartheid
- The text explores the intersection of philosophy, global capital, and the socio-political structures of modernity.
- South African apartheid is analyzed as a microcosm of the neo-colonial world order, specifically designed to separate political rights from economic utility.
- The 'bantustan' policy is identified as a strategy to keep labor in close economic proximity while maintaining absolute political distance through artificial national sovereignty.
- The author argues that the entire Third World functions as a global 'bantustan' for the international capital metropolis.
- National sovereignty is critiqued as an insufficient and naive framework for Third World political forces to resolve the issues of neo-colonial integration.
- The displacement of the political consequences of wage labor away from the center of capital is presented as a fundamental necessity of accumulation.
The most basic aspiration of the Boer state is the dissociation of politics from economic relations, so that by means of 'bantustans' or 'homelands' the black African population can be suspended in a condition of simultaneous political distance and economic proximity vis-a-vis the white metropolis.
Kant, Capital, and the Prohi bition
of I ncest: A Polemical I ntroduction
to the Configu ratio n of Philosophy
and Modernity
But intuition and the concept differentiate themselvesfrom
each other specifically; because they do not inter-mix with
each other.
I M M ANUEL KANT1
Significantly ... incest proper, and its metaphoricalform
as the violation of a minor (by someone 'old enough to
be her father', as the expression goes), even combines in
some countries with its direct opposite, inter-racial sexual
relations, an extreme form of exogamy, as the two most
powerful inducements to horror and collective vengeance.
CLAUDE L EVI- STRAUS S2
1. Kant, Kritik der Urteilskrafi, ed. Wilhelm Weischedel (Wiesbaden; Suhrkampf, 1974),
Anmerkungto section VIII of the Introduction to Kant's first edition, 40j for a recent
English translation, see 1. Kant, Critique if the Power of Judgment, ed. P. Guyer, tr. P.
Guyer & E. Matthews (Cambridge/NY; Cambridge University Press, QOoo), First
Introduction, VIII, 29.
C. Levi-Strauss, 1he Elementory Structures of Kinship (Boston: Taylor & Francis, 1969), 10.
5 5
FANGED NOUM ENA
No, we do not love humanity; but on the other hand we
are not nearly 'German' enough, in the sense in which
the word 'German ' is constantly being used nowadays, to
advocate nationalism and race hatred and to be able to
take pleasure in the national scabies oj the heart and blood
poisoning that now leads the nations oj Europe to delimit
and barricade themselves against each other as ifit were a
matter oj quarantine.
FRIEDRICH NIETZSC H E3
For the purposes of understanding the complex network
of race, gender, and class oppressions that constitute
our global modernity it is very rewarding to attend to
the evolution of the apartheid policies of the S outh
African regime, since apartheid is directed towards the
construction of a microcosm of the neo-colonial order; a
recapitulation of the world in miniature. The most basic
aspiration of the Boer state is the dissociation of politics
from economic relations, so that by means of 'bantustans'
or 'homelands' the black African population can be sus
pended in a condition of simultaneous political distance
and economic proximity vis-a-vis the white metropolis.
This policy seeks to recast the currently existing political
3
F. Nietzsche, "The Gay Science, tr. Walter Kaufmann (New York: Vintage, 1974), 339.
5 6
KANT, CAP I TA L , AND TH E PROH I B ITION OF INCEST
exteriority of the black population in its relation to the
society that utilizes its labour into a system of geographi
cal relations modelled on national sovereignty. The direct
disenfranchisement of the subject peoples would then be
re-expressed within the dominant international code of
ethno-geographical (national) autonomy.
World opinion discriminates between the relation
South Mrican whites have to the blacks they employ, and
the relation North American whites, for instance, have
to the Third World labour force they employ (directly or
indirectly), because it acknowledges an indissoluble claim
upon the entire South Mrican land-mass by a population
sharing an internationally recognized national identity.
My contention in this paper is that the Third World as a
whole is the product of a successful - although piecemeal
and largely unconscious - 'bantustan' policy on the part
of the global Kapital metropolis. Any attempt by political
forces in the Third World to resolve the problems of their
neo-colonial integration into the world trading system on
the basis of national sovereignty is as naive as would be
the attempt of black South Africans if they opted for a
'bantustan' solution to their particular politico-economic
dilemma. The displacement of the political consequences
of wage labour relations away from the metropolis is
not an incidental feature of capital accumulation, as the
economic purists aligned to both the bourgeoisie and the
5 7
FANG ED NOUM ENA
The Violent Infrastructure of Capital
- Capitalism originates not from economic evolution but from an overt war against the people and their forced removal from subsistence.
- The bourgeois ideal is the total de-politicization of society by displacing all social decision-making into the marketplace.
- To survive the political refusal of the market, capital disaggregates the global system, creating welfare states in the metropolis while exporting instability to the Third World.
- The global labor market functions as a sustained demographic disaster that is systematically displaced away from metropolitan political institutions.
- Modernity is defined by a compromise between expansionary development and a continuity of patrilineal descent and formal logic.
- The infrastructure of capital accumulation is fundamentally dependent on the sexual economy of gender and race, often dismissed by traditional Marxists.
But this ideal of total de-politicization, or the absolute annihilation of resistance to market relations, is an impossible megalomaniac fantasy.
workerist left assert. It is rather the fundamental condition
of capital as nothing other than an explicit aggression
against the masses.
Despite inadequacies in Marx's grasp of the nation
state in its colonial and neo-colonial functioning, his
account of 'so-called primitive accumulation'4 clearly
demonstrates that the origin of wage labour relations is
not itself economic, but lies in an overt war against the
people, or their forced removal from previous conditions
of subsistence. It is the outward shock-wave of this violent
process of coercion, whereby the subsistence producer is
driven into the marketplace, that determines the character
of the imperialist project and its offspring. Capital has
always sought to distance itself in reality - i.e. geographi
cally - from this brutal political infrastructure. After all,
the ideal of bourgeois politics is the absence of politics,
since capital is nothing other than the consistent displace
ment of social decision-making into the marketplace.
But this ideal of total de-politicization, or the absolute
annihilation of resistance to market relations, is an impos
sible megalomaniac fantasy, and Marx's contention that
labour trading at its natural price in an undistorted
market (equal to the cost of its reproduction) will tend
strongly to express an equally 'natural' political refusal
of the market, continues to haunt the global bourgeoisie.
4
K. Marx, Capital: Volume J, tr. Ben Fowkes (NY: Vintage, 1977), 667ff.
5 8
KANT, CAPITA L , AND T H E PROHIBITION OF INCEST
The only practical option available to the rulers of
capitalist societies has lain in the global disaggregation
of the political system, accompanied by a regional distor
tion of the world labour trading system in favour of the
working classes in the metropolitan regions (,welfare
capitalism'). This is why a deep complicity has continued
to exist between the form of the 'nation state' as intema
tional political agent and an economic order based upon
the commodification of labour. Since it is of systematic
necessity that the economic conditions of an undistorted
labour market are accompanied by political crisis, the
world order functions as an integrated process based upon
the flow of market-priced labour into the metropolis from
the Third World (on the basis of the economic form of
capital production), and the export of political instability
to the Third World from the metropolis (on the basis of
the political form of autonomous national sovereignty).
The global labour market is easily interpreted, therefore,
as a sustained demographic disaster that is systemati
cally displaced away from the political institutions of
the metropolis.
This process of displacement, which is the ulti
mate 'base' or 'infrastructure' of capital accumulation,
is dependent upon those issues of 'kinships' or 'mar
riage organization' (the sexual economy of gender and
race) which Marxists have often tended to consider as
surface features of an underlying mode of production.
5 9
FANG ED NOUM ENA
In this paper I shall argue that with the philosophy of
Immanuel Kant, Western cultural history culminates in a
self-reflecting bourgeois civilization, because his thought
of synthesis (or relation to alterity), and also the strangula
tion of this thought within his system, captures modernity
as a problem. But the modernity thus symptomized by its
philosophical exposition is not primarily the penultimate
phase of a dialectic of society and production, it is rather
the necessity that historically itself - expansionary social
and economic development, or 'synthesis' - compromises
with a profound continuity whose basic aspects are on the
one hand patrilineal descent, and on the other a formal
logic of identity that was already concluded in its essentials
by Aristotle. These two aspects, the genealogical and the
logical, are functions of a position of abstract masculine
Patriarchy, Capital, and Fascism
- The stability of the male line serves as the proto-cultural foundation for maintaining identity and sameness within a population.
- Modernity represents a deepening compromise between commercial social organization and the archaic patterns of patrilineal exogamy.
- Capitalist empires function as developed forms of exogamic patriarchy that require a 'residual alterity' in the other to generate surplus.
- Fascism emerges when a metropolitan society decouples its economic synthesis from its kinship organization, retreating into xenophobic endogamy.
- The historical failure of capitalism lies in its refusal to allow a radical, post-patriarchal synthesis through the 'uncontrollable eruption' of migrant alterity.
- Capital ultimately acts as a frustration of the human tendency toward expansive exogamy by refusing to push the prohibition of incest to its limit.
Capital is the point at which a culture refuses the possibility -which it has itself engendered -of pushing the prohibition of incest towards its limit.
subjectivity coincident with the patronymic. This position
is the proto-cultural fundamem of eveqi.1tiug that is able
to count as the same. The tradition is thus rooted in a
communication between culture and population, whose
medium is the stability ('identity') of the male line. Moder
nity is not merely a compromise between novel forms of
commercially driven social organization and this archaic
cultural pattern of patrilineal exogamy, but more funda
mentally, a deepening of the compromise already integral
to any exogamy that is able to remain patrilineal. It is only
by understanding the inhibitive function of patriarchies
in relation to exogamic dissipation (an inhibition that is
6 0
KANT, CAPITA L , AND TH E PROHIBITION OF INCEST
supremely logical in that it conserves identity, and which
is for this reason violently xenophobic) that we can make
sense of capital production and its tendency towards the
peculiar cultural mutation that was baptised by Mussolini
as 'fascism'. This is because the restriction of cultural
synthesis, based upon a strenuous endogamy at the level
of the national community, is the ultimate outcome of the
concerted 'liberalization' of kinship organizations within
( metropolitan) industrial societies.
A capitalist trading empire is a developed form of
exogamic patriarchy, and inherits its tensions. Domina
tion of the other is inhibited in principle from developing
into full absorption, because it is the residual alterity of
the other that conditions the generation of surplus. The
parallel difference between a labour market and a slave
market is based on the fact that one cannot do business
with a slave (but only with a slave-owner), and similarly,
one cannot base a kinship system upon a harem. The
prevalence of slave-labour within the Hitlerite new order
in Eastern Europe is thus a clear indication that the Nazi
conquests were in an important sense 'post-imperialist'.
In contrast to the fascist 'mixed economy' of slavery and
extermination, colonial wage-labour exploitation, even
to the point of murder through impoverishment, leaves
open the possibility of a radical destabilization of the
metropolis. But what is crucial to the demarcation of a
colonial from a neo-colonial system is a transnational
6 1
FAN G ED NOUM ENA
diffusion of ethnicity. As soon as a metropolitan society
disengages its organization of kinship and citizenship
from its international economic syntheses it already reveals
proto-fascist traits, and on this basis it is easy to see that
the radical aspect to the colonial project - the explosion
of national identity and the dissipation of metropolitan
transcendence - was strangled at birth within Western
history (with the emergence of Judaeo-Christian race
theories).
The disaster of world history is that capitalism was
never the progressive unwinding of patrilineage through
a series of generalized exploitative relations associated
with a trans-cultural exogamy, leading to an uncontrol
lable eruption of feminine (i.e. migrant) alterity into
the father's heartland, and thus to the emergence of a
radical - or ethnically disruptive and post-patriarchal -
synthesis. Instead, kinship and trade were systematically
isolated from each other, so that the internationalization
of the economy was coupled with an entrenchment of
xenophobic (nationalistic) kinship practices, maintaining
a concentration of political and economic power within
an isolated and geographically sedentary ethnic stock.
Thus, when we discuss capital in its historical concrete
ness, we are simultaneously discussing a frustration of the
cultural tendency of human societies towards expansive
exogamy. Capital is the point at which a culture refuses the
62
KANT, C A P I TAL , AN D T H E P R O H I B I T I ON O F I N C E S T
possibility - which it has itself engendered - of pushing
the prohibition of incest towards its limit.
I want to touch upon this condition of modernity
Modernity and Inhibited Synthesis
- Modernity is defined by 'inhibited synthesis,' a philosophical state where society seeks explosive novelty while simultaneously shackling it through systematic compromise.
- Enlightenment societies exhibit a paradoxical desire to expand indefinitely and open to the 'other' while remaining identical to themselves and invulnerable to change.
- The author compares the exploitative culture of modernity to the psychology of rape, characterized by a volatile mixture of hatred and desire toward an outside it seeks to master.
- The Kantian 'a priori' is framed as a brutal denial of alterity, as it pre-determines the nature of an encounter before it actually happens, effectively silencing the 'other.'
- The philosophical problem of 'synthetic a priori knowledge' mirrors the socio-political problem of modernity: the attempt to gain new knowledge while ensuring it is already given by ourselves.
- The history of modern philosophy is a tension between empiricism (knowledge from experience) and rationalism (knowledge inherent to reason), which Kant attempted to reconcile.
If before encountering otherness we already know what its relation to us will be, we have obliterated it in advance.
- which can be awkwardly described as patriarchal neo
colonial capital accumulation, but which I shall come
to name 'inhibited synthesis' - not as a historian or a
political theorist, but as a philosopher. The philosophical
task in relation to modernity is that of delineating and
challenging the type of thinking which characterizes
it. But what we are to understand as 'thinking' is not at
-all clear in advance, indeed, the very thought of the 'in
advance' (which Kant called the a priori) is itself the
predominant trait of our contemporary reason. Western
societies departed from the stagnant theocracies of the
Middle Ages through a series of more or less violent con
vulsions that have engendered an explosive possibility of
novelty on earth. But these same societies simultaneously
shackled this new history by systematically compromis
ing it. This ambiguous movement of 'enlightenment',
which characterizes the emergence of industrial societies
trading in commodities, is intellectually stimulated by
its own paradoxical nature. An enlightenment society
wants both to learn and to legislate for all time, to open
itself to the other and to consolidate itself from within, to
expand indefinitely whilst reproducing itself as the same.
r ts ultimate dream is to grow whilst remaining identical
6 3
FAN G E D N O U MENA
to what it was, to touch the other without vulnerability.
Where the European ancien regime was parochial and
insular, modernity is appropriate. It lives in a profound
but uneasy relation to an outside that both attracts and
repels it, a relation that it precariously resolves within itself
on the basis of exploitation, or interaction from a position
of unilateral mastery. I think it is likely that the volatile
mixture of hatred and desire that typifies an exploitative
culture bears comparison with the psychology of rape.
The paradox of enlightenment, then, is an attempt
to fix a stable relation with what is radically other, since
insofar as the other is rigidly positioned within a relation
it is no longer fully other. If before encountering other
ness we already know what its relation to us will be, we
have obliterated it in advance. And this brutal denial is
the effective implication of the thought of the a priori,
since if our certainties come to us without reference to
otherness we have always already torn out the tongue of
alterity before entering into relation with it. This aggres
sive logical absurdity (the absurdity oflogic itself) reaches
its zenith in the philosophy of Kant, whose basic problem
was to find an account for the possibility of what he termed
'synthetic a priori knowledge', which is knowledge that
is both given in advance by ourselves, and yet adds to
what we know. As we have seen, this problem is the same
as that of accounting for the possibility of modernity or
64
KANT, CAPITAL, A N D T H E P RO H I B IT I O N O F I N C E ST
enlightenment, which is to say, of the inhibited encounter
with alterity.
Modern philosophy between Rene Descartes (1596-
1650) and Immanuel Kant (1724-1804) is usually retro
spectively understood in terms of the two basic tendencies
which we refer to as 'empiricism' and 'rationalism'. No
philosopher was a perfect and consistent exemplar of
either of these tendencies, but the exponents of each
tended to become increasingly radical in one direction or
the other. By the time Kant wrote his first great critique, The
Critique qfPure Reason,5 he was able to take the writings of
David Hume (1711-76) as definitive for empirical thought,
and those of Gottfried Wilhelm Leibniz (1646-1716) as
definitive for rationalism. He took the basic argument of
the empiricists to be that knowledge is synthetic and a
posteriori, meaning that it takes the form of an addition
to what is inherent to reason, and thus follows from expe
rience (or an encounter with what is outside ourselves).
In contrast to this, he saw the rationalists to be arguing
Kant's Transcendental Revolution
- Kant disrupts the traditional alignment of analytic/a priori and synthetic/a posteriori knowledge by creating a perpendicular grid of four permutations.
- He introduces the concept of synthetic a priori knowledge, which describes the necessary conditions of experience without being derived from it.
- This 'Copernican revolution' shifts the philosophical focus from the nature of the mind to the necessary characteristics objects must possess to be known.
- The author likens Kant's transcendental form to an 'exchange value' that allows external reality to be 'marketed' to the Enlightenment mind.
- Kant’s system represents a transition from a parochial economy of thought to a controlled system of trade that appropriates and formalizes novelty.
- This philosophical shift mirrors the political overthrow of the ancien régime, replacing exclusion with the integration of alterity into an immutable formal system.
It is solely concerned with the forms of appearance, or the unchanging manner in which things must be if they are to be for us.
that knowledge is characteristically analytic and a priori,
meaning that it is derived from what is already inherent
to reason, and thus anticipates experience by constructing
systems of logical deduction from basic axioms. Knowl
edge is analytic or synthetic depending on whether its
5
l. Kant, 1he Critique of Pure Reason, tr., ed. P. Guyer & A. W. Wood (Camhridge/NY:
Cambridge University Press, 1998).
6 5
FAN GED N O U M ENA
source is intrinsic or extrinsic to the faculty of reason,
and a priori or a posteriori depending on whether it
precedes or succeeds the contact with sensation, or with
what is outside reason. It is with these pairs of concepts,
the analytic/synthetic couple and the a priorija posteriori
couple, that Kant determines the structure of his own
thinking in relation to that of his recent predecessors.
Kant thought that both empiricist and rationalist
philosophers had accepted the simple alignment of the
synthetic with the a posteriori and of the analytic with
the a priori. This is to say, the relation between these
couples had seemed to be itself analytic, so that to speak
of analytic a priori judgments would add nothing to the
concept of the analytic, or in other words, an analysis of
the concept 'analytic' would yield the concept of the 'a
priori' as already implicit within it. This assumption was
not accepted by Kant, whu Ie-aligned the two pairs of
concepts in a perpendicular fashion to form a grid, thus
yielding four permutations. He granted the elimination
of any analytic a posteriori knowledge, but clung dog
gedly to the possibility of knowledge that would be both
synthetic and a priori. This new conception of knowledge
was relevant to an 'object' that had not previously been
formulated: the conditions of experience. Kant described
his 'Copernican revolution' in philosophy as a shift from
the question 'what must the mind be like in order to
know?' to the question 'what must objects be like in
6 6
KANT, C A P I TAL , A N D T H E P R O H I B I T I O N O F I N C E S T
order to be known?' The answers to this latter question
would provide a body of synthetic a priori knowledge,
telling us about experience without being derived from
experience. It would justify the emergence of knowledge
that was both new and timelessly certain, grounding the
enlightenment culture of a civilization confronting an
ambiguous dependence upon novelty.
Because a developed knowledge of the conditions
of experience presupposes a relation to the outside it is
synthetic and not analytic, but because it concerns the
pure form of the relation as such and not the sensory
material involved in the relation it is a priori and not a
posteriori. It is solely concerned with the forms of appear
ance, or the unchanging manner in which things must
be if they are to be for us. Kant calls this pure form of
synthesis 'transcendental', and opposes it to the inconstant
content of synthesis, with which the empiricists had been
concerned, and which he calls 'empirical'. Kant's 'object'
is thus the universal form of the relation to alterity; that
which must of necessity be the same in the other in order
for it to appear to us. This universal form is that which
is necessary for anything to be 'on offer' for experience,
it is the 'exchange value' that first allows a thing to be
marketed to the enlightenment mind. Between medieval
scholasticism and Kant Western reason moves from a
parochial economy to a system in which, abandoning
the project of repressing the traffic with alterity, one
6 7
FAN G ED NOUM ENA
resolves instead to control the system of trade. With the
overthrow of the ancien regime it became impossible to
simply exclude novelty; it could only be appropriated,
stamped with a constant form, and integrated into an
immutable formal system. In 1he Elementary Structures oj
Kinship Claude Levi-Strauss notes the frequent distinction
made by various societies between normal and 'rich food'.
Synthesis and Social Exchange
- The distinction between 'normal' and 'rich' food mirrors the anthropological divide between blood relations and marriage alliances.
- Rich food functions like women in exogamous marriage systems, where producers renounce their own product to facilitate trade with the outside.
- Structural anthropology and Kantian philosophy both attempt to reduce radical synthesis to a stable system of unchanging forms.
- Dual organizations use reciprocal exchange and binary myths to capture alterity and exclude the possibility of the radically different.
- Kant’s critique of metaphysics reinterprets traditional philosophical dualities as antinomies arising from the misuse of transcendental concepts.
- The restriction of knowledge to the realm of appearance creates a fundamental difficulty in defining the relationship between the phenomenal and the noumenal.
If 'rich food' is the primordial element of trade, its metamorphosis into the modern 'commodity' can be seen as a suppression of radical synthesis.
Normal food is consumed by its producers as a means to
their subsistence, whilst rich food is given to another to
consume, and received from another. This is not primarily
based upon a differentiation of social classes within a
system of production, but rather, upon a differentiation
between tribes, or separate systems of production. The
difference between rich food and normal food maps
onto the difference between filiation (relation by blood)
and alliance (relation by marriage). This is because rich
food occupies the position of women within a marriage
system regulated by patrilineal exogamy, with its producer
renouncing it for himself, and thus echoing the prohibi
tion of incest. What is of particular philosophical inter
est, however, is that it also marks a distinction between
the 'rational' (analytic) and the 'empirical' (synthetic),
and thus defines a terrain upon which we can sketch an
economy of knowledge. Rich food comes from outside
the system, and the contortions undergone by structural
anthropology in its project to recapture it within an
expanded system of relations replay Kant's efforts to
6 8
KANT, C AP I TAL , AN D T H E P RO H I B IT I O N O F I N C E ST
reduce synthesis to an expanded horizon of unchanging
forms. If 'rich food' is the primordial element of trade,
its metamorphosis into the modern 'commodity' can be
seen as a suppression of radical synthesis, the problematic
process which provides enlightenment reason with its
object of thought.
The cultural inhibition of synthesis takes a form that
Levi-Strauss calls 'dual organization'. 6 A dual organization
arises when two groups form a closed system of reciprocal
exchange, in which each consumes the rich food, and
marries the women, of the other. Such organizations
reproduce themselves culturally through shared myths
articulated around basic dualities ( day/night, sun/moon,
up-river/down-river etc.). The function of these myths
is to capture alterity within a system of rules, to provide
it with an identity, and to exclude the possibility of the
radically different. It should not surprise us, therefore, that
Kant inherited a philosophical tradition whose decisive
concepts were organized into basic couples (spirit/matter,
form/content, abstract/concrete, universal/particular,
etc.). He delineates some basic structure of this tradition
in the section of the Critique oj Pure Reason called the
'Transcendental Dialectic'. In this section he interprets
this dichotomous heritage as a problem (to which Kant
gives the name 'antinomy') and initiates a new phase of
6
Levi-Strauss, The Elementary Structures of Kinship, 69-83.
6 9
FAN G E D N O U M E NA
Western philosophy, now characterized as the critique
of metaphysics. Kant argues that the tendency of previ
ous metaphysics to conceive coherent, but unpersuasive
and antagonistic, intellectual systems resulted from the
application of pure (transcendental) concepts to argu
ments concerning the nature of things in themselves
(noumena). The critical philosophy therefore restricts
the jurisdiction of all concepts to the realm of possible
appearance (intuition), suggesting (as we have seen) that
the a priori forms of knowledge have no purchase on any
reality transcending the phenomenon. Oppositional terms
are no longer accepted as descriptions capturing reality,
but are interpreted as pure forms of reason that can only
be meaningfully deployed theoretically when applied
to objects of possible appearance, which fall within the
legislative domain of the 'faculty' which Kant calls 'the
understanding' [Verstand].
Since 'reality' is itself a transcendental concept, Kant's
usage of a distinction between appearance and reality to
restrict the deployment of pure concepts already suggests
a crucial difficulty with his project, since every attempt to
formulate a relation or distinction between the phenom
enal and noumenal realms (the world as it appears to us
Kant, Capital, and Racism
- Kant's critical philosophy inadvertently perpetuates metaphysical dualism by relying on binary oppositions like phenomenon and noumenon.
- The inability of Enlightenment thought to register 'radical alterity' mirrors a colonial trading system where existence is only recognized through exchange value and ownership.
- Modern capital dissolves the traditional anthropological bond between marriage and trade to geographically quarantine the consequences of its economic processes.
- Systematic racism emerges as a mechanism to distribute class positions on a racial basis, creating a de facto global apartheid within the labor market.
- Kant maintained a bourgeois universality only by identifying it with ideality, whereas contemporary racism functions as a restricted franchise over global production.
The vocabulary that would describe the other of metaphysics is itself inscribed within metaphysics, since the inside and the outside are both conceptually determined from the inside, within a binary myth or cultural symptom of dual organization.
or is understood, and the world as it is in itself) must itself
relapse into the pre-critical and illegitimate deployment of
conceptual thought. One crucial symptom of this is that
the structure of Kantian critique itself perpetuates the
7 0
KANT, C A P ITAL, A N D T H E P RO H I B IT I O N O F I N C E S T
oppositional form of metaphysical thought, since its reso
lution of the antinomies depends upon the mobilization of
further dichotomies, in particular those of transcendental!
empirical, phenomenon/noumenon, concept/intuition,
and analysis/synthesis. In other words, Kant still wants to
say something about radical alterity, even if it is only that
it has no relevance to us, yet he has deprived himself of the
right to all speculation about the nature of what is beyond
appearance. The vocabulary that would describe the other
of metaphysics is itself inscribed within metaphysics, since
the inside and the outside are both conceptually deter
mined from the inside, within a binary myth or cultural
symptom of dual organization. It is thus the inhibition of
synthesis - the delimitation of alterity in advance - that
sets up the modern form ofthe ontological question: 'how
do we know that matter exists?' That the very existence
of materiality is problematic for enlightenment thought
is symptomatic of the colonial trading systems that cor
respond to it. Alterity cannot be registered, unless it can
be inscribed within the system, according to the intercon
nected axes of exchange value (price) and the patronymic,
or, in other words, as a commodity with an owner.
What falls outside this recognized form is everything
that resists commodification, the primordial independ
ence that antedates the constitution of the destituted
proletarian. As I have suggested, this inchoate mass of
more or less explicit resistance to capital is isolated outside
7 1
FAN G E D N O U M E NA
the metropolis by a combination of automatic economic
processes (the concentration of poverty) and restrictive
kinship practices. Modern capital has therefore brought
about a fundamental dislocation between filiation and
alliance by simultaneously de-regulating alliance and
abstracting it from all kinship implications. The primor
dial anthropological bond between marriage and trade
is dissolved, in order that capital can ethnically and
geographically quarantine its consequences from itself.
The question of racism, which arises under patriarchal
capital as the default of a global trade in women (a
parochialism in the system of misogynistic violence; the
non·emergence of a trans-cultural exogamy), is thus more
complex than it might seem, and is bound in profound
but often paradoxical ways to the functioning of patri·
archy and capital. Systematic racism is a sign that class
positions within the general (trans-national) economy
are being distributed on a racial basis, which implies an
effective, if not a juridical, apartheid.
Kant was able to remain bourgeois without overtly
promoting racism only because he also remained an ideal·
ist, or in other words a Christian (a 'cunning Christian'
as Nietzsche calls him)? and identified universality with
ideality rather than with power. Kant's economy of the
concept, which is the assimilation of experience into a
7
F. Nietzsche, Twilight if the Idols; and the Anti-Christ, tr. R. J. Hollingdale (London:
Penguin, 1990), 49·
72
KANT, CAP ITAL, A N D T H E P RO H I B I T I O N O F I N C E ST
system of exchange values, is irresistible in principle, and
thus does not recognize a problem of rebellion. It is only
with the implicit recognition of the need for a systematic
evacuation of rebellion from the metropolis by means of a
geographically distorted labour market that racism arises
in its contemporary form, which is ultimately that of a
restricted franchise (on a national basis) over the politi
cal management of the global means of production. It is
Kant and Imperial Reason
- The text argues that metropolitan capital seeks to become 'offshore' and abstract itself from political reference while remaining dependent on the US war-machine.
- Kant’s moral theory is framed as an ethics of appropriative modernity that breaks from traditional religious codes to establish a universal imperial jurisdiction.
- The 'categorical imperative' is characterized as a unilateral imposition and an absolute monologue of colonial reason that forbids negotiation with alterity.
- Kant’s practical subject is described as a 'deaf führer' issuing commands from a position of extreme fanaticism and unresponsive moral certainty.
- The three Critiques are mapped onto the global system: the first to commodification, the second to imperial jurisdiction, and the third to the exercise of war.
- The Critique of Judgment is interpreted as an 'extortionate' delight in the submission of objects that resist standard market or administrative logic.
Kant's practical subject already prefigures a deaf fUhrer, barking impossible orders that seem to come from another world.
no longer a question of 'taxation without representation'
(except by means of interest payments), but rather of a
metropolitan capital seeking to abstract itself from all
political reference, becoming 'offshore', although not to
the extent that it loses its geopolitical condition of exist
ence (the US war-machine). The increasingly rigorous
differentiation of marriage from trade, or politics from
economics, finds its ultimate conceptual definition in the
thought of a moral agency which is utterly impervious to
learning, communication, or exchange.
It is in his second critique, The Critique if Practical
Reason,8 that Kant capitalizes upon the ethno-ethical con
sequences of the first: that justice must be prosecuted
without negotiation. Kant's moral theory is an ethics of
appropriative modernity, and breaks with the parochial
or scriptural morality of the ancien regime. Where Judaic,
Christian, and Islamic moral codes served as legitimations
8
I. Kant, 'Critique of Practical Reason', in Practical Philosophy, tr., ed. M. J. Gregor
(Cambridge/NY: Cambridge University Press, 1996), 133-271.
7 3
FA N G E D N O U M E NA
of imperial projects in their periods of ascendency, Kantian
morality is, inversely, legitimated by the position of impe
rial or universal jurisdiction. Only that is moral which can
be demanded of every rational being unconditionally, in
the name of an ultra-empire that Kant names the 'empire
of ends' [Reich derZwecke]. The law of this empire is called
the 'categorical imperative', which means a law stemming
solely from the purity of the concept, and thus dictated by
the absolute monologue of colonial reason. In the purity of
categorical morality the incestuous blood-line of the phar
aohs is still detectable, but sublimated into an impersonal
administration. The law is that which cannot be legiti
mately discussed, and which is therefore an unresponsive
or unilateral imposition. It is not difficult to see that the
second critique distills the xenophobic violence of the first
and elevates it to the most extreme possible fanaticism.
Where theoretical knowledge is open to a limited negotia
tion with alterity, practical or moral certainty is forbidden
from entering into relation with anything outside itself,
except to issue commands. Kant's practical subject already
prefigures a deaf fUhrer, barking impossible orders that
seem to come from another world. Kant makes a further
strenuous effort to push forward the horizon of a priori
synthesis in his third critique, The Critique if Judgment.
If the first Critique corresponds to appropriative economy
or commodification, and the second critique corresponds
to imperial jurisdiction, the third critique corresponds to
74
KANT, CAPITA L , AND TH E PROHIBITION OF I NCEST
the exercise of war at those margins of the global system
that continue to resist both the market and the administra
tion. It is concerned with the type of pleasure that is expe·
rienced when an object demonstrates an extra-juridical
submission or abasement before the faculty of judgment;
an experience which Kant associates with the contempla
tion of beauty. The first Critique already exhibits a concep
tion of excess or a priori synthesis that generalizes the
principles of the labour market to all objects of theoretical
cognition and transforms the understanding into a form of
intellectual capital. In the third critique there is a far more
aggressive conception of excess, which generates a feeling
of delight, because it is essentially extortionate. This excess
is not a surplus of certainty stemming from dimensions of
objectivity possessed in advance of intuition, and thus by
right, but rather a surplus of purchase upon the object.
Kant argues that we have no transcendental right to expect
natural laws to be sufficiently homogeneous for us to grasp.
When confronting the heterogeneity of intuition, reason
Capitalism, Racism, and Nomadism
- The text frames the global victory of capitalized reason as a form of imperial conquest that treats nature as a system to be submitted to the 'inside' of the idea.
- Racism is described as a regulated, chronic process of passive genocide necessary to maintain a global labor pool at bare subsistence levels.
- Fascism is avoided in metropolitan centers only by displacing this annihilating poverty and disciplinary violence onto Third World commodity markets.
- A radical international socialism is envisioned not as an ideology, but as a libidinal dissolution of national totalities and unrestrained synthesis.
- The 'anonymous female flux' under patriarchy represents a potentially revolutionary nomadism because the patronymic system strips women of stable ethno-geographical identity.
- The author warns against a sentimental feminism that seeks a return to the mother or national stability, viewing it as a masked form of incestuous economic order.
The Critique of Judgment thus projects the global victory of capitalized reason as pure and exuberant ambition.
must engage in a kind of Pascalian wager; assuming an
intelligible system of nature because it has nothing to lose
by not doing so. The submission of the outside in general
to the inside in general, or of nature to the idea, i.e. con
quest, is not guaranteed by any principle. The capitalist
feels a neutral satisfaction in the production of 'normal
profits', but the conqueror feels exultation in the attain
ment of victory, precisely because there was no reason to
75
FANG ED NOU M ENA
expect it. Kant's advice to the imperial war-machine in his
third critique can be summarized as: 'treat all resistance as
if it were less than you might justifiably fear'. The Critique
rifJudgment thus projects the global victory of capitalized
reason as pure and exuberant ambition.
The only possible politics of purity is fascism, or a
militant activism rooted in the inhibitory and exclusive
dimensions of a metropolitanism. Racism, as a regulated,
automatic, and indefinitely suspended process of genocide
(as opposed to the hysterical and unsustainable genocide
of the Nazis) is the real condition of persistence for a global
economic system that is dependent upon an aggregate
price of labour approximating to the cost of its bare sub·
sistence, and therefore upon an expanding pool of labour
power which must be constantly 'stimulated' into this
market by an annihilating poverty. If fascism is evaded in
metropolitan societies it is only because a chronic passive
genocide trails in the wake of capital and commodity mar
kets as they displace themselves around the Third World,
'disciplining' the labour market, and ensuring that basic
commodity prices are not high enough to distribute capital
back into primary producer societies. The forces most
unambiguously antagonistic to this grotesque process
are 'exogamic' (or, less humanistically, 'exotropic'); the
synthetic energies that condition all surplus value, and
yet co-exist with capital only under repression. A radical
international socialism would not be a socialist ideology
7 6
KANT, C A P I TA L , A N D TH E P RO H I B I T I O N OF I N C E ST
generalized beyond its culture of origin, but a programme
of collectivity or unrestrained synthesis that springs from
the theoretical and libidinal dissolution of national totality.
To get to a world without nations would in itself guarantee
the achievement of all immediately post-capitalist social
and economic goals. It is this revolutionary requirement
for a spontaneously homeless subversion that gives an
urgency to certain possibilities of feminist politics, since
the erasure of matrilineal genealogy within the patriarchal
machine means that fascisizing valorizations of ancestry
have no final purchase on the feminine 'subject'. The pat
ronymic has irrecoverably divested all the women who fall
under it of any recourse to an ethno-geogra phical identity;
only the twin powers of father and husband suppress the
nomadism of the anonymous female fluxes that patriarchy
oppressively manipulates, violates, and psychiatrizes. By
allowmg womensomeaccess to wealthandsocial prestige
the liberalization of patriarchy has sought to defuse the
explosive force of this anonymity, just as capital has tended
to reduce the voluptuous excess of exogamic conjugation
to the stability of nationally segmented trading circuits.
The increasingly incestual character of economic order -
reaching its zenith in racist xenophobia - is easily masked
as a series of 'feminist' reforms of patriarchy; as a de-com
modification of woman, a diminution of the obliterating
effects of the patronymic, and a return to the mother. This
is the sentimental 'feminism' that Nietzsche despised, and
77
FAN G E D N O U M E NA
whose petit-bourgeois nationalist implications he clearly
saw. The only resolutely revolutionary politics is feminist
in orientation, but only if the synthetic forces mobilized
under patriarchy are extrapolated beyond the possibil
Patriarchy and Revolutionary Violence
- The text argues that genealogy should be viewed as a dissipation of origins rather than a sentimental search for roots.
- Patriarchy is described as a system that exploits and inhibits the synthetic, communicative function of women, assigning them a revolutionary destiny.
- The author criticizes existing feminist theory for being 'feebly nostalgic' or pacifistic, arguing that true liberation requires a military-grade ruthlessness.
- Nationalist struggles are dismissed as mere geographical modulations of capital that fail to challenge the underlying structure of neo-colonialism.
- The state apparatus of advanced industrial societies can only be defeated through an escalation of violence that the author describes as 'fighting in hell.'
- The conservation of the nation-state form is seen as a guarantee that society will remain trapped in a system of inhibited synthesis and patriarchy.
A revolutionary war against a modern metropolitan state can only be fought in hell.
ity of assimilation, rather than being criticized from the
perspective of mutilated genealogies. Genealogy as the
dissipation of recuperative origins (Nietzsche), not as sen
timental nostalgia. The women of the earth are segmented
only by their fathers and husbands. Their praxial fusion
is indistinguishable from the struggle against the micro
powers that suppress them most immediately. That is why
the proto-fascism of nationality laws and immigration
controls tends to have a sexist character as well as a racist
one. It is because women are the historical realization
of the potentially euphoric synthetic or communicative
function which patriarchy both exploits and inhibits that
they are invested with a revolutionary destiny, and it is
only through their struggle that politics will be able to
escape from all fatherlands. In her meticulous studies
of patriarchy Luce Irigaray has amply demonstrated the
peculiar urgency of the feminist question,9 although the
political solutions she suggests are often feebly nostal
gic, sentimental, and pacifistic. Perhaps only Monique
Amongst the growing body of Luce lrigaray's work available in English the most
powerful arguments are to be found, perhaps, in Speculum if the Other Woman, tr. G. C.
Gill (Ithaca, NY: Cornell University Press, 1985) and in essays amongst those compiled
in This Sex which is not One, tr. C. Porter, C. Burke (Ithaca, NY; Cornell University
Press, 1985), especially 'Women on the Market' CLe marche des femmes'), 170-91,
and 'Commodities Among Themselves' ('Des marchandises entre elIes'), 192-7.
7 8
KANT, C A P ITA L , A N D T H E P RO H I B IT I O N O F I N C E S T
Wittig has adequately grasped the inescapably military
task faced by any serious revolutionary feminism,lO and it
is difficult not to be dispirited by the enormous reluctance
women have shown historically to prosecute their strug
gle with sufficient ruthlessness and aggression. The left
tends to be evasive about the numbing violence intrinsic
to revolutionary war, and feminism is often particularly
fastidious in this respect, even reverting to absurd mysti
cal and Ghandian ideologies. If feminist struggles have
been constantly deprioritized in theory and practice it is
surely because of their idealistic recoil from the currency
of violence, which is to say, from the only definitive 'matter'
of politics. The state apparatus of an advanced industrial
society can certainly not be defeated without a willingness
to escalate the cycle of violence without limit. It is a terrible
fact that atrocity is not the perversion, but the very motor
of such struggles: the language of inexorable political
will. A revolutionary war against a modern metropolitan
state can only be fought in hell. It is this harsh truth that
has deflected Western politics into an increasingly servile
reformism, whilst transforming nationalist struggles into
the sole arena of vigorous contention against particular
configurations of capital. But, as I hope I have demon
strated, such nationalist struggles are relevant only to the
geographical modulation of capital, and not to the radical
10 See especially M. Wittig. Les Guerilleres (Paris: Minuit, 1969); Ir. D. Le Vay (Chicago,
Ill.: University of Illinois Press, 2007).
7 9
FAN G E D N O U M E NA
jeopardizing of neo-colonialism (inhibited synthesis) as
such. Victorious Third World struggles, so long as they
have been successfully localized, do not lead to realistic
post-capitalist achievements, and certainly not to post
patriarchal ones, since the conservation of the form of the
nation state is itself enough to guarantee the reinsertion
of a society into the system of inhibited synthesis. For as
long as the dynamic of guerilla war just leads to new men
at the top -with all that this entails in terms of the commu
nication between individuated sovereignties - history will
continue to look bleak. For it is only when the pervasive
Feminist Violence and Trakl's Failure
- The text argues that breaking the bond between masculinity and war through feminist violence is necessary to dismantle the patriarchal world order.
- The author critiques the 'sordid cowardice' of Kantian modernity and calls for the emergence of 'new Amazons' to bring about its end.
- Heidegger's 1953 interpretation of Georg Trakl is examined, questioning the traditional philosophical impulse to 'use' poetry for representational concepts.
- The author rejects the notion of 'success' in poetry, viewing Trakl’s life of addiction and psychosis as a productive, traumatic failure rather than a lack of achievement.
- Trakl's style is described as a drive toward the dissolution of evaluative criteria, pushing language into shadows where formal aesthetics lose all pertinence.
- True engagement with Trakl’s work requires abandoning the desire for mastery and instead learning to 'write in ashes.'
Trakl's traces are the ruins of a miserable, even horrific, failure. A failure to adapt or conform, to repress or sublimate adequately, to produce, resolve, comfort, or conclude.
historical bond between masculinity and war is broken by
effective feminist violence that it will become possible to
envisage the uprooting of the patriarchal endogamies that
orchestrate the contemporary world order. With the aboli
tion of the inhibition of synthesis - of Kantian thought - a
sordid cowardice will be washed away, and cowardice is
the engine of greed. But the only conceivable end of Kan
tianism is the end of modernity, and to reach this we must
foster new Amazons in our midst.
8 0
Narcissism and Dispersion in
H eidegger's 1 953 Trakl I nterpretation
Martin Heidegger's thinking continues to have a massive
- and constantly growing - influence on the development
of modern 'philosophy'; in the formulation of its ques
tions, the selection of its 'objects', and the constructions
of its history. Yet this in itself might not be enough to
explain why his 1953 essay on the Austrian poet Georg
Trakl should be of interest to us. Does Heidegger's essay
perhaps represent Trakl to us in a way that is enlightening
or informative? Does it tell us something about poetry, or
history, or language in general? Does it, in fact, succeed
in doing anything at all? In his safely vacuous text on
Trakl's poetry Herbert Lindenberger writes:
It would seem gratuitous to complain of the wrong
headedness of Heidegger's approach to Trakl, for
Heidegger does not even pretend to use the poets he
writes about for any purpose except the exposition of
his own philosophy. But Heidegger's study of Trakl
seems to me considerably less successful than his
study of Holderlin . . . 1
1
H. Lindenberger, George Trakl (NY: Twayne, 1971), '41.
8 1
FAN G E D N O U M E NA
Lindenberger does not ask what meaning can be given
to 'success' within a history - like Heidegger's history
of being - for which the proper sense of progress has
always been the expansion of devastation; a history, that
is, which has been perpetually deflected from thinking by
a pervasive theo-technical tradition. Platonic-Christian
culture has made it not only possible, but also impera
tive, to think of poetry as the product of a poet, and,
derivatively, as something to be 'used' by a philosopher
for the purpose of illustrating representational concepts.
It is this tradition which directs us to ask about the useful
ness and representational adequacy of Heidegger's essay.
Such questions are symptoms of a profound and positively
constituted illiteracy, whose hegemony it has been the
intellectual task of the (post-)modern age to question.
As for Trakl - who failed to organize his desires accord
ing to the laws of his civilization, failed to keep a job,
became addicted to opium, enmeshed in alcoholism, failed
to defeat his psychosis and died of a cocaine overdose in
a military pharmacy - what would we be doing to him
if we said he had 'succeeded' as a poet? Appropriating
his delicate, futile ardour to a society that has forgotten
how to despise itself? Trakl's traces are the ruins of a
miserable, even horrific, failure. A failure to adapt or
conform, to repress or sublimate adequately, to produce,
resolve, comfort, or conclude. This failure is not merely
a default, however, but a violently traumatic condition.
82
NARC I S S I S M AN D D I S P E RS I O N
The evolution of his style, if it is still possible to write coher
ently of such a thing, is a drive towards the dissolution of
every criterion for evaluation. It is this above all which
he learns from his decisive encounters with Rimbaud
and Holderlin. The traditional aesthetics which would
distinguish a traumatic content from a perfectly 'achieved'
formal presentation loses all pertinence as Trakl presses
language into the shadows. The last thing we should want
is for Heidegger to 'master' these traumatized signs. To
learn from Trakl is to write in ashes.
A long essay by Heidegger appeared in the sixty-first
(1953) issue of the German literary periodical Merkur
Heidegger's Situating of Trakl
- Heidegger’s engagement with Georg Trakl’s poetry is centered on 'situating' the work rather than providing a conventional literary analysis.
- The structure of Heidegger's essay eschews pedagogical progression, instead adopting the motion of a wave that coils and repeats.
- Heidegger rejects European aesthetics and the subject-object epistemological categories that typically define literary criticism.
- The text argues that meta-language is a tool of metaphysics that destroys the essential kinship between the thinker and the poet.
- Heidegger seeks an 'impersonal thinking' where the language of poetry is guided into a relationship with itself rather than being translated.
- The ultimate goal is the erasure of terminological distinctiveness to move beyond the epoch of philosophy and its meta-linguistic constraints.
To depict this complex progression it is perhaps necessary to borrow the 'metaphor' Heidegger himself calls upon, that of a wave, which describes motion coiling into an enigmatic pulsion and cyclical repetition.
which discussed the work of Georg Trakl. This mysterious
text, at once intensely personal and strangely detached,
was entitled 'Georg Trakl. Eine Erorterung seines Gedich
tes' ('Georg Trakl. A situating of his poetry'). The same
essay, renamed 'Die Sprache im Gedicht' ('Language
in the Poem'), and now subtitled 'Eine Erorterung von
Georg Trakls Gedicht' ('A situating of Georg Trakl's
poetry'), was later published (in 1959) as the second
division of Heidegger's book Unterwegs zur Sprache (On
the Way to Language). The essay which precedes it in the
book, 'Die Sprache' ('Language'), is also concerned with
Trakl, or, more precisely, with the reading of a single
Trakl poem, Ein Winterabend ('A Winter Evening'). 'Die
Sprache im Gedicht', in comparison, cites, or sites, no
fewer than forty-three ofTrakl's poems in the course of a
8 3
FAN G E D N O U M E NA
wide-ranging search for the well-spring of their peculiar
language. Outside of these two texts Heidegger makes
only glancing references to Trakl's work and to the impact
it had on his own thinking.
The 1953 essay consists of three numbered sections of
uneven length, prefaced by a short untitled introduction
or prologue. These basic partitions are not interrelated
according to any conventional pedagogical principle, and
do not unfold the stages of a developing argument. It is, for
instance, very difficult to discriminate between the essay's
three main sections in terms of theses or themes, since each
successive section recollects the discussion of the last and
subtly displaces it. To depict this complex progression it
is perhaps necessary to borrow the 'metaphor' Heidegger
himself calls upon, that of a wave, which describes motion
coiling into an enigmatic pulsion and cyclical repetition.
Yet the peaks and troughs that alternate within Heidegger's
text do not follow the regular trace of an oscillograph; they
cut a jagged and confusing path. As they rise a distinct
'theme' emerges, momentarily isolated from a maelstrom
of interweaving currents. Due to the intensity of Trakl's
language, and to the momentum historically invested
within it, each theme shatters into blinding foam when
swept to its apex, and sinks again into swirling depths. In
this essay I shall only attempt to explore limited stretches
along a single of these interwoven currents: pursuing
84
NARC I S S I S M A N D D I S P E R S I O N
elements of reflection and dispersion in Heidegger's read
ing of Trakl's poem Geistliche Dammerung.
Heidegger's readings of poetry are perhaps most
distinctively characterized by the refusal to participate
affirmatively in the discourse of European aesthetics, and
the associated project of rigorously bracketing subject
object epistemological categories. He argues that when
the categories of aesthetics are carried into the domain
of linguistics or other varieties of language study they
take the form of a distinction between a normal and a
meta-language. The minimal notion of meta-language is
a technical terminology which is distinctive to the critical
or interpretative text. This terminology traces an ancestry
for itself that is divergent in principle from that of the
texts to which it is 'applied'. The kinship of 'thinker' and
'poet' is annihilated. At variance to this sedimenting of
metaphysics, Heidegger pursues a tendency towards the
uttermost erasure of terminological distinctiveness. The
language of poetry is not to be translated, but simply
guided into a relationship with itself. And this guidance
is not to be that of the thinker qua subject, but that of an
impersonal thinking which is no longer disguised in the
cloak of philosophy. Philosophy would no longer be the
guardian of this relation, since the epoch of philosophy
is simultaneous with that of meta-language. Or, put dif
ferently, meta-language is pre-eminently the language of
metaphysics.
8 5
FAN G E D N O U M E NA
The final essay in Unterwegs zur Sprache, entitled 'Der
Heidegger, Language, and Narcissism
- Heidegger explores the idea that language concerns itself only with itself, a concept derived from Novalis's 1798 text.
- The text distinguishes language's self-relation from 'egoistic solipsism,' arguing that language's self-regard actually frees what is shown into its own appearing.
- Heidegger explicitly fends off psychoanalytic interpretations that would view the 'circle of language' as a symptom of auto-eroticism or the death drive.
- The interpretation of Nietzsche's 'eternal recurrence' is reclaimed from Freudian energetics and repositioned within the temporality of being and poetry.
- The poem 'Geistliche Dämmerung' is identified as a unique site of resistance that Heidegger cannot easily splinter or assimilate into his broader ontological project.
At this crucial moment the circle of language seems to symptomize a type of auto-eroticism, displacing itself into a geometric figure of desire.
Weg zur Sprache', begins by citing a sentence from
Novalis's 1798 text Mon 0 log: 'Precisely what is most
peculiar about language, that it only concerns itself
with itself, nobody knows'.2 It is from this thought - of
language accounting for itself in itself - that Heidegger
begins his meditation on poetry. The vocabulary for the
meditation is to stem from the reading itself. Indeed,
thought is to be carefully dissolved into poetry, but
only in such a way that poetry is strengthened in its
thinking. Heidegger trusts that the key to what is said in
the reserve of Western languages, while itself reserved,
is yet able to be elicited. He suggests:
Thus released into its own freedom, language can
concern itself solely with itself. This sounds like the
discourse upon an egoistic solipsism. But language
does not insist on itself in the sense of a self-centred
all-forgetting self-mirroring. As saying, the weft of
language is the propriative showing, which precisely
deflects its gaze from itself, in order to free what is
shown into its appropriate appearing.3
2
Novalis, Dichtungen (Reinbek bei Hamburg: Rowohlt: '963), 5; M. Heidegger, Unterwegs
zurSprache (Pfullingen: Neske, 1982), 241; tr. P.D. Hertz,]. Stambaugh as On the Way
to Language (London: Harper & Row, 1982).
3
Heidegger, UnteroJegs zur Sprache, 262.
8 6
NARC I S S I S M A N D D I S P E R S I O N
Language is to be understood in a way that could be
misread as a theory of narcissism, since it relates itself
to itself, and this could be taken to be analogous to the
self-regard of a subject enraptured by its own reflection.
The discourse on language must therefore fend off a
misinterpretation that threatens to appropriate it, or at
least deflect it, into a psychoanalysis of the sign. At this
crucial moment the circle of language seems to sympt
omize a type of auto-eroticism, displacing itself into a
geometric figure of desire. In insisting that his approach
to language is not to be confused with a dissolution of the
subject into unconscious energetics - and in the prologue
to 'Die Sprache im Gedicht' the reference to psychoa
nalysis is explicit - Heidegger marks a crucial historical
crossroads in the interpretation of Nietzsche's doctrine
of the cosmic circle, the eternal recurrence of the same.
Heidegger seeks rigorously to distinguish his own reading
of eternal recurrence - as the last attempt to conceive the
temporality of beings, as recapitulation of the history
of being, as the circle of language, and even as Trakl's
'icy wave of eternity' - from what has been interpreted
within the Freudian research programme as the 'death
drive', as the economy of desire, and as the return of the
inorganic. Return, which is perhaps the crucial thought of
modernity, must now be read elsewhere. The dissolution
of humanism is stripped even of the terminology which
87
FAN G E D N O U M E NA
veils collapse in the mask of theoretical mastery. It must
be hazarded to poetry.
Geistliche Diimmerunt is the only poem cited by Hei
degger in its entirety in the essay, and this is of some con
siderable significance. Dissolving the unity and specificity
of the separate poems plays a vital role in Heidegger's
project of uncovering a site [Ort] that relates to the Trakl
corpus indifferently and as a whole. Up to the point at
which Geistliche Diimmerung is introduced Heidegger
conserves the status of this site as the sole 'ontologi
cally' significant totality by splintering, rearranging, and
repeating fragments of the individual poems. The resilient
integrity of this particular poem in Heidegger's text might
therefore indicate a special difficulty, one that obstructs
the process of assimilation and resists the hegemony of
the site. If this is so it is possible that an issue is at stake
in the reading of this poem which resists absorption into
any readily communicable truth ofTrakl's poetry, an issue
that perhaps remains in some sense exterior to a 'thinking
Trakl, Heidegger, and the Beast
- The text explores Martin Heidegger’s philosophical 'dialogue' with the poetry of Georg Trakl, focusing on the ambiguity of twilight and the nature of animality.
- A linguistic tension exists in the title 'Geistliche Dämmerung,' which can mean either a spiritual dawn or dusk, reflecting Trakl's possible Baudelairean influences versus Heidegger's insistence on ambiguity.
- The poem 'Geistliche Dämmerung' introduces the 'dark beast' at the forest's edge, a figure that Heidegger interprets as a representation of man (der Mensch) navigating the horizon of being.
- Translation difficulties arise with the German word 'Wild,' which encompasses feral animals, game, and the concept of wilderness, making it difficult to capture Trakl’s specific exploration of animality in English.
- Heidegger identifies the 'blue beast' as a creature whose essence lies not in biological animalness but in a 'thoughtful gaze' that looks toward the spiritual night.
- The figure of the sister and her 'lunar voice' haunts the poetic landscape, acting as a persistent presence that displaces other thematic preoccupations within the 'spiriting night.'
The blue beast is an animal whose animality presumably rests, not in animalness, but rather in that thoughtful gaze, after which the poet calls.
dialogue' with the poet, but one that also retains a peculiar
insistence. As Heidegger's reading unfolds it comes to
chart a closure of communication of precisely this kind.
4
The German Diimmerung is as ambiguous as the English 'twilight', and can mean the
half-light of dawn as well as that of dusk. As Raudelaire is almost certainly Trakl's first
major poetical influence (0. Basil, Trakl [Reinbek bei Hamburg: Rowohlt, 1965], 42-9)
it is tempting to read the title Geistliche Ddmmerung as a translation of L 'Aube spirituelle
(,Spiritual dawn'), the forty·seventh poem of Spleen et Ideale (C. Baudelaire, Oeuvres
Completes [Paris: Gallimard, 1975], vol. 1, 46). Heidegger, however, is determined to
maintain the ambiguity of Dammerungin his interpretation (Heidegger, Unterwegs zur
Sprache, 42-3), and the importance of Abend (,evening') in Trak!'s poetry lends weight
to this 'decision'.
8 8
NARCISSISM AND DISPERSION
There is no unambiguous point at which the discussion
of Geistliche Diimmerung begins. It is approached through
a discussion of the final lines of Sommersneige (,Summer
Solstice') in which the steps of a stranger ring through the
silver night, and a blue beast is brought to the memory
of its path, the melody of its spiriting year. To this is
conjoined the hyacinthine countenance of twilight from
the poem Unterwegs ('Underway '). Heidegger introduces
the poem in order to address what is named in its title,
without any hint that the perplexing figure of the sister is
to haunt it both here and in its later citation,5 displacing
all other preoccupations. It reads:
Stille begegnet am Saum des Waldes
Ein dunkles Wild;
Am H tigel endet leise der Abendwind,
Verstummt die Klage der Amsel,
Und die sanften Floten des Herbstes
Schweigen im Rohr.
Auf schwarzer Wolke
Befahrst du trunken von Mohn
Den nachtigen Weiher,
5
Ibid., 67-81.
8 9
FANGED NOUM ENA
Den Sternenhimmel.
Immer tont der Schwester mondene Stimme
Durch die geistlichc Nacht.
(At the forest's rim silence meets / A dark beast; / Quietly, on
the hill, dies the evening wind, liThe plaint of the blackbird
ceases, / And the gentle flutes of autumn I Fall silent in the
reed. li On a black cloud you sail, I Drunk on poppies, I
The nocturnal pool, I I The starry sky. I The lunar voice of
the sister sounds unceasing I Through the spiriting night.) 6
The translation of 'beast' for Wild is of course unsatisfac
tory. In German the word Wild denotes a feral animal,
especially one hunted as game, and sometimes it specifies
such animals as deer. In addition it connotes wildness and
wilderness, since the adjective 'wild' exists in German as
well as English. Furthermore, it is probably etymologically
related to the similar word Wald (forest). This network
of associations seems impossible even to approach in
translation. Such difficulties are particularly frustrating
inasmuch as this translation must bear almost the entire
weight of Trakl's exploration of animality, and the further
stresses of Heidegger's response to it.
6
Ibid., 48; G. Trakl, Das dichterische Werk (Munchen: Deutscher Taschenbuch Verlag,
197!Z), 66. For a recent English translation of most Trakl poems referred to in this essay,
see G. Trakl, Poems and Prose: A Bilingual Edition tr. A. Stillmark, (Illinois: Northwestern
University Press, 2005).
90
NARC I S S I S M A N D D I S P E RS I O N
For Heidegger the 'dark beast' is clearly the 'blue beast'
who negotiates the difference between animality and the
opening of the horizon of being - der Mensch. The wild
ness of the beast is not swallowed by the forest; instead
it gives to the forest a margin. But this margin is not a
fixed demarcation, and is not illuminated by the light of
day. The shadowy animal, trembling with uncertainty in
the evening wind, is man:
The blue beast is an animal whose animality pre
sumably rests, not in animalness, but rather in that
thoughtful gaze, after which the poet calls. This
Heidegger, Trakl, and Reflective Transcendence
- Heidegger explores the 'animal rationale' as an entity not yet firmly established, oscillating between animality and a thinking that transcends biological calculation.
- The distinction between humanity and beasts is rooted in transcendental thinking and the philosophical tradition of 'reflection,' where the human is defined by being caught in its own mental play.
- Through an analysis of Trakl’s poetry, Heidegger posits that the night sky is 'in truth' a pool, challenging habitual representations of spatiality and metaphor.
- The pool serves as a mirror where humanity initially seeks its own countenance in a narcissistic reverie, attempting to ground its own transcendence.
- Ultimately, this reflection is shattered by the 'abyssal twilit blue' of the nocturnal pool, which returns no familiar image and reveals humanity as a lack of ground.
In the darkened pool the gaze does not return in a familiar form; it reveals instead an abyssal twilit blue, which colours both the dawn and dusk of the spiriting night.
animality is yet distant, and scarcely to be registered,
so that the animality of the animal noted here oscil
lates in the indeterminate. It is not yet brought into
its weft [Wesen]. This animal, the one that thinks, ani
mal rationale, humanity, is, according to Nietzsche's
words, not yet firmly established [fest gestellt r
Heidegger takes the weave of the distance separating
humanity from the beasts of the wilderness to rest in a
type of thinking that is irreducible to adaptive biological
calculation. Such thinking is rooted in the temporalization
of the ontological difference, and has been traditionally
unified - if only confusedly so - about the thought of
7
Heidegger, Unterwegs zur Sprache, 45.
9 1
FANG E D N O U M E NA
transcendence. Transcendental thinking has the peculiar
characteristic of relating itself to the thematic of thought
itself, a tendency which has been systematized within
epistemological philosophy. Within the Western tradition
this type of cognition has been designated ' reflection'. The
human is that animal caught in the play of its reflection.
The line of approach that Heidegger follows, in what is
to be his first and sole decisive encounter with the poem,
begins with its final stanza:
The starry sky is portrayed [dargestellt, staged, placed
there, the stellen is always decisive for Heidegger 1
in the poetic image of the nocturnal pool. So our
habitual representation [Dor-stellen ] thinks it. But the
night sky is in the truth of its weft this pool. Over
against this, what we otherwise call the night remains
only an image, namely, the faded and vacuous after
image [Nachbild, perhaps also 'copy'] of its weft.8
The insistence that the night sky is in truth a pool is
not irreducible either to Heidegger's phenomenological
stubbornness, or to a defence of the primordiality of
metaphor. It is far more intimately connected with the
problematic of spatiality in post-Kantian thinking, and
beyond this with the Greek thought of the heavens as xao1;.
8
Ibid., 48.
92
NARCISSISM AND DISPERSION
These concerns are bound up with Heidegger's pursuit of
that reflection which yields an image of human transcend
ence, and therefore marks a firmly established separation
of Dasein from the psychology of animals. This pursuit
is perhaps the aspect of Heidegger's work which is clos
est to the concerns of the ontotheological tradition, the
point where his thinking is most 'human, all-to-human'.
But there is, nevertheless, something both crucial and
'technically' precise at issue in this play of mirrors. The
passage continues:
The pool and the mirror-pool often recur in the poet's
poetry. The water, sometimes blue, sometimes black,
shows humanity its own countenance, its returning
gaze. But in the nocturnal pool of the starry sky
appears the twilight blue of the spiriting night. Its
gleam is cool. 9
The starry sky has an integral relation to reflection, but
one which is of daunting complexity. Heidegger first
turns to the pool itself, beside which humanity lies, lost
in narcissistic reverie. Here humanity gazes upon itself,
although we are not told whether, like Narcissus, this
gaze is inflamed with desire.
9
Ibid., 48.
9 3
FANGED NOUM ENA
Heidegger finds the compulsive character of Trakl's
imagery to be indicative of a repression, but one which
does not seem to be - at least superficially - primarily
sexual. He takes thc reflectivity of Trakl 's mirrors to exceed
all representation and ontical objectivity [Vorhandenheit].
In the darkened pool the gaze does not return in a famil
iar form; it reveals instead an abyssal twilit blue, which
colours both the dawn and dusk of the spiriting night.
The image of no thing returns. Reflection is shattered
against the impersonal, against the impassive shade of a
pure opening or cleft in beings. Humanity is thus reflected
as the default of an (ontical) image; as a lack of ground
The Lunar Sister and Chaos
- Heidegger explores the concept of chaos as a transcendental abyss or 'XaoS' that precedes formal ontology.
- The figure of the sister emerges as a lunar guide who renders the world visible during the darkness of nihilism.
- The sister represents a transitional state between the collapse of theological metaphysics and an unknown future.
- The 'stranger' and the 'brother' navigate a nocturnal journey across a black pool, following a flickering, golden light.
- Mythological connections link the lunar woman to Selene and Semele, the mother of Dionysus, suggesting a lethal radiance.
- The narrative dissolves into a 'mythological aporia' where traditional identities and genres are no longer fixed.
The 'lunar voice' of the sister, which always sounds through the spiriting night, is then heard by the brother in his boat when he attempts to follow the stranger in a nocturnal journey across the pool.
or Abgrund which is the transcendental condition of any
possible ontology. The heavens are an abyss: XaoS. As we
follow Heidegger's discussion of Geistliche Diimmerung
further, this classical comprehension of chaos enters into
a problematic negotiation with the cuntemporary sense of
the word as disorder. It is this negotiation which reopens
the path to Trakl's most crucial explorations.
As the reading of Geistliche Diimmerung proceeds
Heidegger's discussion suddenly changes key, without
indicating that there is any thematic unity between the
mirror and the mysterious figure who is now introduced,
the sister:
The cool light stems from the shining of the lunar
woman [Miindin] (Selanna) . Ringing her luminosity,
94
N A RC I S S I S M A N D D I S P E RS I O N
as ancient Greek verse says, the stars fade and even
coo!. Everything becomes 'lunar'. The stranger [der
Fremde, the German masculine] stepping through the
night is called 'the lunar one'. The 'lunar voice' of
the sister, which always sounds through the spiriting
night, is then heard by the brother in his boat when
he attempts to follow the stranger in a nocturnal
journey across the pool, which is still 'black' and
scarcely illuminated by the stranger's goldenness.lO
The sister is allied to the moon, and thus to the luminosity
of the night. Her power to render a world visible holds
sway in the epoch of world-calumniating darkness initi
ated by the flight of the Hellenic gods, whose end is her
alded by the stranger's goldenness, which is the flickering
light of a new dawn. It is the sister who guides the path
of the wanderer throughout the nihilistic metamorphoses,
during which the securities of ontotheology lose their
authority and disappear into their twilight, and before
the arising of that new thinking which betrays itself only
in scarcely perceptible hints. The sister is associated with
transition, and with the indeterminacy of an unthreaded
time. Even the corrupted seals that stamped the distinc
tive mark of scholasticism and theological apologetic
10 Ibid., 48-9.
9 5
FAN G E D N O U M E NA
are broken, and no new type has taken their place. The
haunting voice of the sister is heard as the brother drifts
away from the ancient genus of theological metaphysics
and towards the genus of the stranger. Yet the sister's
voice cannot be identified with the type of the past or with
that of the future, it cannot be subsumed within a genre.
The passage is not so easily reduced to even this ten
tative meta physico-historical familiarity, however, since
Hcidegger does not only mention the sister, but also
SeIanna; the strangers (der Fremde, der Fremdling - the
gender of das Fremde from Unterwegs zur Sprachell - has
now strangely metamorphosed); and the sister's brother.
What is the meaning of this perplexing cast? What relation
does Selanna, the lunar woman, have to the sister who
speaks in lunar tones? Of Selanna, David Farrell Krell
writes: 'Heidegger recollects the way the ancient Greek
lyricists speak of the moon and stars; in the context of
abscission, of the confluent twofold, and Selene, who as
Semele is the mother of Dionysos . .. ' .12 In the classical
myth Semele is tricked by Hera into demanding that her
lover (Zeus) reveal himself to her in his full presence, and
when he does so she is killed by his radiance. An event
that might suggest some relation to the 'stranger's golden
ness'. But even following this apparently unambiguous
11 Ibid., 41.
12
D.F. Krell, Intimations qf Mortality: "lime, Truth and Finitude in Heidegger's Thinking of
Being (University Park, Penn.: Penn. State University Press, 1986), 171.
9 6
NARC I S S I S M A N D D I S P E R S I O N
path quickly leads us into a kind of mythological aporia,
since, as Robert Graves notes in The White Goddess:
The Vine-Dionysus once had no father, either. His
nativity appears to have been that of an earlier Diony
sus, the Toadstool-god; for the Greeks believed that
Dionysian Delirium and Social Policing
- The transition from mushroom-based cults to wine-based Dionysian worship represents an early state effort to regulate socially unassimilable deliria.
- Attributing a patrilinear genealogy to Dionysus serves as a repressive mechanism to domesticate an intoxication that originally 'came from nowhere.'
- Western history and scientificity are characterized as inherently delirious, rooted in a 'constitutive arche-amnesia' or a foundational default of discourse.
- The medicalization of madness is viewed as a modern continuation of ancient political efforts to police social pathology and control the 'pharmakon.'
- Trakl’s poetry introduces a 'lunar' problematic where intoxication evades traditional typographic structures through the figure of the sister.
An intoxication that came from nowhere, from a bolt of lightning, is asked to show its birth-certificate.
mushrooms and toadstools were engendered by light
ning -not sprung from seed like all other plants.
When the tyrants of Athens, Corinth and Sicyon legal
ized Dionysus worship in their cities, they limited the
orgies, it seems, by substituting wine for toadstools;
thus the myth of the Toadstool- Dionysus became
attached to the Vine-Dionysus, who now figured as a
son of Semele the Theban and Zeus, Lord of lightning.
Yet Semele was the sister of Agave, who tore off her
son Pentheus' head in a Dionysiac frenzy.13
The attribution of a (patrilinear) genealogy to Dionysus
is complicit with a project of repression. An intoxication
that came from nowhere, from a bolt oflightning, is asked
to show its birth-certificate. Wine, which Plato will later
accommodate even to dialectic, displaces the fungus of the
Dionysian cults (Amanita Muscaria). The sacred mushroom
of the cults is held to be responsible for those socially unas
similable deliria which are a threat to the 1toAi�.
l3 R. Graves, The White Goddess: A Historical Grammar of Poetic Myth (London: Faber &
Faber,l96l),159·
97
FANGED NOUMEN A
But what is the relation between this ancient policing of
social pathology and Heidegger's interpretation ofTrakl?
How can a bridge be built between such ontic-empirical
history, and the onto-transcendental question concerning
the site of poetry? The spanning of such a gulf has been
hindered by the medicalization of the history of derange
ment, and its reduction to the historical and psychiatric
study of madness. But this regional investigation is noth
ing other than the contemporary instance ofthat discourse
of the 7Tol\i� which first instituted a genealogy of Dionysus.
Such a construction patently fails to mark the inherently
delirious character of western history, and, therefore, of
scientificity itself. This is not only a matter of ontotheolog y
being rooted in a specific amnesia. A delirium integral to
the western graphic order implies, more radically, that
any possible history must arise out of the forgetting (or
secondary repression) of a constitutive arche-amnesia (the
ellipsis integral to inscription ). Klossowski has even been
led to suggest that western science is aphasic, because it is
initiated in the default of a foundational discourse .14 This
default is not merely a passively accepted pathology, it is an
inscribed, prescribed, or actively administered pharmaco
pathology. The response of the West to the writing of itself
has been that of a poisoning. This is why the fact that
Selanna substitutes for a delirium without origin -which is
14 P. Klossowski1 Nietzsche et Ie cercle vicieux (Paris: Mercure de France, 1978), 16; tr. D.
W. Smith as Nietzsche and the Vicious Circle (London: Continuum, 2005), xvii.
98
NARCISSISM AND DISPERSION
equally a delirium of origins -seems to resonate with what
Derrida entitles an aggression pharmakographique.
In Trakl's Geistliche Ddmmerung the path of the phar
makon, the intoxicated voyage across the nocturnal pool,
seems to evade Geschlecht (the general resource of typogra
phy). Instead it crosses the starry sky, through which the
lunar voice of the sister resounds. A problematic of the
moon is introduced, demanding some minimal gesture
of interpretation. Perhaps to speak of the 'lunar' in this
fashion is simply to speak of the way things appear in the
night.15 In the poem In der Heimat, for instance, the sister
is seen asleep bathed in moonlight:
Der Schwester Schlaf ist schwer. Der N achtwind wiihlt
In ihrem Haar, das mondner Glanz umspiilt.
(The sister's sleep is heavy. The nightwind burrows /
In her hair, bathed in the gleam of the moon.)16
Trakl's Lunar Night
- The Traklean night is not merely a backdrop but an active expression of 'nocturnal luminacy' and the 'silver voice' of the sister.
- Etymological links connect the moon to mania, the mind, and the feminine, framing the night as a time of derangement and lunar transformation.
- The sister acts as a threshold figure, moving between the reflective order of the father's house and the 'illimitative difference' of the night sky.
- The shattering of the mirror represents an explosion of desire that exceeds narcissism and representation, flooding the subject with nocturnal intensities.
- By breaching the family structure, the sister opens the 'accursed genus' to an unappropriated alterity that exists outside of patrilineal exchange.
- This nocturnal delirium suggests a positive differentiation from the day, where the night becomes a fully realized, positive alterity.
It is the 'night pool' with its subtly differentiated luminosities - a series of intensities which defy resolution within any dialectic of presence and absence -that flood onto the mirror with the sister; shattering every power of representation.
'5 Trakl ends the poem Am Moor ('At the Moor') with the line Erscheinung der Nacht:
Kriiten tauchen aIlS silbernen Wassern ('Appearance of the night: toads dive out of silver
waters) (Trakl, Das dichterische Werk, 54) suggesting that there is indeed an issue of
nocturnal luminacy in Trakl's poetry; a becoming visible in the night, which is also
an appearance of the night itself. The night is nor merely a formal condition or scene
for certain apparitions, it is also what is 'expressed' in the silver light of the moon
and stars. The night itself finds a voice in 'the lunar voice of the sister', that is also a
Silberstimme (,silver voice'), a word that is used in the poem Hohenburg (Ibid., 5'), and
twice in the poem Sebastian im Traum (Ibid., 53).
,6 Ibid., 35.
9 9
FAN G E D N O U M E NA
This apparent reduction or simplification of the problem
only displaces our difficulties however. The Traklean
night [Nacht] is, as we have seen, the time of derangement
[Umnachtung], consonant perhaps with the 'mania' that
stems, like moon (and 'mind'), from the Indo-European
road (*men(e)s). That the moon is associated with woman
is indicated by the etymological relations between 'moon',
'month', and 'menses', but it is also the companion of
lunatics and werewolves; figures with whom the reader
of Trakl is certainly familiar.
It is, fittingly, in the culminating lines of Traum und
Umnachtungthat this imagery crosses a climactic threshold:
Steinige Oede fand er am Abend, Geleite eines Toten
in das dunkle Haus des Vaters. Purpurne Wolke
umwolkte sein Haupt, daB er schweigend tiber sein
eigenes Blut und Bildnis herfiel, ein mondenes Ant·
litz; steinern ins Leere hinsank, da in zerbrochenen
Spiegel, ein sterbender J tingling, die Schwester
erschien; die Nacht das verfluchte Geschlecht
verschlang.
(He found a petrified desolation in the evening, the com·
pany of one deceased as he entered the dark house of the
father. Purple clouds enwreathed his head, so that he fell
upon his own blood and image, a lunar countenance; and
fainted petrified into emptiness when, in a shattered mirror
1 00
NARC I S S I S M A N D D I S P E R S I O N
a dead youngster appeared, the sister: night enveloped the
accursed genus.)17
With a passage of such beauty and labyrinthine depths
any response is likely at worst merely to irritate, and
at best to increase our perplexity. I will only try to ask
one simple question. Is there a connection to be made
between the shattering of the mirror and a movement of
astronomical imagery; between an explosion of desire
that exceeds all introversion or reflection on the one hand,
and a nocturnal or lunar process on the other? If such
a connection were to be made it would surely pass by
way of the sister, who is herself a threshold between the
reflective order of the father's house and the illimitative
difference of the night sky. It is the 'night pool' with its
subtly differentiated luminosities - a series of intensities
which defy resolution within any dialectic of presence
and absence - that flood onto the mirror with the sister;
shattering every power of representation. At the point of
a certain nocturnal delirium (or lunacy) the relation of
the sister to the family is metamorphosed. She no longer
obeys the law of the boundary by mediating the family
with itself, sublimating its narcissism, or establishing its
insertion into the order of signification by disappearing
(leaving the father's house according to the exchange
17
Ibid., 84.
1 0 1
FAN G E D N O U M E NA
patterns of patrilineal exogamy, and thus as a metabolic
or reproductive moment within a kinship structure).
Instead she breaches the family, by opening it onto an
alterity which has not been appropriated in advance to
any deep structure or encompassing system. A night that
was an indeterminable alterity such as this would be a
fully positive differentiation from the day.18
Perhaps the single most important Trakl text on this
Lunar Ruin and Familial Interiority
- The poem 'Geburt' uses lunar imagery to represent a 'haemorrhaging' of the family unit and its internal secrets.
- Trakl’s work explores a stifling, incestuous interiority where the sister attempts to escape being a mere reflection or 'copy' of the brother.
- The 'ruined moon' serves as a pivotal astronomical metaphor that historicizes the heavens rather than treating them as timeless archetypes.
- The decay of the moon can be interpreted as a collapse of traditional order, potentially leading back to the security of the 'inside' or the authority of social institutions.
- Alternatively, the moon's ruin may represent the removal of a restrictive barrier, allowing for a movement from claustrophobic domesticity into an unlimited, 'fanged' alterity.
- The sister’s emergence from the brother’s shadow signifies a break from self-mediated narcissism and the constraints of the family dynasty.
By stepping out of her brother's shadow the sister escapes the determinations of image, reflection, or copy that could be returned to the same; to a self-mediated narcissism playing with representations as its own (or proper) alterity.
theme, in addition to the culmination of Traum und
Umnachtung, is a poem called Geburt (,Birth')19 where lunar
imagery functions similarly as a haemorrhaging of familial
interiority. The poem pivots upon a line at the end of the
third stanza in which a sublimated incestuality works a
stifling movement of interiorization: Seufiend erblickt sein
Bild der geJallene Engel ('Sighing the fallen angel glimpsed
his image'). It might seem as if the birth of the sister is
to be absorbed in a retreat into the claustrophobic heart
of the Geschlecht. But although the fourth stanza begins
with an awakening in a musty room [dumpier Stube 1 the
18 The sister is also associated with the moon towards the end of the prose poem Oifen
barungund Untergang, first in the line hob sich aufmondenen Flugeln uber die grilnenden
Wipfel, bistallene Klippen das weifie Antlilt det' Schwester ('lifted by lunar wings above
the greening treetops, crystal cliffs of the sister's white countenance') that ends the
penultimate paragraph. 1he final paragraph begins Mit silbernen Sohlen stieg ich die
domigen Stufen hinab (,With silver soles I climbed down the thorny steps) and speaks
of ein mondenes Gebilde, das langJam aus meinem Schattefl (rat Ca lunar shape, that
slowly stepped from out of my shadow') (Ibid., 97). By stepping out of her brother's
shadow the sister escapes the determinations of image, reflection, Of copy that could
be returned to the same; to a self-mediated narcissism playing with representations
as its own (or proper) alterity.
'9 Ibid., 64·
1 0 2
NARC I S S I S M A N D D I S P E RS I O N
one who thus awakes is 'a pale one' [einBleiches]; 'lunar'.
The eyes of the mother (or the midwife) [steinernen Greisin]
are described as 'two moons', a reference taking us back
out into the night (whose 'black wing touches the boy's
temple'), and back to a crucial image from the second
stanza; that of the decayed moon:20
Stille der Mutter; unter schwarzen Tannen
Oeffnen sich die schlafenden Hande,
Wenn verfallen der kaIte Mond erscheint.
(Silence of the mother; under black pines / The sleep·
ing hands open out / When the cold and ruined moon
appears.)21
It would be possible to interpret this ruin of the moon
as a dialectical restoration of the inside, its order and its
securities, as if what had defied the inside was now falling
away into self-annihilation. It might thus be asserted: 'This
nocturnal path, departing from everything we have always
20 The ruined moon is also mentioned in Sebastian im Traum in the line Da injenemMiirz
der Mond verfiel. (,Then, in that march, the moon was ruined.') (Ruin, from the Latin
mere 'to fall', cannot be used intransitively to capture the precise usage of verJallen in
this case.) (Ibid" 53). The ruin of the moon is here taken as a datable event, emphasizing
its referential entanglement in the processes of genre. Trakl's deployment of astronomi
cal metaphor is not a retreat from history into timeless or archetypal symbolism, it is,
on the contrary, a historicizing of the heavens; the opening of a genealogy through
conjugation with astronomical forces. For Heidegger's most explicit comments on
Trak! and history, see Die Sprache im Gedicht in particular (Heidegger, Unterwegs ,ur
Sprache, 80).
Ql Trakl, Das dichterische Werk, 64.
1 0 3
FAN G E D N O U M E NA
believed in, it has all collapsed into chaos now. Wasn't it
obvious it was going to go terribly wrong? You should
have listened to your priestjparents/teachers/the police.'
Yet this is not the only reading open to us.
The ruin of the moon might seem to block the noctur
nal movement that passes from a claustrophobic interior
into endless space, and that conjugates the dynasty with
an unlimited alterity. But this would not be the case if
the moon itself was, at least partially, a restrictive element
across the path of departure, rather than being the sole
gateway into the heavens. The ruin of the moon would
The Disease of Stars
- Heidegger interprets the moon not as a negation of the sun, but as a cooling and fading of stellar luminescence.
- Modern astro-physics has largely obliterated the philosophical problem of informal, irreducible differences in favor of mathematical formalism.
- Deleuze suggests that these irreducible differences could form the basis for a new theoretical quantification that avoids ultimate identity.
- Hegel expresses a profound disdain for the stars, viewing their distribution as an irrational facticity that lacks the dignity of concrete individuals.
- The text identifies a 'neo-Ptolemaism' in Hegel, where the vast dispersion of the universe is subordinated to terrestrial life and dialectical history.
- The term 'Ausschlag' links the celestial outbreak of light to the repulsive nature of a skin rash or a swarm of flies.
This outbreak of light [Licht-Ausschlag] is no more worthy of wonder than that of a rash in man, or than a swarm of flies.
then be a protraction of the nocturnal trajectory; a dis
solution of the lunar that proceeds not as a negation
of the night, but as a falling away of what is still too
similar to the sun. This second possibility is supported
by the terms of Heidegger's reading. He is very precise,
in his interpretation of the delirious journey across the
nocturnal pool, about what he takes the meaning of the
moon to be: a constriction of stellar luminescence rather
than the ultimate elimination of sunlight; a fading and
cooling of stars:
The cool light stems from the shining of the lunar
woman (Selanna). Ringing her radiance, as ancient
Greek verse says, the stars fade and even cool. 22
22 Heidegger, Unterwegs zur Sprache, 48-9-
1 0 4
NARC I S S I S M AND D I S P E RS I O N
This interpretation might seem to lack all philosophical
rigour, and perhaps even to forsake any possible 'theo
retical' reference. In fact it contributes to a problematic
of enormous importance, although one that has been
fragmented and largely obliterated by the constitution of
astronomy and astro-physics as positive sciences in modern
times. This problem is that of real (and astronomically
evident) differences that are in principle irreducible to
mathematical formalism, and which are furthermore - as
Deleuze has demonstrated in the closing sections of Dif
ference et Repetition23 - a potential basis for a quite other
and more comprehensive approach to mathematization
(or theoretical quantification) without any recourse to
ultimate identity or equalities. The obscuration of such
differences within the constitution of astro-science has
been a deferral rather than a resolution of the problem
of radically informal differences, leaving this matter as an
explosive threat to the foundations of modern cosmology.
Perhaps the last confident, unitary, and explicit treatment
of the question is to be found in Hegel's 'Encyclopaedia',
in the Zusatz to the transition from Finite Mechanics to
Absolute Mechanics:
One can admire the stars because of their tranquil
ity: but they are not of equal dignity to the concrete
23 G. Deleuze, Dtlference et Repetition (Paris: Press Universitaire de Paris, 1968); tr. P.
Patton as Difference and Repetitian (NY: Columbia University Press, 1994), 262-304.
1 0 5
FAN G E D N O U M E NA
individual. The filling of space breaks out [ausschlagt]
into endless kinds of matter; but that [i.e. the casting
of thc stars] is only the first outbreak [Ausschlagen 1
that can delight the eye. This outbreak of light [Licht
Ausschlag] is no more worthy of wonder than that of
a rash in man, or than a swarm of flies.24
Philosophy is to turn its gaze away from the stars, learning
from Thales perhaps, who fell into a hole whilst absorbed
in astronomical contemplation. In a subtle but vigorous
neo-Ptolemaism, Hegel subordinates the stellar moment
to the concrete and ordered bodies ofthe solar system, and
these bodies are in turn subordinated to the development
of terrestrial life. This is due to the dialectical dignity
of particularized actuality in comparison with abstract
principle, so that astrophysical laws are sublated into their
successively more concrete expositions in geology, biology,
anthropology, and cultural history. Yet there is something
more primordially and uncontrollably disturbing in the
vast and senseless dispersion of the stars, something which
is even hideous, like a disease of the skin.
What offends Hegel about the stars is the irrational
facticity of their distribution; a scattering which obeys
no discernible law. He expresses his disdain for this
distribution, and his anxiety before it, in a word that is
24 G.W.F. Hegel, System der Philosophic Zweiter Tei!. Die Naturphi!osophie, from Sarntliche
Wake, Volume 9 (Stuttgart, Fr.: Frommanns Verlage, 1929), u8.
1 0 6
NARC I S S I S M A N D D I S P E RS I O N
also both a powerful description and an acknowledge
ment: Ausschlag, which can mean swing or deflection, but
Ausschlag and Stellar Irrationality
- The German term 'Ausschlag' serves as a pivot point between Hegel and Heidegger, signifying an outbreak, rash, or eruption of irrationality within reason.
- Hegel views the chaotic distribution of stars and biological life as a 'pathological luminescence' that offends the dignity of philosophical order.
- Trakl’s poetry, particularly the 'dust of the stars' and the 'demented signs' of bird flight, illustrates the emergence of sense from erratic dispersal.
- Heidegger radicalizes the concept of sentience (Geist) as being 'outside oneself,' suggesting that consciousness is not a stable subject but a movement of infection.
- The Hegelian system ultimately represses the senseless distribution of stellar matter to favor a geocentric, logicized notion of significance.
It is no longer even that sentience is infected by irrationality; it is rather that sentience has dissolved into the very movement of infection, becoming a virulent element of contagious matter.
in this context means 'outbreak' in the sense of a rash.
The verb ausschlagen is even more multi-faceted, and can
mean (among other possibilities) to knock or beat out,
to waive, to burgeon or blossom, or to sweat. But Hegel
is not speaking of the blossoming of the stars here, or at
least, he does not want to do so. We must be careful not
to lose track of the 'object' Hegel is isolating here: it is a
differentiation that is at once senseless and sensible, an
outbreak of irrationality in the redoubt of reason similar
to that which Kant acknowledges in the Schematismuslehre.
It is the differential principle of stars, flies, flocks of birds,
and dust; of astronomical, geological, ornithological,25 and
epidermal eruptions. Trakl names it with deft precision
Staub der Sterne ('the dust of the stars'). In his reading of
Trakl Heidegger also acknowledges this unity of aus and
Schlag as a disruption 'of' sentience, but only if the 'of' is
read according to the subversive syntax of Heideggerian
thought; as an 'of' that no longer presumes a prior and
25 The association of bird-flight and the emergence of signs is one of the richest threads
ofTrakl's poetry. I n In rinem verlassenen Zimmer ('In an Abandoned Room') occurs the
line Schwalbm iTTe Zeichen ziehn (' Swallows trace demented signs') (Trakl, Dasdichttri!che
Werk., 16); the final stanza of Traum des Bosm ('Dream of Evil') begins Des Voge!flugs
wiree Zeichen /esen / Aussiitrigen ('Lepers read the confused signs of bird· flight') (Ibid.,
19); the second stanza of An den Knaben Elis ('To the Youth Elis') ends with the words
dunk/e Deutung des Vogeiflugs ('the dark significance of bird·flight') (Ibid., '7, 49) and
Der Herbst des Einsamen contains the line Der Voge!flug tont von alten Sagen ('The flight
of birds resounds with ancient sagas') (Ibid., 62). Wherever there is erratic dispersal
and movement in undemarcated space Trakl anticipates the arising of sense, and a
question of reading.
1 0 7
FANGED NOUM ENA
undisrupted subject. For Heidegger sentience is not
exploded or threatened from without by the Ausschlag, it
is alway s already under the sway of the outbreak that will
be derivatively apprehended as its subversion:
Trakl sees 'sentience' [Geist] in terms of that weave
[Wesen] that is named in the primordial significa
tion of the word Geist; since gheis means: incensed,
dislocated, being outside oneself [aufgebracht, entsetzt,
aujer sich sein]. 26
Hegelian sentience could be described as entsetzt by
cosmological eruption, but the sense of this outrage
changes with Heidegger's radicalized approach, in which
Entsetztheit cannot be thought as a delimiting response
to the anarchic explosion of cosmic debris but only as
its inertial protraction. Heidegger thus provides us with
a hermeneutical key according to which every sentient
reaction to the Ausschlag can be read as a symptom or
repetition of the outbreak 'itself'. It is no longer even
that sentience is infected by irrationality ; it is rather that
sentience has dissolved into the very movement of infec
tion, becoming a virulent element of contagious matter.
Since the light of the stars is not a transcendental
ground of phenomenality, but rather a differential effect
26 Heidegger, Unterwegs z:ur Sprache, 60.
1 0 8
NARC I S S I S M A N D D I S P E R S I O N
stemming from the isolation or uneven distribution of
intensities, Hegel takes its claim to philosophical dignity
as an offence. He determines starlight as a pathological
luminescence, without order or intelligibility. The fading
of stars is, therefore, among other things, a name for a
necessary stage in Hegel's system. The senseless distribu
tion of stellar material is repressed in the interest of the
particularized (sub-)planetary body, which in turn furthers
geocentrism and the infinitizing of light. This movement
crushes difference under a logicized notion of significance.
Stratophysics and Stellar Dispersion
- The poet Georg Trakl links the concept of the 'sign' to stellar dispersion, viewing stars as traces of a primordial, explosive strewing that defies mathematical reduction.
- The etymological link between 'star' and 'strew' suggests a materialist 'stratophysics' where order is merely a regional variation in the rate of dissipation.
- Unlike metaphysics, which relies on absolute laws, stratophysics posits an abyssal relativism rooted in the impersonal stratification of physical forces.
- Strata function as dimensions of dispersion, where the stacking of organizational levels creates the energetic surplus necessary for 'real form' or redundancy.
- Graphic redundancy, such as the gap between possible and realized words, allows for the uneven distribution of energy and the generation of intensities within a semiotic system.
The stars are traces of a primordial strewing; an explosive dispersion, which in its formlessness, defies mathematization or the reduction to order.
In contrast, Trakl brings the thought of the sign together
with that of stellar dispersion, writing: 0, ihr Zeichen und
Sterne (,0, you signs and stars').27 And - partially echoing
Rimbaud's words - Un chant mysteneux tombe des astres
d'or ('a mysterious song falls from stars of gold') - he
mentions die Silberstimmen der Sterne ('the silver voice of
the stars')28 and Das letzte Gold verfallener Sterne ('The last
gold of ruined stars').29 The German word Stern derives
from the Indo-European root *ster- meaning to extend
or spread out. It is from this root that the English word
'strew' - as well as 'star' - descends. The stars are traces of
a primordial strewing; an explosive dispersion, which in
its formlessness, defies mathematization or the reduction
to order. It is the shockwave of this metaphorics which
27 Trakl, Das dichterische Werk, 63.
28 Ibid., 53.
29 Ibid., 50.
1 0 9
FAN G E D N O U M E NA
sweeps through Trakl's specifications of the sign, and it is
perhaps for this reason that Trakl writes of ruination [Ver
fallen] in this context. Any order which is to be extracted
from the strewing of difference will be dependent on this
'spreading out' (Latin sternere), it will not be metaphysi
cal - dependent upon a transcendental difference - but
'stratophysical'; a movement between planes, or grades,
of dispersion. Where metaphysics has always fixed dis
order in a dichotomous relation to an absolute principle
of coherent form or ultimate lawfulness, a stratophysics
would locate regional order within a differentiation in the
rate of dissipation. It thus constitutes an abyssal relativism,
although not one that is rooted in subjective perspectives,
but rather in the open-ended stratifications of impersonal
and unconscious physical forces. Astrophysics is marked
by its etymology as stratophysics - a materialist study of
planes of distributed intensities - and therefore can be
seen to abandon its most extreme potentialities when it
subordinates itself to mathematical physics.
The question of strata can insinuate itself into every
word of Trakl's text, because it is at the 'core' of any
rigorous graphematics. Each stratum is a dimension
of dispersion, flattened like a spiral galaxy. This flat
ness is just as crucial to the study of intensities as the
trajectories traced within it, since the stratification or
stacking of organizational levels is the basic form of
any possible energetic surplus, the irreducible or final
1 1 0
NARC I S S I S M A N D D I S P E RS I O N
principle of 'real form': redundancy. Each stratum has its
specific 'negentropy' or positive range of compositions,
'selecting' only a relatively narrow series of combinations
from the stock of elements generated by its substrate. A
stratum thus inherits an aggregate 'degree of difference'
or grammar, distinguishing it from a certain potential
ity of 'randomness' (unproblematic reducibility into its
substrate), and constituting a potential for teleological
illusion (unproblematic reduction of its substrate). This
stratification of intensive positivities, which is most clearly
indexed by the successive unities ofletter, word, sentence,
etc. that are precipitated out of a common 'graphic plasma'
or semiotic substance within alphabetical regimes, is the
only rigorous basis for an architectonics of the sign. Only
because of such a graphic redundancy - for example,
that stored in the difference between letter and word -
between the words an alphabet makes possible and those which
are realized - can energy be unevenly distributed within a
stratum, and intensities generated. 30 Trakl acknowledges
30 Claude Shannon's theory of information understands redundancy as the dimension of
a message that docs not function at the level of communication, but rather functions as
a resource for the discrimination of the incommunicative (,noise') from communication
Redundancy and Stratified Control
- The author critiques standard communication theory for treating redundancy as a transcendental condition rather than a constitutive process.
- By separating semiotic messages from material techniques, traditional models preserve a metaphysical distinction that the author seeks to collapse.
- Redundancy is identified as a political mechanism used to trap disruptive signals and categorize them as madness, perversion, or disobedience.
- The text argues that noise is not a passive interruption but a strategic 'jamming' that occurs within the conflictual space of control.
- Through the poetry of Georg Trakl, the author explores how stratification functions as a physiological process where matter and meaning become indistinguishable.
- Heidegger's analysis of 'flame' is introduced as a metaphor for an 'outside' that both illuminates and voraciously consumes everything into ash.
To fail to acknowledge such questions is to take the notion of noise as a purely passive and non-sentient interruption rather than as a strategically oriented 'jamming' of the message.
in general, thus providing a layer of insulation against the degradation of the message.
This formulation seems to me to lack two crucial elements: 1) It fails to provide any
suggestion as to how the message participates in the constitution of redundancies
(thus taking redundancy as a transcendental condition of communication). This first
default leads to the preservation of the metaphysical distinction between semiotic and
material processes (messages and technique s), which is otherwise profoundly shaken
by the thought of redundancy; the thought, that is, of an isolation or 'de-naturalization'
of the semiotic stratum proceeding by means of intensities or surpluses that invoke
no element of negativity, but only gradations. 2) It fails to acknowledge the political
dimension of redundancy as a means of trapping disruptive signals. It is this 'trapping'
within an intermediate zone between strata that first enables the categories of madness�
111
FANGED NOUMEN A
this excitatory axis, which punctures and intensifies each
plane of distribution, in the use of words related to the
German verb sinken (to sink). Thus he writes:
Von Liiften trunken sinken balde em die Lider
Und offnen leise sich zu fremden Sternenzeiche n.
(Drunken with breezes the lids soon subside / And open
themselves to strange star· signs. )31
And:
Zeichen und Sterne
Versinken leise im Abendweiher .
(Signs and stars / Sink quietly in the evening-pool.)32
The explosion of stellar and semiotic materials generates
a combination of intra-stratal and trans-stratal processes,
the former of which have been historically determined as
perversion, deformity, disobedience, and indiscipline to be constituted, thus providing
the basis for the associated but counterposed disciplinary programmes of pedagogy,
psychiatry, punition, etc. To fail to acknowledge such questions is to take the notion
of noise as a purely passive and non-sentient interruption rather than as a strategically
oriented 'jamming' of the message, and thus to ignore the conflictual aspects of both
grammars and anti-grammatical subterfuges as they contend within the fluctuating
space of rerlundancy or control. This default is typical of a technocratic sdentificity
which takes the question of power as having been always already resolved prior to
the question of technique.
3' Trakl, Das dichterische Werk, 18.
32 Ibid., 51.
112
NARCISSISM AND DISPERSION
'causal' or 'legislated' and the latter as 'intellectual', 'tele
ological', or 'legislative'. This is a ramification (speculative
I admit) ofTrakl's vocabulary of StuJen (,steps') of terraced
differentiation (a theme I hope to explore more thoroughly
elsewhere). Stratification is the complex physiological
process, the only one, in which the distinction between
matter and meaning cannot be sustained.33
The tools Heidegger relies upon in his approach to the
issues of exile into the night and astronomical dispersion
stem from the 'ecstative analyses' of his Marburg medita
tions. The term he focuses upon as a possible entry point
for such a discussion is 'flame'. He first gathers Trakl's
stellar thematic into that of flame with the suggestion: 'The
night flames as the lightening mirror of the starry sky'. 34 He
then proceeds: Das Flammende ist das Aujer-sich, das tichtet
und erglanzen liijt, das indessen auch weiterfressen und alles in
das Weije der Asche verzehren kann. ('That which flames is
the outside itself, that which lightens and lets gleam, and
that which in doing so can expand voraciously so that
The Curse of Discord
- The text explores the recurring motif of leprosy and physical decay in Georg Trakl's poetry as a symbol of spiritual or existential devastation.
- Heidegger interprets the 'accursed genus' through the etymological link between the Greek 'plage' (curse), the Latin 'plague', and the German 'Schlag' (cast or blow).
- The fundamental 'curse' is identified not as duality itself, but as the discordance that tears a genus apart into isolated, wild individuation.
- Heidegger distinguishes between a 'gentle illumination' and an 'uncontrolled devastation' (revolt) within the metaphorical flame of existence.
- The 'ruined genus' is described as being unable to find its 'right cast' once it has been decomposed into the blind wildness of the beast.
The curse of the decomposed gen-us consists in this, that this ancient gen-us is cast apart into the discord of gen-ders.
33 For instance, in Kleines Kon?ert ('Little Concert') Aussiitzigen winkt die Flut Gene.rung
('The torrent beckons lepers to convalescence') (Ibid., 25); in Drei Blicke in einen
Opal ('Three Glimpses in an Opal') Die Knaben triiumen wirr in dilrren Weidenslriihnen
/Und ihre Stirnen sind von Aussatz kahl und rauh ('Youths dream confusedly among the
pasture's dry bales / And their brows are naked and raw with leprosy') (Ibid., 39; see
also Ibid., 40); towards the end of He/ian (in a line I have already cited) Helians Seele
sich im rosigen Spiegel beschaut /Und Schnee undAuHat;: von seiner Stime sinken CHelian's
soul gazes on itself in the rosy mirror / And snow and leprosy sink from his brow')
(Ibid., 43); and in Verwandlund des Bosen ('Metamorphosis of Evil') there is a Minute
stummer <;crstiinmg; aujtauscht die Stime des Aussiitzigen unter dem kahlen Baum (,moment
of mute devastation; the brow of the leper hearkens under the naked tree') (Ibid., 56).
34 Heidegger, Unterwegs zur Sprache, 66.
1 1 3
FAN G E D N O U M E NA
everything is consumed to become white ash.' [The expres
sion Aufler-sich is such a clear index for Heidegger's notion
of ecstasis that Hertz employs 'ek-stasis' as its translation
in his rendering of this sentence]). 35 The flame of the stars
is explosive - or outside of itself - but this Ausschlag can
be a gentle illumination or an uncontrolled devastation
(an AuJruhr, 'revolt', 'turmoil').36 It is about this 'or', with
which I am attempting to indicate Heidegger's hope that
the WeiterJressung can be deflected or suspended in contin
gency, that the ambiguous path of his reading turns.
Ten pages earlier Heidegger poses this sense of an
al ternative between castings [Schliige] most acu tely, and in
so doing returns us to the question of infection. Examining
Trakl's expression das verfluchte Geschlecht ('the accursed
genus')37 he points to a Greek word that can be translated
equally as either Schlag or Fluch; 7ti\llYll (,curse'). 7ti\llYll
is also translated by the Latin plangere, from which we
derive the English 'plague', and the German Plage (found
in the sixth line of Trakl's poem Fohn38 and in the fifteenth
line of Allerseelen ['All Soul's Day'J).39 Heidegger's text
(which I cannot confidently hazard to my translation
alone) reads:
35 Ibid., 60.
36 Ibid., 60.
37 Trakl, Das dichterische Werk, 84·
38 Ibid., 67-
39 Ibid., QU.
1 1 4
NARC I S S I S M AN D D I S P E RS I O N
Womit ist dieses Geschlecht geschlagen, d.h. ver
flucht? Fluch heiBt griechisch ni\llY'l, unser Wort
' S chlag' . Der Fluch des verwesenden Geschlechtes
besteht darin, daB dieses alte Geschlecht in die Zwi
etracht der Geschlechter auseinandergeschlagen ist.
Aus ihr trachtet jedes der Geschlechter in den los·
gelassenen Aufruhr der je vereinzelten und blol1en
Wildheit des Wildes. Nicht die Zwiefache als solches,
sondern die Zwietracht ist der Fluch. Sie tragt aus
dem Aufruhr der blinden Wildheit das Geschlecht in
die Entzweiung und verschlagt es so in die losgelas
sene Vereinzelung. Also entzweit und zerschlagen
vermag das 'verfallene Geschlecht' von sich aus nicht
mehr in den rechten Schlag zu finden.
(With what is this gen-us cast, i.e. cursed? Cursed
names the Greek ni\llYll, our word 'casting' . The
curse of the decomposed gen-us consists in this, that
this ancient gen-us is cast apart into the discord of
gen-ders. Each of the genera strives for unleashed
revolt in an always individuated and naked wildness
of the beast. It is not the twofold that is the curse, but
rather the discordance of the two. Out of the revolt
of the blind wildness it carries the gen-us, cast away
into torn duality and unleashed individuation. Thus
1 1 5
FAN G E D N O U M E NA
divided and cast down the 'ruined gen-us' is no longer
able to find the 'right cast'. )40
It would be possible to read this passage as if it were a
development entirely internal to Heidegger's 'philosophy',
Heidegger, Trakl, and the Leprous Curse
- The text explores Heidegger's critique of onto-theology as a curse that drives beings toward absolute mastery of the earth while erasing their dependence on being.
- Metaphysical dualities, such as gender or genre (Geschlecht), are criticized not for being binary, but for monopolizing the interpretation of difference and obscuring the 'being' of those categories.
- The author contrasts Heidegger's abstract intellectual pursuit with the visceral, 'vespertine labyrinth' of Georg Trakl's poetry, specifically the recurring motif of leprosy (Aussatz).
- Trakl’s use of 'Aussatz' signifies a state of being 'cast out' (Aus-setzung), which aligns with Heidegger’s concept of ecstatic orientation yet is curiously avoided by the philosopher.
- The author suggests that Heidegger’s refusal to name the 'ecstatic eruption' as leprosy reflects a regressive piety or obstinacy in his 1953 essay on Trakl.
- The discussion highlights a tension between formal philosophical disjunctions and the 'primordial and contagious eruption of the pathological' found in poetic language.
The disease which finds a place in Heidegger's text is the same as that which obsesses Trakl; it is the searing of stars, or the primordial and contagious eruption of the pathological.
and as if the reading ofTrakl in which it is embedded were
a mere eccentricity or modulation in the vocabulary of
an unswerving intellectual pursuit. Such a reading would
recall that according to Heidegger, onto theology is the
curse that leads beings to strive towards absolute mastery
of the earth, erasing every trace of their dependence upon
being. That difference of each being with respect to being
is displaced by the differences among beings, and being is
converted into a mere disputed territory to be subdivided
among conflicting beings. It would also recall that within
this history everything thought of as 'real' has been dis
tributed among exclusive concepts, through which beings
represent themselves to themselves in their competitive
distinctiveness, so that the differences, discriminations,
and determinations of beings cease to speak of being. It
would conclude that what is metaphysical (in the sense
that Heidegger understands as the onto theological) in
dualities of genre is not that they are binary, but that this
binarity monopolizes the interpretation of the being's dif
ference from being. What is lost in ontical interpretation
40 Heidegger, Unterwegs wr Sprache, 50.
1 1 6
NARC I S S I S M A N D D I S P E RS I O N
is the being of genre itself, the composition of ontical
difference from out of the non-ontic. In other words, to
think Geschlecht abstractly, but in a certain sense beyond
ontotheology, it would be necessary only to insist (in a
decisive Heideggerian trope) that ontical differentiation
is not itself anything ontical.
Yet Heidegger is not simply interpreting a word that
circulates freely within the German language. He is
attempting to read this word as he encounters it within
the tortuous and vespertine labyrinth ofTrakl's poetry. We
must return to Heidegger's question, and attempt to ask it
along with him: what is this cast, this curse or epidemic?
We are assisted in this by Trakl's words, which lend us a
faltering answer to place alongside Heidegger's discus
sion; the cast that has cursed us, surely that is what Trakl
namesAussatz; leprosy, infection, and (thus) exclusion. The
spaces of difference across which the Zwietracht stretches
and displaces itself (following the semantic instabililty
of Geschlecht) are never to be found described by Trakl
in terms that could be reduced to formal disjunctions or
negative articulations. Instead he writes of Mauern vall
Aussatz (,walls full of leprosy')41 echoing Rimbaud who,
during his Saison en EnfeT finds himself assis, lepreux, SUT
les pots casses et les oTties, au pied d 'un mUT range par Ie soleil
(,sitting, leprous, upon broken pots and nettles, at the foot
41 Trakl, Das dichterische Werk, 41.
1 1 7
F A N G E D N O U M E NA
of a wall gnawed by the sun'). 42 I t seems at first surprising
that Heidegger makes no mention of the frequent refer
ences to leprosy throughout Trakl's poetry, since Aussatz
points to an Aus-setzung (the Old High German source
Uzsazeo means 'one who has been ausgesetzt or "cast out"
of society'), a coinage which profoundly accords with the
ecstative orientation of Heidegger's reading. Heidegger
even has a space specifically allocated to disease in his
reading. Not that he is particularly concerned with the
German equivalent of this word: Krankheit (although he
quotes Trakl's line Wie scheint doch alles Werdende so krank!
('How sick everything that is becoming seems! ') .43 The
disease which finds a place in Heidegger's text is the
same as that which obsesses Trakl; it is the searing of
stars, or the primordial and contagious eruption of the
pathological. But Heidegger's supplement to Trakl's
text is disappointingly regressive on this issue, and my
brief concluding question touches on an example of the
repugnant obstinacy and piety of the 1953 essay in asking:
why does Heidegger refuse to follow Trakl and name
ecstative eruption Aussatz?
In concluding the question of the curse that abuts
Heidegger's Gentle Critique
- Heidegger distinguishes between two types of duality: the destructive, conflictual 'Zwietracht' and the gentle, gathering 'Zwifalt'.
- The concept of 'Zwifalt' represents an attempt to find an 'immaculate' difference that escapes the historical curse of oppositional metaphysics.
- The author argues that Heidegger’s project is a 'grotesque recapitulation' of Kantian compromise, seeking to limit the insurrectionary energy found in Trakl’s poetry.
- Derrida differs from Heidegger by refusing to validate such pure distinctions, opting instead for a structural inadequacy that acknowledges continuity with the past.
- Heidegger’s philosophy is characterized as a 'sterile hope' of an aging thinker attempting to evade the inevitable dissipation of Western civilization.
- The text suggests Heidegger’s 'logic' of purification is a symptom of a decomposing theology and a fear of losing control to 'ecstatic difference'.
Heidegger—exhausted and uncomfortably feverish—lays down his copy of Trakl's poems, and closes his eyes.
onto Trakl's thema of Geschlecht, Heidegger distinguishes
between two cast( e)s and two dualities. There is a cursing
42 A. Rimbaud, Collected Poems, tr. O. Bernard (Harmondsworth: Penguin, 1980), 302-3.
43 Trakl, Das dichterische Werk, 29; Heidegger, Unterwegs zur Sprache, 64.
1 1 8
N A RC I S S I S M A N D D I S P E RS I O N
cast or stamp that is associated with a reckless and destruc
tive individualization and that generates antagonistic
or conflictual binarity [Zwietracht], and there is a gentle
sarifi binarity [Zwiifalt] that escapes the contagion of the
curse. As is so typical of Heidegger, Zwiifalt simultane
ously marks an aspiration towards the (Schellingian)
post-philosopher's stone of a-logical intervallic differ
ence and the theologian's dream of an immaculate or
uncontaminated conception. Drawing upon a thought
of pain [Schmerz] as a threshold and relation Heidegger
seeks to ameliorate the pathological scorching of the stars:
'gentleness is, following the word das Sanjte, the peaceful
gatherer. It metamorphoses discord, in that it turns what
is injuring and searing in wildness to soothed pain'. 44 This
attempt to establish pure and dichotomous distinctions
that both explicate and escape the history of oppositional
thought necessitates a discrimination between (two) types
of duality. (It is precisely because Derrida will refuse to
underwrite such a discrimination that he turns instead to
a re-inscription of continuities that are able to encompass
and partially assimilate the 'ruptural' aspect of his own
work, resigned to a 'structurally necessary inadequacy' in
the prosecution of deconstruction. Both Heidegger and
Derrida seem to concur, however, in taking the sense of
dichotomy to be irredeemably polar and reciprocally
44 Ibid., 45.
1 1 9
FAN G E D N O U M E NA
ultimate rather that stratal and unilaterally or impulsively
protractile. )
The historical predicament that Heidegger and (in a
different way) Derrida trace out here, and which finds
its symptom in this problematic 'antinomy' of escape
and re-capture, hope and despair, with all the unstable
compromises and evanescent moments of indecision or
indifference it generates, is too complex to delineate in
this paper. I will only venture to suggest that by holding
Zwietracht and Zwiifalt apart at this point, and refusing
to abandon the hope that formal or ultimate dichotomy
might be redeemed by a future thinking, Heidegger is
engaged in what we could legitimately describe as a
'gentle critique' of the history of metaphysics, a grotesque
recapitulation of Kant's compromise with onto theological
tradition (and tradition always belongs to the church).
Heidegger's attempt is to limit the Aujruhr which consti
tutes the intensive undertow of Traklean textuality. His
is the sterile hope of an aging philosopher with Platonic
instincts, the delusion that the climactic dissipation of
Western civilization can be evaded, and that the accumu
lation of fossilized labour-power can found an eternally
reformable social order. He was not completely unaware
of the profound struggle between the weary regimentation
of the patriarchal bourgeoisie, and a fluctuating pool of
insurrectionary energy tracing its genealogy to the ur
catastrophe of organic matter. But he felt nauseous at the
1 2 0
NARCISSISM AND DISPERSION
thought of losing control, and perhaps he still believed
in God. Zwiifalt would surely be a distantiation from this
noise and restless ferment, an end to contagion, a final
peace? It is according to this deeply rooted 'logic' of
purification and transcendence, the most insidious trope
of a decomposing theology, that the irruption of ecsta
tive difference refuses the name Aussatz, and Heidegger
- exhausted and uncomfortably feverish - lays down his
copy of Trakl's poems, and closes his ey es.
1 2 1
Delighted to Death
E.M. Cioran's essay, 'Thinking Against Oneself' , begins:
We owe the quasi-totality of our discoveries to our
The Fanaticism of Collapse
- Human action and creativity are inherently self-destructive, as every work eventually returns to crush its author.
- The 'violent man' seeks to devastate others only as a detour toward his own inevitable internal devastation.
- To assume an identity or a name is to choose a specific, exact mode of personal collapse.
- Western culture is characterized by a fanatical 'thirst for annihilating ecstasy' that stands in direct opposition to quietude.
- Kant’s critical philosophy represented a form of intellectual martyrdom, replacing the desire for a complete system with a rigorous, ascetic renunciation.
- The French Revolution is framed as the 'freedom of the void' manifesting as a destructive political and religious passion.
One always perishes by the self that one assumes: to bear a name is to claim an exact mode of collapse.
violences, to the exacerbation of our disequilibrium.
Even God, insofar as he intrigues us, is not to be
found in our most intimate depths, but rather at the
exterior limit of our fever, at the precise point where,
our rage coIliding with his, a shock results, an encoun
ter that is equally ruinous for him and for us. Stricken
with the malediction attached to acts, the violent man
does nor force his nature, does not go beyond himself,
except to furiously re-enter, as aggressor, followed by
his enterprises, which come to punish him for having
raised them. There is no work that does not return
against its author: the poem crushes the poet, the
system the philosopher, the event the man of action.
Some form of self-destruction, responding to his
1 2 3
FAN G E D N O U M E NA
vocation and accomplishing it, is at work in the core
of history; only he saves himself who sacrifices gift s
and talents in order that, disengaged from his quality
as a man, he is able to strut into being. If I aspire to
a metaphysical career there is no price at which I am
able to protect my identity, however minute are the
residues that remain, it is necessary that I liquidate
them; just as, on the contrary, if I adventure into a
role in history, the task that I take upon myself has to
exasperate my faculties to the point where I splinter
with them. One always perishes by the self that one
assumes: to bear a name is to claim an exact mode
of collapse.
Faithful to his appearance the violent one is not
discouraged, he begins again, obstinately, because he
is unable to dispense with suffering. Is he driven to
devastate others? That is the detour that he borrows
to rejoin his own devastation. Beneath his assured air,
beneath his fanfares, is hidden one who is besotted
with misfortune. It is thus amongst the violent ones
that are encountered the enemies of self. And we are
all violent ones, the enraged, who, having lost the
key to quietude, have access only to the secrets of
laceration.!
E. M. Cioran, 1M Temptation to Exist, tr. R. Howard (Chicago: University of Chicago
Press, 1998), 33'4 (translation adapted).
1 2 4
D E L I G H T E D TO D EATH
Cioran quotes Lao Tsu's maxim 'the intense life is contrary
to the Tao', and compares the tranquility of the mod
est life with the thirst for annihilating ecstasy that has
possessed the Western world. However, acknowledging
the compulsion of his Occidental heritage, he remarks
'1 can pay homage to Lao 7Su a thousand times, but 1 am more
likely to identify with an assassin'. Our culture, he argues,
is essentially fanatical.
Kant began something quite new in the history of
Western philosophy, by adapting thought to a rigorous
austerity. Unlike Descartes, for whom doubt was only a
detour to a more secure edifice of knowledge, Kant com
mitted his thought to renunciation. Following Luther,
he steeled himself against the seductions of 'the whore
of reason') pursuing an ascetic doctrine that he baptized
'critical philosophy'. His great temptation was to write a
'system of pure reason' - the constructive philosophy that
Hegel accomplished in his Logic - but he did not succumb,
and went to his grave with his speculative virginity intact.
His mature work was a perpetual flagellation of dialecti
cal desire. It was not with the scholastics, but with Kant,
that philosophy tasted the fierce delights of martyrdom.
In 1790, the year in which Kant's Critique qfJudgment
was published, the French revolution was in full surge. The
enlightenment had climaxed in an insurrection aligned
with a secular project of redemption. In his Philosophy if
Right, Hegel describes these events as follows:
1 2 5
FAN G E D N O U M E NA
This is the freedom of the void which rises to a passion
and takes shape in the world; while still remaining
theoretical, it takes shape in the Hindu fanaticism
of pure contemplation, but when it turns to actual
practice, it takes shape in religion and politics alike
Kant and Intolerable Pleasure
- The text explores the 'fanaticism of destruction' inherent in the social order and compares the violent impulses of the Marquis de Sade with the philosophical rigor of Immanuel Kant.
- It suggests that Kant's turn away from the French Revolution was not due to its violence, but because its utilitarian secularism failed to satisfy his deeper 'thirst for extinction.'
- Kant is characterized as a 'voluptuary of defeat' and the first philosopher of 'intolerable pleasure,' viewing life as a constant antagonism between satisfaction and pain.
- The author argues that for Kant, uninhibited pleasure leads to the immolation of the organism, meaning life is only preserved by the 'brake' of suffering.
- Kant's philosophy is linked to the bourgeois practice of accumulation, where satisfaction is deferred and capitalized upon rather than experienced immediately.
- The text posits that we survive only by 'smouldering,' as total delight would result in an immediate, annihilating death.
Because what would proceed from a continual promotion of living force, which does not let itself climb above a certain grade, other than a rapid death from delight?
as the fanaticism of destruction - the destruction of
the whole subsisting social order - as the elimination
of individuals who are objects of suspicion to any
social order, and the annihilation of any organization
which tries to rise anew from the ruins.2
Such is the insatiable fury that finds its voice, in this same
period, in the literary and political writing of the Marquis
de Sade. But comparing Sade with Kant, it is not obvious
that it is the Marquis - despite his obsession with orgy
and massacre - who is the more excited by violence. Hegel
pictures spirit migrating from Paris to Konigsberg, flee
ing from its annihilating frenzy towards a moderated, or
concrete, negation. He suggests that Kant recoiled from
the extreme negativity of deist republicanism. But, like
the ancien regime, the Jacobins also found it necessary to
imprison Sade and repress the mystical delirium of his
atheism. So it is equally possible to suggest that, insofar
as Kant turned away from the French revolution, it was
2
GW.F. Hegel, Grundlinien der PhilosophiedesRechts (Frankfurt am Main: Ullstein, 1972),
22; for a recent English translation, see also Elements if the Philosophy if Right, tr. H. B.
Nisbet (Cambridge/NY: Cambridge University Press, 1991), Introduction, § 5, 38.
1 2 6
D E L I G H T E D T O D E ATH
because its basically restrained and utilitarian secularism
failed to quench his thirst for extinction.
It is worth remembering that a glimpse into Kant's
philosophy was sufficient to drive Kleist to suicide, and
that Schopenhauer found in it the ethical imperative
that existence be denied. Perhaps neither of these writers
were ecclesiastical enough to enjoy the ghoulish cruelties
that Kant explored. For Kant was a consummate saint, a
cheerful man. He was not a stoic, but rather, faithful to
his Christian heritage, a voluptuary of defeat.
Amongst other things, Kant is the first philosopher
of intolerable pleasure. In his Anthropology, published in
1798, he writes:
Satisfaction i s the feeling o f the promotion; pain that
of the obstruction of life. But life (of animals) is, as
doctors have already noted, a continuous play of the
antagonism of the two.
Thus before every satisfaction there must first be pain;
pain is always first. Because what would proceed from
a continual promotion of living force, which does
not let itself climb above a certain grade, other than
a rapid death from delight? 3
3
I. Kant, Schrijien WT Anthropologie. Geschichtsphilosophie, Politlk und Pedagogik (Frankfurt
am Main: Suhrkamp, 1968), 231; for a recent English translation, seeAnthropololfYfrom a
Pragmatic PointoJView, tr. & cd. R. B. Louden (CambridgejNY: Cambridge University
Press, 2006), Part I, Book II, § 60, 126.
1 2 7
FAN G E D N O U M E NA
Uninhibited pleasure does not tend to the benefit of
the organism, but rather, to its immolation. Or, more
precisely, the enhancement of life is intrinsically bound
to its abolition. Life is not consumed by death at its point
of greatest depression, but at its peak, and inversely; it
is only the brake provided by suffering that preserves
the organism in its existence. It is pain that spares life
for something other than an immediate and annihilating
delight. So Kant suggests that pleasure is the combustion
of life, and we survive by smouldering.
It was Kant's genius to combine the saint with the
bourgeois. He was not immune to the prevalent ascetic
practice of our age: accumulation. If pleasure is to be
suspended, this is at least in part because it should be capi
talized. A few pages later in the Anthropology he implores:
Young man! Hold work dear; refuse yourself satisfac
tion, not in order to renounce it, but rather to hold
it as much as possible in prospect! Do not deaden
the receptivity for it by premature enjoyment! The
ripeness of age, which never lets the privation of any
physical enjoyment be regretted, shall, in this sacri
Martyrology and Capital Accumulation
- The text argues that the bourgeois ethic of accumulation requires a permanent disequilibrium between labor and enjoyment that cannot be justified by economics alone.
- Utilitarian arguments for austerity are dismissed as hypocritical because capital accumulation is designed to be interminable rather than a provisional sacrifice.
- The author suggests that only religious language can provide an absolute justification for the conclusive loss of terrestrial pleasure inherent in productivity.
- Bourgeois austerity is framed as a form of 'martyrology,' where the denial of consumption is sanctified through a supernatural lens.
- The passage provides graphic historical accounts of Christian martyrs to illustrate the extreme imagination of suffering and the 'reward' of total physical negation.
Only religion speaks the sort of language that could possibly affirm the conclusive loss of terrestrial pleasure, such as that which is represented by the subordination of consumption to the amassing of productive resources.
fice, secure you a capital of contentment independent
of the accidents of natural law. 4
4
Ibid., 237; '33·
1 2 8
D E L I G H T E D TO D E ATH
Delights foregone will be transmuted and redeemed.
This is more than a little mendacious since, even at the
end of the eighteenth century, it had become intrinsic to
capital accumulation that it was interminable. One does
not capitalize that which will ever be spent. It is only with
the reference to the super-natural, to a pleasure beyond
natural law - which is weakly described as a 'content
ment' [Zufriedenheit] - that this passage comes close to
sanctifying denial. For it is mere hypocrisy to employ
utilitarian arguments to justify the austerity demanded
by an ethic of accumulation, which requires an unceas
ing disequilibrium between work and enjoyment. Such
an argument could only be convincing if this austerity
were merely provisional, like a negation that will be in
turn negated. If capital is to be provided with an absolute
justification - and the need for this might not necessarily
be felt - it will not be found in economics, but religion, as
it always has been in the past. Only religion speaks the sort
oflanguage that could possibly affirm the conclusive loss
of terrestrial pleasure, such as that which is represented
by the subordination of consumption to the amassing of
productive resources.
The only coherent apologetic of bourgeois austerity
is called 'martyrology'. A rather mild example is the
account of the passion of Saint Vincent given in The
Roman Martyrology:
1 2 9
FAN G E D N O U M E NA
At Valencia in Spain, in the province of Tarragona,
[the death J of Saint Vincent, Deacon and Martyr,
who under the most wicked governor Dacian suffered
prison, starvation, the rack, the twisting of his limbs,
burning coals, the iron basket, fire and other kinds
of torture; and for the reward of his martyrdom he
departed to heaven.s
A harsher version, found in Delahaye's The Passions
of the Martyrs, tells us more about the imagination of
Christendom than its history. It describes how a certain
Saint George (not the English one) consummated his
martyrdom:
Saint George is hung, flayed to the point of exposing
his entrails, stretched and drawn by four machines,
flayed again, tormented by salt on his open wound,
nailed by his feet to a scaffold, torn by six hooks,
thrown in a tub and immersed by blows from a fork.
He undergoes torture at the wheel, which is fitted
with swords and knives, he is stretched on a bed of
bronze; molten lead is poured into his mouth, a stone
covered in lead is rolled over his head and limbs. He is
hung head downwards, a large stone about his neck,
above a thick suffocating smoke . . . He is sawn in two
5
The Roman Martyrology (London : Burns, Oates & Washbourne, 1923).
1 30
D E L I G H T E D TO D EATH
and thrown into a cauldron of molten lead and pitch.
He is whipped with leather thongs. A red-hot cask
is placed on his head. His sides are flayed, and he is
burnt with torches. The sword finally terminates his
martyrdom.6
I n The Book qfMartyrs, John Foxe makes some more general
remarks about martyrdom:
I t is marvellous to see and read the incredible numbers
of Christian innocents that were slain and tormented
some one way, some another, as Rabanas saith, 'Some
slain with the sword; some burnt with fire; some
scourged with whips; some stabbed with forks: some
fastened to the cross or gibbet; some drowned in the
sea; some their skins plukt off; some their tongues
cut off; some stoned to death; some killed with cold;
some starved with hunger; some their hands cut off,
or otherwise dismembered.' Whereof Augustine also
saith, 'They were bound - imprisoned - killed -
tortured - burned - butchered - cut in pieces,' etc.7
6
H. Delahaye, Les Passions des Martyrs et les genres littiraires (Bruxelles: Bollandistes,
1921), 286.
7
John Foxe, 1fte Book '!IMartyrs, ed. G.A.Williamson (London : Seeker and Warburg,
1965).
1 3 1
Martyrdom and Kantian Sublimity
- The text contrasts the physical tortures of early Christian martyrs with the internal, systematic discipline of modern secular philosophy.
- Theological discourse traditionally frames the suffering of saints as a redemptive 'seed' that leads to spiritual increase and conversion.
- Kant internalizes the role of the persecutor, moving martyrdom from historical accident to an autonomous, psychological process.
- The Kantian sublime is defined as a 'super-natural delight' occurring when the self intuits its own internal division.
- Reason is described as exercising a necessary 'violence' upon human sensibility to bridge the gulf between the natural and the moral realms.
- The imagination serves as the site of this 'holy passion,' where the subject finds a paradoxical delight in the excruciation of its own animality.
Human nature does not of its own proper motion accord with the good, but only by virtue of the violence that reason exercises upon sensibility.
FAN G E D N O U M E NA
Discussing the powerful enemies of the early Christians,
Foxe remarks:
Neither yet were these tyrants contented with death
only. The kinds of death were various and horri
ble. Whatever the cruelty of man's invention could
devise for the punishment of man's body, was prac
tised against the Christians. Crafty trains, outcries
of enemies, imprisonment, stripes and scourgings,
drawings, tearings, stonings, plates of iron laid unto
them burning hot, deep dungeons, racks, strangling
in prisons, the teeth of wild beasts, gridirons, gibbets
and gallows, tossing upon the horns of bulls . . . 8
But theological discourses in the Western tradition are
redemptive, and thus demand a happy ending. One
example is that given by Foxe in his commentary upon
the death of St. Lawrence:
Such is the wisdom and providence of God, that the
blood of his dear saints (like good seed) never falls
in vain to the ground, but it brings some increase: so
it pleased the Lord to work at the martyrdom of this
holy Lawrence, that by the constant confession of this
worthy and valiant deacon, a certain soldier of Rome,
8
Ibid.
1 3 2
D E L I G H T E D TO D EATH
being converted to the same faith, desired forthwith
to be baptized of him; for which he was called to the
judge, scourged, and afterwards beheaded.9
These examples have to be used carefully, because Kant
learnt from Protestantism and secularism the necessity for
internal discipline, so that, to a degree that was without
philosophical precedent, he became the source of his
own persecution. In the modem age, martyrdom has to
become more systematic, independent of psychological
and historical accident, or, to use Kant's word, autono
mous. Kant describes this new passional experience as
sublime, and the theory corresponding to it is to be found
in his Critique qfJudgment.
Kant's theory of the sublime is an extreme point in
the history of Occidental mysticism. It is concerned with
the super-natural delight experienced by the self when it
intuits the splitting of itself. The task Kant sets himself is
that of grasping the connection between the finite animal
part of the human being (sensibility), and its transcen
dental moral part (reason). He argues:
between the realm of the natural concept, as the
sensible, and the realm of the concept of freedom, as
the super-sensible, there is a great gulf fixed, so that
9
Ibid.
1 3 3
FAN G E D N O U M E NA
it is not possible to pass from the former to the latter
(by means of the theoretical employment of reason),
just as if they were so many separate worlds . . . 10
In his theory of the sublime he proposes a resolution
to this rift, which hinges upon the concept of violence
[Gewalt]. He insists: 'human nature does not of its own
proper motion accord with the good, but only by virtue
of the violence that reason exercises upon sensibility.'ll He
uses the word 'imagination' to refer to the pre-conscious
process that grasps the raw material of sensation and
moulds it into a coherent whole. The imagination is
the faculty of appropriation, which assimilates passively
received material to basic concepts, constituting objects
of experience. In the first Critique Kant calls this function
'schematism'. It is the primary vitality of the organism,
thc basic animal vigour in which the subject is rooted,
and upon which the possibility of knowledge rests. If the
subject is to find delight in the excruciation of its animal
ity, it is the imagination that must bear the fury of holy
passion, and this is indeed what Kant argues:
10 I. Kant, Kritik der Urtcilskraji, in Werksgaube, ed. W. Wieschedel, vol. 10 (Frankfurt am
Main: Suhrkamp, 1968), 14; for a recent English translation, see J. Kant, Critique iflhe
PowerifJudgmcnt, ed. P. Guyer, tr. P. Guyer, E. Matthews (Cambridge/NY: Cambridge
University Press, 2000), Introduction, II, 63.
II
Ibid., 124; 154.
1 34
DELIGHTED TO DEATH
The Paradox of Sublime Violence
- The sublime is defined by its capacity to frustrate the imagination and violate the faculty of presentation.
- Sublime pleasure arises from a 'pathological disaster' where the mind's failure to intuit the infinite propels it into rapture.
- Kant uses the sublime as a bridge to resolve the extreme metaphysical tension between empirical sensibility and transcendental reason.
- The experience functions as an 'anti-pathological eroticism' where the body seeks its own negation to satisfy a religious thirst for violence.
- Kant's idealism obscures the materialist reality of the sublime by presupposing disinterestedness, masking what is essentially a process of annihilation.
- The 'martyrdom of the imagination' is framed as a rational necessity rather than a psychological or physical trauma.
Sublime pleasure is an experience of the impossibility of experience, an intuition of that part of the self that exceeds intuition by means of an immolating failure of intuition.
that which, without our indulging in any refinements
of thought, but simply in being apprehended, excites
the feeling of the sublime, may appear to be frustrat·
ing for our powers of judgment, inappropriate to
our faculty of presentation, and a violation of the
imagination, but yet be judged even more sublime
on that account.12
The sublimity evoked by an experience is in direct propor·
tion to the devastation it wreaks upon the imagination .
Because the pain resulting from the defeat of the imagina
tion, or the animal part of the mind, is the tension that
propels the mind as a whole into the rapture of sublime
experience. Sublime pleasure is an experience of the
impossibility of experience, an intuition of that part of
the self that exceeds intuition by means of an immolating
failure of intuition. The sublime is only touched upon as
pathological disaster.
The paradoxical character of Kantian sublime experi
ence is undoubtedly in part conditioned by the extreme
severity of the metaphysical problem which it is designed
to solve. When sensibility and reason, the empirical and
the transcendental, are distinguished with the rigour that
Kant insists upon - as if they were two separate worlds
- it is scarcely surprising that the bridge between them
12 Ibid., 90; 129.
1 3 5
FANG E D N O U M E NA
will exhibit inordinate stresses. Beyond such modern
philosophical issues - indeed generating them - there are
more deeply rooted historical effects at stake, and foremost
amongst these is the Platonic-Christian affirmation of a
super-terrestrial desire. Sublime experience is to be an
anti-pathological eroticism, in which the body lusts after
the agonized convulsions that stem from its own negation.
The tension of sublimity is not merely the symptom of
theoretical contradictions, but also, and more basically,
the key to the mystical persuasiveness of the sublime.
For it is only because of this paradoxical character - or
tension - that the sublime promises to slake the raging
thirst for violence that drives religious enthusiasm, and
in so doing, to offer the delights of catastrophic rupture.
It is crucial to the way that sublimity functions in
Kant's work that it is subsumed under the more general
concept of aesthetic judgment. As the synthetic a priori
judgment of the relation of imagination to the practically
constitutive and theoretically regulative ideas of pure
reason, it falls within the more comprehensive domain of
aesthetic judgment, which is the transcendental exposi
tion of the relation between imagination and concepts
in general, which thus also includes the theoretically
constitutive pure concepts of the understanding, as well as
its empirical concepts. This subsumption characterizes the
idealist tendency of Kant's theory, since disinterestedness
is established as a presupposition of aesthetic judgment,
1 36
DELI GHTED TO DEATH
and the question of its generation is evaded. It is not even
that transcendental reason is merely presupposed by Kant,
for it is thought as nothing other that pure presupposition.
But the purity or absolute abstraction that underpins such
a concept of reason is the absence of all intuitive content,
so that the word purity - for example - also operates
simultaneously in another (psycho religious ) register;
employed in fact as a scantly veiled name for annihilation.
Cutting against the idealism that obscures this effective
or pathological functioning would involve a genealogical
investigation into the emergence of disinterestedness, and
it is this that drives a materialist reading of Kant towards
the issue of his mysticism.
By reserving his discussion of sublime violence until
he has established the presupposition of disinterested
ness, Kant justifies the excruciation of animality from
without. The martyrdom of the imagination is described
as rational rather than rationalizing, as irrelevant to the
The Violence of Sublimity
- The sublime is presented as a generative force of reason that requires the repression and sacrifice of the imagination.
- Kant’s mathematical sublime involves the collapse of imagination when faced with magnitude, highlighting human insignificance.
- The dynamic sublime stems from the intuition of overwhelming power, emphasizing the vulnerability and humiliation of the human animal.
- Sublimity acts as a wedge driven between human sensibility and pure intelligence, elevating the transcendental subject through the crushing of the body.
- The mathematical sublime achieves its effect by compressing temporal synthesis into a devastating intensity that ruins ordered experience.
The object provoking the sublime is simultaneously crushing for the sensibility and contemptible in respect to reason, and it thus serves to demonstrate the immeasurable humiliation of animal existence before the transcendental subject.
constitution of reason. A materialist deciphering of this
revision requires that repression - to use an inappropri
ately mild word - precedes its justification. If one is to
gain some purchase upon the gloomy cathedral of our
history, along with a little fresh air, it is important to begin
with the sublime rather than aesthetic contemplation in
general, and to read the sublime as generative rather than
revelatory in its relation to reason.
1 3 7
FANGED NOUM E NA
Kant outlines two types of sublimity, one mathematical,
and the other dynamic. Each of these types is associ"
ated with a specific violence against the imagination,
which is marked out for sacrifice due to its status as the
transcendental - and thus philosophically accessible -
representative of the body. The mathematical sublime
is the pleasure taken by reason in the collapse of the
imagination induced by the intuition of magnitude,
and the dynamic sublime is the equivalent pleasure cor"
responding to the intuition of power. In other words,
the mathematical sublime is associated with the insig"
nificance of the human animal, and the dynamic sublime
with its vulnerability. The theological resonance of these
terms is not at all accidental.
Sublimity has three elements; on the one hand the two
elements of the subject: its sensibility or animality and its
reason or pure intelligence, and on the other an object
that overwhelms the imagination, and which is driven
between the two parts of the subject like a wedge. The
object provoking the sublime is simultaneously crushing
for the sensibility and contemptible in respect to rea"
son, and it thus serves to demonstrate the immeasurable
humiliation of animal existence before the transcendental
subject. The opportunity for the dynamic sublime lies in
overweening force. It is the lucid intuition of catastrophic
power, and is so nakedly rooted in brutal intimidation
that Kant associates it with military butchery.
1 3 8
D E LIGHTED TO DEATH
The more subtle case is that of the mathematical sublime.
Given time it is necessary that the imagination succeeds
in unifying the flood of sensations into a coherent whole.
In other words, temporal synthesis dilutes the impact of
sense, and since time is an ideal form of intuition its suf
ficiency for this process is transcendentally guaranteed.
The mathematical sublime is the pleasure resulting from
the obliteration of such ordered experience. It results
when the laborious construction of organized perception
is ruinously undermined by means of the sudden collapse
of time, with the corresponding compression of sensation
into a devastating intensity. The diabolic genius of Kant's
account is worth well worth reciting:
Measurement of a space (as apprehension) is at the
same time a description of it, and so an objective
movement in the imagination and a progression. On
the other hand, the comprehension of the manifold
in the unity, not of thought, but of intuition, and
consequently the comprehension of the successively
apprehended parts in one glance, is a retrogression
that removes the time-condition in the progression of
the imagination, and renders coexistence intuitable.
Therefore, since the time-series is a condition of the
internal sense and of intuition, it is a subjective move·
ment of the imagination by which it does violence
to the internal sense - a violence which must be
1 3 9
FANG ED NOUM ENA
proportionately more striking the greater the quantum
which the imagination comprehends in one intuition.
The effort, therefore, to receive in a single intuition a
measure for magnitudes which it takes an appreciable
time to apprehend, is a mode of representation which
is defeating when subjectively considered, but, objec
tively, is requisite for the estimation of magnitude,
and is consequently expedient. Here the very same
violence that is wrought on the subject through the
The Gothic Violence of Reason
- Kant's philosophy of the sublime is framed as a violent conquest where reason 'unleashes' itself upon human sensibility to extend its domain.
- The text argues that Kantian morality requires the 'annihilation of animality' and the 'crucifixion of natural intelligence' to establish the rule of law.
- Reason is not an inherent peace but a construction built upon the demolition of the imagination and animal cunning.
- The Kantian moral good is defined as the total monopoly of power by the supersensible, rendering the physical body and its desires powerless.
- Kant's anti-utilitarianism is presented as a form of integrity that refuses to hide the fact that morality is inherently painful and sacrificial.
Philosophers feast in the palaces of reason, and luxuriate in the screams that reach them from the dungeons of sublimity.
imagination is estimated as expedient for the total
purpose of feeling.I3
It would be difficult to delineate the violent desire to
consummate the purity of reason in the annihilation
of animality more starkly. This does not prevent Kant
from elaborating upon these horrors for page after page,
describing sublimity as:
something terrifying for sensibility . . . which, for all
that, has an attraction for us, arising from the fact of
its being a violence which reason unleashes upon the
sensibility with a view to extending its own domain
(the practical) and letting sensibility look out beyond
itself into the infinite, which is an abyss for it.l4
'3
Ibid., 107-8; '42.
14 Ibid., "5; 148.
1 40
D E L I G HTE D TO D E ATH
He later adds that:
law ordained function ... is the genuine characteris
tic of human morality, wherein reason must violate
sensibility. IS
Such is the world of Gothic violence in which the enlight
enment reached its crescendo; philosophers feast in the
palaces of reason, and luxuriate in the screams that reach
them from the dungeons of sublimity. Kant would have
us believe that this sacrificial consumption of animality
merely exposes the transcendentally established truth of
reason in respect of the body, or rather, in frenzied con
tempt for it. Sublimity would be a final, almost gratuitous,
negation_ It would be the confirmation, rather than the
generation, of the absolute supremacy enjoyed by the
part of us that we share with the angels over the part that
we share with the beasts. Nevertheless, he has actually
taught us something quite different, if our stomachs are
strong enough for it.
Reason is something that must be built, and the site of
its construction first requires a demolition. The object of
this demolition is the synthetic capability that Kant refers
to as the imagination, and which he exhibits as natural
intelligence or animal cunning. This is the capability to
15
Ibid., 120; 151.
1 4 1
FAN G E D N O U M E NA
act without the prior authorization of a juridical power,
and it is only through the crucifixion of natural intel
ligence that the human animal comes to prostrate itself
before universal law. Kant is quite explicit about this
in the second Critique; only that is moral which totally
negates all pathological influence, for morality must
never negotiate with empirical stimulation. The Kantian
moral good is the total monopoly of power in the hands
of reason, and reason finds its principal definition as the
supersensible element of the subject, and thus as funda
mentally negative. In other words, morality is precisely
the powerlessness of animality. This is not the discourse
of civil jurisdiction, because it presupposes the prior
silencing of the defendant. It is more like the discourse
of military strategy in the grand style, which insists upon
utterly vanquishing the enemy before dictating terms, and
for which the very idea of negotiation already smelt of
humiliation and defeat. In Kant's own words (from the
Groundwork to the Metaphysics if Morals):
Thus it is that man lays claim to a will which does
not let anything come into account if it belongs
merely to his desires and inclinations, but, contrary
to these, thinks of acts being possible for him, indeed
1 4 2
D E LI G H T E D TO DEATH
necessary, which could only occur after all desires and
sensory stimulation have been ignored.16
Those with a taste for the macabre can find this theme
obsessively reiterated within Kant's practical philosophy.
It is hard to imagine that it could be controversial to
suggest that the categorical imperative presupposes a
vivisection.
Kant's anti-utilitarianism is a mark of his integrity as
a moralist in the Western tradition. He does not mask
the perennially severe character of moral submission in
order to pander to the loutish hedonism of the English.
He knows that morality is only good if it hurts. This
The Trauma of the Sublime
- Kant defines the sublime as a 'negative pleasure' where reason finds enjoyment in the suppression of the body's primary desires.
- The introduction of aesthetics into Kantian philosophy is described as a traumatic irruption that signals a catastrophic shift in Western thought.
- Kant’s critical project is framed as a response to the collapse of logical metaphysics, replacing stagnant theism with a 'metaphysics of excess.'
- The shift toward synthetic a priori judgments represents a revolutionary moment where philosophy abandons deductive certainty for the hazards of thought.
- Kant attempted to stabilize this intellectual revolution by seeking a definitive 'defensive line' that would bring the volatility of history to a meticulous end.
For reason has programmatically deafened itself to the howls of the body, and it is only by means of the aesthetic detour of the sublime that the devastating effects of its sovereignty can come to be enjoyed.
is why he refers to the delights of the sublime - where
morality comes closest to touching itself - as a 'negative
pleasure' [negative Lust], which is not at all the same as
displeasure [Unlust]. Negative Lust is a pleasure taken in
the negation of a primary pleasure, which is to say, in the
unpleasure of the imagination. For reason has program
matically deafened itself to the howls of the body, and it
is only by means of the aesthetic detour of the sublime
that the devastating effects of its sovereignty can come
to be enjoyed.
16
I . Kant, Kritik der Praktischen Vemunji / Grundlegung zur Metaphysik der Sit/en, ed.
Wilhelm Wieschedel, vol. 8 (Frankfurt am Main: Suhrkamp, 1968; for a recent English
translation, see I. Kant, GroundworkJor the Metaphysics oj Morals, tr., ed. A. W. Wood
(New Haven/London: Yale University Press, 2002), Third Section, 73.
143
FAN G E D N O U M E NA
Squeamishness does not befit a moralist. A certain harsh·
ness is necessary if one would prevent life from being
delighted to death. Such harshness, indeed, that the
pathological lunge towards death rediscovers itself in the
process of its own rigorous extirpation; sublimated into
the thanatropic frenzy of reason.
1 44
Art as I nsurrection: the Question of
Aesthetics in Kant, Schopenhauer, and
Nietzsche
Artists; those savage beasts that can't get enough qftoo much.
LAND
I
Immanuel Kant's Critique if Judgment is the site where
art irrupts into European philosophy with the force of
trauma. The ferocious impetus of this irruption was only
possible in an epoch attempting to rationalize itself as
permanent metamorphosis, as growth. Which means
that it is a trauma quite incommensurable with the sort
of difficulties art has posed to western philosophy since
Plato, for it is no longer a matter of irritation, but of
catastrophe. Our own.
The consistency of Kant's critical philosophy throughout
all three of the great Critiques rests in the attention to excess
inherent in the conception of synthetic a priori judgments.
1 4 5
FAN G E D N O U M E NA
The very inception of the critical project lay in Kant's
decisive response to the voiding of logical metaphysics -
the disintegration of the philosophical endeavour to
reduce synthesis - that was consummated by Burne.
Perhaps nothing was clearer to Kant than the radical
untenability of the Leibnizian paradigm of metaphysics,
still dominant in the (Wolfian) philosophy of the Prussian
state. Logicism had been exposed, by the sceptical and
empirical thought of a more advanced social system, as
a sterile tautological stammering that belonged to the
Middle Ages when positivity had been given in advance.
It was with extraordinary resolve that Kant jettisoned
the deductive systematization that had characterized
the philosophies of immobilist societies - philosophies
deeply and deliberately rooted in stagnant theism - and
replaced it with the metaphysics of excess. Be was even
prepared to assist in the razing of all theoretical theology;
because philosophy, too, had to become (at least a little)
revolutionary. Nothing substantial was any longer to be
presupposed.
Although the hazards of synthesis - of having to think
-were clearly no longer eliminable, Kant still dung to the
prospect that they could be traversed and definitively con
cluded. Philosophy would have to take some g;round, but it
could still anticipate a place of rest; an impregnable defen
sive line. If history could no longer be avoided, at least
it could be brought swiftly and meticulously to its end.
1 4 6
ART AS I NSURRECTION
lime would have to be transcendentally determined, once
and for all, by a new metaphysics. It would thenceforth
just continue, without disruption, in an innocent confirma
tion of itself. For a while - a period some time between
the early 1770S and 1790 - it is possible that Kant was as
cheerful as any bourgeois philosopher has ever been. An
Kant's Final Campaign
- Kant realized that his previous Critiques failed to fully outlaw chaos, as the understanding's legislation did not guarantee the coherence of empirical laws.
- The Critique of Judgment was born from the 'horror' of a master legislator discovering that nature remained an undomesticated, 'freely flowing wound'.
- Kant turned to the concept of 'beauty' as a fragile, impermanent discipline to bridge the gap between transcendental form and chaotic nature.
- The principle of 'purposiveness without purpose' suggests a subjectively necessary presupposition that nature must conform to a system for experience to be possible.
- Kant’s late philosophy is characterized by a desperate, cynical radicalism that attempts to legislate the 'lawfulness of the accidental'.
There are few horrors comparable to that of the master legislator who realizes that anarchy is still permitted.
ephemeral restabilization had been achieved. Then came
disaster. Something was still shockingly out of control.
A third Critique was necessary.
The terrifying insight that drove Kant into the laby
rinthine labours of the Critique ofludg;ment was that utter
chaos had still not been outlawed by an understanding
whose pretension was to 'legislate for nature'. Kant's own
words are these:
although this [the pure understanding] makes up
a system according to transcendental laws, which
contain the condition of possibility for experience as
such, it would still be possible that there be an infinite
multiplicity of empirical laws and such a great hetero·
geneity of natural forms belonging to the particular
experience that the concept of a system according
to these (empirical) laws must be totally alien to the
understanding, and neither the possibility, even less
the necessity of such a totality could be conceived.!
1. Kant, Kritik der Urteilskraji, ed. W. Weischedel (Wiesbaden: Suhrkampf, '974), 16.
\Vherc both original texts and translation are given I have sometimes translated directly
1 4 7
FANG E D N O U M E NA
There are few horrors comparable to that of the master
legislator who realizes that anarchy is still permitted. Far
from having been domesticated by the transcendental
forms of understanding, nature was still a freely flowing
wound that needed to be staunched. This was going to be
far more messy and frightening than anything yet under
taken, but Kant gritted his yellowing teeth, and began.
He found the resource for his new and final campaign in
the precarious negative disorder which he called 'beauty'.
When compared to the rigorous order of transcendental
form, beauty was an altogether fragile and impermanent
discipline. It was something the transcendental subject
could not promise itself. Nevertheless, it seemed that
something beyond reason, something that was prepared
to get its hands dirty, was keeping nature down. 'Purpo
siveness without purpose', Kant's last name for excess,
has all the extravagance of triumph. Even without trying,
we win. History is written by the victors and ascendancy
is presupposed as the condition of presentation, so that
the submission of nature to exorbitant law is given with
the objectivity of experience:
It is thus a subjectively necessary transcendental pre
supposition that unlimited dissimilarity of empirical
from the original, and sometimes cited the English version without modification. For
a recent English translation, see I. Kant, Critique qfthe Power of Judgment, cd. P. Guyer,
tr. P. Guyer, E. Matthews (Cambridge/NY: Cambridge University Press, 2000), First
Introduction, II, g.
1 48
ART AS I N SURRECTION
laws and heterogeneity of natural forms does not
arise, but that it rather, through the affinity of the
particular laws under more general ones, qualifies
as an experience, as an empirical system.2
All those martialled formulas: nature takes the shortest
way - she does nothing in vain - there is no leap in the
multiplicity of forms (continuumjormarum) - she is rich
in species, but yet thrifty in genuses, and so forth, are
nothing other than just this transcendental expression
of judgment, setting itself a principle for experience as a
system and thus for its own needs.3
Experience is thought of in terms of an extravagant
but explosive inheritance; an ungrounded adaptation
of nature to the faculties of representation. The increas
ingly tortured and paradoxical formulations that Kant
selects indicate the precarious character of the luxuriance
(stocked and expended in the imagination as 'free-play') .
Consider just one example: 'Purposiveness is a lawfulness
of the accidental as such.'4
Like M arx's Ricardo, it is the extraordinary cynicism
of Kantianism at the edge of its desperation that lends it a
profound radicality. Kant's 'reason' is a reactive concept,
negatively defined against the pathology with which
Fanged Noumena and Kantian Genius
- Kant’s third Critique reveals a brutal conflict where reason unleashes 'insensate violence' against the animalistic faculty of imagination.
- The experience of the sublime is characterized as a 'negative-pleasure' that humiliates the sensory self to extend the domain of reason.
- The concept of 'genius' represents an impersonal, irresponsible creativity that resists reduction to human design or theological teleology.
- Art inflicts a massive disruption on transcendental philosophy, introducing an 'irrational surplus' that Kant struggles to marginalize.
- The energetic unconscious emerges not from subjectivity, but from the intertwining of pathological inclination and repressed nature.
His theory of the sublime, for instance, is sheer exultation in an insensate violence [Gewalt] against the pre-conceptual (animal) powers summarized under the faculty of the 'imagination'.
� Ibid., 22; Kant, Critique oJthe Power qfJudgment, First Introduction, IV, 14.
3 Ibid., 23; 14·
4 Ibid., 30; 20.
149
FANGED NOUMENA
it has been locked in perpetual and brutal war. In the
third Critique all inhibition is lifted from this conflict;
it becomes gritty, remorseless, cruel. His theory of the
sublime, for instance, is sheer exultation in an insensate
violence [Gewalt] against the pre-conceptual (animal)
powers summarized under the faculty of the 'imagination' .
In the experience of the sublime nature is affirmed as the
trigger for a 'negative-pleasure', in so far as it humiliates
and ruins that part of ourselves that we fail to share with
the angels. To take one instance (out of innumerable
possibilities) he says of the sublime that it is:
something terrifying for sensibility ... which for all
that, has an attraction for us, arising from the fact
of its being a violence which reason unleashes upon
sensibility with a view to extending its own domain
(the practical) and letting sensibility look out beyond
itself into the infinite, which is an abyss for it.5
Kant is becoming remarkably indiscriminate about his
allies, asking only that they be enemies of pathological
inclination [Neigung], and know how to fight. If reason
is so secure, legitimate, supersensibly guaranteed, why
all the guns?
5 Ibid., ,89-90; tr. J. C. Meredith in '!he Critique ofJudr;ment (Oxford: Oxford University
Press. '982), "5.
150
ART AS INSURRECTION
Irrational surplus, or the inelimin able and beautiful danger
of unconscious creative energy: nature with fangs. How do
we hold on to this thought? It is perpetually threaten ed
by collapse; by a reversion to a depressive philosophy
of work, whether theological or humanistic. The three
great strands of post-Kantian exploration -marked by
the names Hegel, Schelling, and Schopenhauer -are
constantly tempted by the prospect of a reduction to
forgotten or implicit labour; to the agency of God, spirit,
or man, to anything that would return this ruthless artistic
force of the generative unconscious to design, intention,
project, teleolog y. Kant's word 'genius' is the immensely
difficult and confused but emphatic resistance to such
reductions; the thought of an utterly impersonal creativity
that is historically registered as the radical discontinuity
of the example, of irresponsible legislation, as 'order'
without anyone giving the orders .
Kant is quite explicit that a generative theory of
art requires a philosophy of genius - a re-admission of
accursed pathology into its very heart -and one only has
to read the second Critique alongside the third to notice the
immense disruption that art inflicts upon transcendental
philosophy. Kant only manages to control this disruption
by maintaining art as an implicitly marginal problematic
within a field mastered by philosophy. Even though he
acknowledge s that the autonomy of reason is to the
heteronomy of genius what fidelity of representation is
151
FANG ED NOUMENA
when compared to creation -poverty and wretchedness
-the message scarcely seeps out. In addition, there is a
perpetual and pathetic effort to subsume aesthetics under
practical imperative s, 'beauty as the symbol of ethicallife'6
being one example, and the basic tendency of his theory
of the sublime (the infinite privilege of transcendental
ideas in comparison to nature) being another.
Despite superficial appearances it is not with the
thought of noumenal subjectivity that the unconscious is
announced within western philosophy, for this thought is
still recuperable as a prereflexive consciousness, so innocu
ous that even Sartre is happy to accept it. It is rather out
of an intertwining of two quite different strands of the
Kantian text that the perturbing figure of the energetic
unconscious emerges: first, the heteronomous pathologi
cal inclination whose repression is presupposed in the
Genius and Unconscious Will
- The concept of genius is reframed not as a rational character trait, but as a violent, external force akin to a disease or seismic upheaval.
- Schopenhauer critiques Kantian philosophy by replacing the twelve categories of understanding with a simplified principle of sufficient reason.
- Reason is demoted from an autonomous governing principle to a mere 'film' on the surface of nature, derivative of deeper processes.
- The text highlights a shift from Kant's rational, intentional will to Schopenhauer's discovery of a 'non-agentic' and pre-intellectual will.
- Unconscious desire is presented as the primary force, with conscious thought and rational decision-making being merely consequential effects.
One 'is' a genius only in the sense that one 'is' a syphilitic, in the sense that 'one' is violently problematized by a ferocious exteriority.
exercise of practical reason, and second, genius, or nature
in its 'legislative' aspect. The genius 'cannot indicate how
this fantastic and yet thoughtful ideas arise and come
together in his head, because he himself does not know,
and cannot, therefore, teach it to anyone'.?
It is no doubt comforting to speak of ' the genius' as if
impersonal creative energy were commensurable with the
order of autonomous individuality governed by reason,
6
Ibid., 294'9; 221'5·
7
Ibid., 244; 170.
1 5 2
ART AS I N S U R R E C T I O N
but such chatter is, in the end, absurd. Genius is nothing
like a character trait, it does not belong to a psychological
lexicon; far more appropriate is the language of seismic
upheaval, inundation, disease, the onslaught of raw energy
from without. One 'is' a genius only in the sense that
one 'is' a syphilitic, in the sense that 'one' is violently
problematized by a ferocious exteriority. One returns to
the subject of which genius has been predicated to find
it charred and devastated beyond recognition.
I I
Schopenhauer reconstructed the critical philosophy in
several very basic ways: by eliminating the dogmatic
presupposition of a difference between subjective and
objective noumena; by shifting, not in an idealist (phe
nomenological) direction, but towards unconscious will;
by simplifying the transcendental understanding from the
twelve categories and two forms of sensibility inherited
from Kant to the integrated 'principle of sufficient reason';
by nipping Kant's proto-idealist logicism in the bud; by
charging the critical philosophy with the furious energy of
sexual torment, attacking its (at least) germinal academi
cism, and immeasurably improving its stylistic resources.
Where Kant distorts, marginalizes, and obscures the
thought of the unconscious, Schopenhauer emphasizes
and develops it. He defies the pretensions of imperalistic
1 5 3
FAN G E D N O U M E NA
idealism by describing reason as a derivative abstraction
from the understanding, co-extensive with language, so
that Kant's transcendental logic is rethought through a
transcendental aesthetic organized in terms of the 'prin
ciple of sufficient reason', simplified, de-mystified, and
pushed downwards towards pre-intellectual intuition.
Reason is no longer thought of as an autonomous prin
ciple in reciprocal antagonism with nature, but as a film
upon its surface. All these moves involve a massive shift
in the term 'will' [Willel, the placeholder for the psycho
analytical comprehension of desire.
For Kant, the will is aligned with reason, as the princi
ple of the investment of nature with intentional intelligibil
ity, the resource from which teleological judgment must
regulatively metaphorize all exorbitant natural order:
The will, as the faculty of desire, is one of the many
natural causes in the world, namely, that one which
is effective through concepts, and everything that
is represented as possible (or necessary) through a
will is called practically possible (or necessary) , in
contradistinction from the physical possibility or
necessity of an affect for which the ground is not
determined in its causality through concepts (but
rather, as with lifeless matter, through mechanism,
and, with animals, through instinct) .B
8
Ibid., 79; 9·
1 5 4
ART AS I N SURRECTION
In contrast, Schopenhauer's great discovery is that of
non-agentic will; the positivity of the death of God .
Rather than thinking willing a s the movement by which
conceptually articulate decision is realized in nature, he
understands the appearance of rational decisions as a
derivative consequence of pre-intellectual - and ultimately
pre-personal, even pre-organic - willing. Unconscious
desire is not just desire that happens to be unconscious,
as if a decisionistic lucidity is somehow natural or proper
to desire; it is rather that consciousness can only be con
sequential upon a desire for which lucid thought is an
Schopenhauer and the Surplus Intellect
- Schopenhauer posits that the intellect is normally a tool of the will, functioning only to serve biological necessity and desire.
- Genius is defined as a 'superfluity' or excess of intellectual energy that cannot be absorbed by the will's practical demands.
- This surplus creates a 'purposeless' objectivity, allowing for a pure perception of the world that is useless or even injurious to the individual ego.
- The text identifies a tension in Schopenhauer’s thought between the redemption of the individual through renunciation and the dissolution of the self into archaic, pre-individual desire.
- Artistic beauty is interpreted as a negative affect of relief, providing a temporary release from the 'torture chamber' of interested thought and organic specificity.
The mother of the useful arts is necessity; that of the fine arts superfluity and abundance.
instrumental requirement. For Schopenhauer the intellect
is constituted by willing, rather than being constitutive
for it. We do not know what we want.
There is an important sense in which Schopenhauer's
will is the thought of genius taken towards its limit,
subsuming the entire faculty of knowledge under that o f
exorbitant natural order, a s a mere instance (although a
privileged one) of purposiveness without purpose. But
S chopenhauer's own usage of the thought of genius
preserves it in its specificity, as a proportional exorbi
tance on the part of the intellect in relation to the will .
Genius is the result of a positive overcoming of uncon
scious 'purpose', an excess of intellectual energy over
that which can be absorbed by desire, thus redundancy,
or dysfunction through superfluity:
1 5 5
FAN G ED NOU M ENA
an entirely pure and objective picture of things is
not reached in the normal mind, because its power
of perception at once becomes tired and inactive, as
soon as this is not spurred on and set in motion by
the will. For it has not enough energy to apprehend
the world purely objectively from its own elasticity
and without a purpose. On the other hand, where
this happens, where the brain's power of forming
representations has such a surplus that a pure, dis·
tinct, objective picture of the external world exhibits
itself without a purpose as something useless for the
intentions of the will, which is even disturbing in the
higher degrees, and can even become injurious to
them - then there already exists at least the natural
disposition for that abnormality. This is denoted by
the name of genius, which indicates that something
foreign to the will, i.e., to the I or ego proper, a genius
added from outside so to speak, seems to become
active here.9
The mother of the useful arts is necessity; that of the
fine arts superfluity and abundance. As their father,
the former have understanding, the latter genius,
which in itself a kind of superfluity, that of the power
A. Schopenhauer, Die Welt alf Wille und Vorstellung, in Werke in zehn II (Zurich: Diogenes,
1977), 446; translated by E.F.J. Payne as '!he World as Will and Representation, vol. II
(NY: Dover, 1966), 377-
1 5 6
ART AS I N SURRECTION
of knowledge beyond the measure required for the
service of the will.1O
For Schopenhauer the body is the objectification of the
will, the intellect is a function of a particular organ of
the body, and genius is the surplus of that functioning in
relation to the individual organism in question. Genius is
thus an assault on the individualized will that erupts from
ou t of the reservoir of archaic pre-organized willing. I t is a
site of particular tension in his thinking, caught between
a vision of progressive redemption, achieved through
humanity as perfected individuality in which the will is
able to renounce itself, and regressive unleashing of the
pre-individual will from the torture chamber of organic
specificity, ego-interests, and personality. Schopenhauer's
attachment to the first of these options is well known, but
the possibility of an alternative escape from individuali
zation - by way of dissolution into archaic inundating
desire - constantly strains for utterance within his text .
This tension generates a terminological fission that can
be easily detected along the jagged fault lines separating
sexuality from art. One example is 'beauty'; a word that
is driven by Schopenhauer's overt (metaphysical) policy
into an uneasy alignment with renunciation. He interprets
it as the negative affect - relief or release - associated
1 5 7
FANGED NOUMENA
with disengagement from interested thought, attained
through contemplative submergence in the pure univer
sal 'ideas' of natural species as they exist outside space,
time, and causality, and manifest to a radicalized Kantian
disinterestedness that is greatly facilitated by artistic
representation. II
The Libidinous Sublime
- The author critiques Derrida's Spurs for failing to recognize the specific tension between Nietzsche and Schopenhauer regarding the aesthetic and the feminine.
- Schopenhauer defines excitement as suffering, a foundational concept for modern libidinal economy that views pleasure only as the temporary cessation of pain.
- Art in the Schopenhauerian sense is the 'negative of fiction,' serving as an escape from desire and a gateway to the truth of resignation.
- A conflict arises between the disinterested beauty of resignation and the 'arousing' beauty of the female body, which draws the subject deeper into the 'inferno of willing.'
- Schopenhauer posits that nature uses 'instinct' as a delusion or chimera to trick the individual into serving the interests of the species while believing they serve themselves.
- The text identifies two competing versions of the sublime: one rooted in renunciation and the other in libidinous intensity.
The anegoic disinterestedness of resignation is echoed and parodied by an indifference to ego-interests that leads in a quite opposite direction; deeper into the inferno of willing.
If in the end Derrida's Spurs is an absurd book, it is
because it is tapping into Nietzsche's negotiation with
Schopenhauer's discourse on woman and the aesthetic
without knowing what it is listening to, because it is
too busy perpetuating the Heideggerian mutilation of
libidinal post-Kantianism. Nietzsche's recovery and
affirmation of the fictive power of art (in his later writ
ings) is a response to the violent denigration of this
power in Schopenhauer's thought, a denigration that is
programmed by a complex of interlocking factors that
are evidenced with particular intensity in his discussion
of sexual difference. Schopenhauer founds the modern
thought of excitement as suffering, a thought which sur
vives into the twentieth century in a variety of guises, and
most importantly in Freud's libidinal economy. In order
to perpetuate a rhythm of desire and its tranquilization,
II
Of all the complex issues I have skimmed over recklessly this is perhaps the richest
and most impacted. Schopenhauer, by referring exorbitant form back to a Platonic
eidos is undoubtedly sacrificing a great deal of the fertile tension in Kant's thought
of purposiveness without purpose, although he also reduces the risk of a slide back
into teleological theology. The thought that was perhaps necessary in order to depart
most radically from the possibility of theistic relapse was that ofa divine unconscious,
eliminating all possibility ofagentic creation at any level. But this would be the image
of a mad god. Dionysus?
1 5 8
A RT AS I N S U R R E C T I O N
in which there is no space for positive pleasure, but only
variable degrees of pain, it is necessary to be profoundly
misled. This is why Schopenhauer refers to the principle of
sufficient reason, which is associated with the pure form
of material reality, and is the transcendental condition of
individuated appearance, as the veil of Maya, or illusion.
Art, as the escape from individuation and desire, is thus the
very negative of fiction. Beauty is an experience of truth.
But there is also another troubling, enticing, arousing,
and captivating type of beauty (Nietzsche will come to
say it is the only one), the beauty that is exemplified - in
post-Hellenic western history at least - in the female body.
For Schopenhauer this is an immense problem, as is the
domain of the erotic in its entirety. The anegoic disinter
estedness of resignation is echoed and parodied by an
indifference to ego-interests that leads in a quite opposite
direction; deeper into the inferno ojwilling. After acknowl
edging with his usual raw honesty that 'all amorousness
is rooted in the sexual impulse alone',12 Schopenhauer is
forced to accept that 'it is precisely this not seeking one's
own interest, everywhere the stamp of greatness, which
gives even to passionate love a touch of the sublime, and
makes it a worthy subject ofpoetry'.13
There is thus both a renunciatory and a libidinous
sublime, each with its associated objects and aesthetic
12 Ibid., 624; 555.
1 5 9
FAN G E D N O U M E NA
'perfections' or intensities. And it is not only beauty that
is torn in separate directions, fiction too is split; on the
one hand as the condition of individualization, and on the
other as an appeal to constituted individuality. Either the
ego is a dream of desire, or desire has to creep up on the
ego as a dream. In sexuality,
nature can attain her end only by implanting in the
individual a certain delusion, and by virtue of this, that
which in truth is merely a good thing for the species
seems to him to be a good thing for himself, so that
he serves the species, whereas he is under the delu
sion that he is serving himself. In this process a mere
chimera, which vanishes immediately afterwards,
floats before him, and, as motive, takes the place of
a reality. This delusion is instinct. In the great majority
of cases, instinct is to be regarded as the sense of the
Schopenhauer, Misogyny, and Nietzschean Inheritance
- Schopenhauer characterizes woman as a formless, deceptive force of 'dissimulation' that disrupts male self-legislation and rationality.
- The text argues that Schopenhauer's pessimism necessitates misogyny because woman represents an 'overflowing positivity' that refuses to repel the will to live.
- Schopenhauer views the female form as 'unaesthetic,' claiming only the sexual impulse blinds the male intellect into perceiving beauty in women.
- Nietzsche inherited several core tenets from Schopenhauer, including libidinal materialism, the primacy of the body, and a distrust of mathematical thinking.
- Schopenhauer identifies the circle as the universal symbol of nature and recurrence, a concept that prefigures Nietzsche's own philosophical developments.
- Nietzsche eventually transcended Schopenhauer by shifting from a passive 'will to life' toward a creative 'will to power' and a logic of gradation without negativity.
Pessimism has to be misogyny, because woman refuses to repel.
species which presents to the will what is useful to it.13
Woman is matter, formless and unpresentable, arousing
and thus tormenting; everything about her is pretence,
deception, alteration, unlocalizable irrational attraction,
Verstellung. Schopenhauer's notorious essay On Woman is
mapped by the movement of this word, as it organizes the
play of seduction, of indirect action, of non-ideal beauty,
13 Ibid., 630; 538.
1 6 0
ART AS INSURRECTION
disrupting the seriousness and responsible self-legislation
of the male subject through an 'art of dissimulation'.14
Woman is wicked art, art that intensifies life, art whose
only truth is a whispered intimation that negation, too, is
only a dream, the figment of an overflowing positivity that
deceives through excess. Could the dream of redemption
be nothing but a bangle upon the arms of exuberant life?
Schopenhauer reels in horror:
Only the male intellect, clouded by the sexual impulse,
could call the undersized, narrow-shouldered, broad
hipped, and short-legged sex the fair sex; for in this
impulse is to be found its whole beauty. The female
sex could be more aptly called the unaesthetic. IS
Women are so terribly non-Platonic, so outrageously vital
and real, so excessive in relation to the cold sterile perfec
tions of the ideas. With infallible instinctive power they
propagate the dangerous delusion that there is something
about life that we want. Pessimism has to be misogyny,
because woman refuses to repel.
'4
A. Schopenhauer, Parergo und Paralipomena II (Zurich: Diogenes, '977), 671; tr. by E.
F. J. Payne as Parerga and Paralipomena, vol. II (Oxford: Clarendon, 1974), 617-
'5
Ibid., 673; 619.
1 6 1
FAN G E D N O U M E NA
I I I
A few of the things that Nietzsche learnt - at least in
part - from Schopenhauer were the elementary tenets of
libidinal materialism or the philosophy of the energetic
unconscious (the unrestricted development of the theory
of genius), the primacy of the body and its medical condi
tion, pragmatism (asking not how we know but why we
know), effervescent literary brilliance, aestheticism (with
a musical focus), an 'aristocratic' concern for hierarchy
and gradation (which he turned into an implement for
overcoming Aristotelian logic), antihumanism, a construc
tion of the history of philosophy as dominated by Plato
and Kant and the problematic of reality and appearance,
virulent anti-academicism, misogyny, and the distrust of
mathematical thinking. Schopenhauer even wrote that:
The genuine symbol of nature is universally and
everywhere the circle, because it is the schema or form
of recurrence; in fact, this is the most general form
in nature. She carries it through in everything from
the course of the constellations down to the death
and birth of organic beings. In this way alone, in the
restless stream of time and its content, a continued
existence, i.e., a nature, becomes possible.16
16 A. Schopenhauer, Die Welt als Wille und Vorstellung II, ii, 559; tr. Payne in Ille World as
Will and Representation, vol. 11, 477,
1 6 2
ART AS I N SURRECTION
But the shifts Nietzsche had brought to the Schopenhaue
rian philosophy by the end of his creative life were at least
as immense as this inheritance, involving, amongst other
elements, a displacement from the will to life to the will to
power, so that survival is thought of as a tool or resource
for creation; a displacement of antihumanism from the
ascetic ideal to overman (non-terminal overcoming); the
completion of a post-Aristotelian 'logic' of gradation
without negativity or limits; a 'critique of philosophy'
that diagnosed Plato and Kant as symptoms of libidinal
disaster; a return of historical thinking freed from the
untenable time/timelessness opposition of bankrupt logi
cism; and a displacement from the principle of sufficient
reason to 'equalization' [Ausgleichung], which - since
differentiation was no longer thought of as an imposition
Dionysian Insurrection and Apollonian Defense
- Nietzsche reinterprets Schopenhauer’s 'will' as Dionysus, a force of primordial unity that liquidates individual personality through collective delirium.
- The Apollonian represents the masculine drive for clarity, order, and the 'plastic arts,' serving as a defensive structure against the chaotic Dionysian outside.
- Doric civilization is characterized as a permanent military encampment, a rigid and cruel architecture designed to resist 'titanic-barbaric' nature.
- Greek tragedy functioned as a unique fusion where desire was delivered into representation, allowing the West to remain permeable to its 'outside.'
- The 'Socratic death' of tragedy initiated a period of ethnic solipsism and the domestication of impersonal creative energies into repressed, psychologized 'genius.'
- Nietzsche shifts the solution to the problem of individuality from metaphysical renunciation toward the affirmation of insurgent desire.
Only incessant resistance to the titanic-barbaric nature of the Dionysian could account for the long survival of an art so defiantly prim and so encompassed with bulwarks, a training so warlike and rigorous, and a political structure so cruel and relentless.
of the subject - implied a shift from primordial unity to
irreducible pluralism, and from the disinterested 'world
eye' to perspectivism.
Nietzsche's intricate, profound, and explosive response
to the provocation of S chopenhauer resists hasty sum
marization. It is helpful to start with the transitional
movements of The Birth of Tragedy, in which the Scho
penhauerian will is re-baptized as 'Dionysus'. Like the
undifferentiated will, it is only in the dream of Apollon
ian appearance that Dionysus can be individualized. As
Walter Otto remarks (about the mythological, not just
the specifically Nietzschean god) : 'He is clearly thought
1 6 3
FANG ED NOUM ENA
of on the oriental pattern as the divine or infinite in
general, in which the individual soul longs so much to
lose itself' .17 The tragic chorus is the focus of a delirious
fusion, in which the personality is liquidated by the collec
tive artistic process. Otto says some other very important
things about Dionysus, the twice-born:
The one so born is not merely the exultant one and
joy·bringer, he is also the suffering and dying god,
the god of tragic contradiction. And the inner power
of this dual nature is so great, that he steps amongst
humanity as a storm, quaking them and subduing
their resistance with the whip of madness. Everything
habitual and ordered must be scattered. Existence
suddenly becomes an intoxication - an introduction
of blessedness, but no less one of terror.
To this female world the Apollonian stands opposed,
as the decidedly masculine. The mystery of life, of
blood and of terrestrial force does not rule in it, but
rather clarity and breadth of spirit. But the Apollon
ian world cannot persist without the other.!8
'7
W. F. Otto, Dianysos, Mythos und Kultus (Frankfurt am Main: Vittorio Klostermann,
'933), liS·
,8 Ibid., 74'5, '32.
1 64
ART AS INSURRECTION
Doric civilization, the hard Apollonian spine of western
culture, vaunting the defiant erectness of its architecture,
is fundamentally defensive in nature. Already in this,
Nietzsche's most 'Schopenhauerian' book, the minor
register of the pessimistic quandary prevails without
compromise; the overcoming of wretched individuality is
to be referred in the direction of the reservoir of insurgent
desire, not in that of a metaphysical renunciation. One
does not build fortifications against saints:
to me the Doric state and Doric art are explicable
only as a permanent military encampment of the
Apollonian. Only incessant resistance to the titanic
barbaric nature of the Dionysian could account for
the long survival of an art so defiantly prim and so
encompassed with bulwarks, a training so warlike
and rigorous, and a political structure so cruel and
relentless .19
The difference between Dionysus and Apollo is that
between music and the plastic arts (Schopenhauer's differ
entiation that Nietzsche describes as 'the most important
insight of aesthetics'),20 will and representation (primary
and secondary process), chaos and form. In the tragic
'9 F. Nietzsche, Die Ceburt der Tragddie (Frankfurt am Main: Ullstein Materialien, 1981),
35 tr. W. Kaufmann as The Birth qfTragedy (NY: Vintage, 1967), 47.
20 Ibid., 89; 100.
1 6 5
FAN G E D N O U M E NA
fusion of music and theatrical spectacle desire is delivered
upon the order of representation in a delirious collective
affirmation of insurgent alterity (nature, impulse, oracular
insight, woman, barbarism, Asia). Greek tragedy is the
last instance of the occident being radically permeable
to its outside. The Socratic death of tragedy is the begin
ning of the ethnic solipsism and imperialistic dogmatism
that has characterized western politics ever since, the
brutal domestication process with which the repressive
instance in man (,reason') has afflicted the impersonal
insurrectionary energies of creativity, until they became
the whimpering, sentimental, and psychologized 'genius'
Art as Dionysian Insurrection
- Nietzsche redefines the aesthetic operation not as a teleological move toward 'truth' or simplicity, but as an open-ended creative process that intensifies the world's enigma.
- The unintelligibility and disturbing character of the world are presented as the primary sources of its value and the stimulus for ecstatic creation.
- Dionysian pessimism is characterized by a refusal to be deprived of the enigmatic, exulting in 'terrible agonies' and 'burning perplexities' as resources for becoming.
- The text critiques Freud for reducing art to a contingent terrain for psycho-biography and therapeutic application rather than recognizing its inherent connection to the primary process.
- Psychoanalysis is accused of becoming a 'Kantian' police activity that manages and contains genius to adapt the individual to bourgeois society.
What the philosophers have never understood is this: it is the unintelligibility if the world alone that gives it worth.
of the romantics. With Socrates began the passionate
quest of European humanity to become the ugly animal.
In his later, more fragmentary writings on art, Nietzsche
perhaps says something a little like the following. The
aesthetic operation is simplification; the movement of
abstraction, logicization, unification, the resolution of
problematic. It is this operation which, when understood
in terms of the logical principles formulated by Aristotle
- in terms, that is, of its own product - seems like a
negation of the enigmatic, the re-distribution of alterity
to the same within a zero-sum exchange, the progressive
'improvement' and domestication of life. But simplifica
tion is not a teleologically regulated approximation to
simplicity, to the decadent terminus we call 'truth', it is
an inexhaustibly open-ended creative process whose only
1 6 6
ART AS I N SURRECTION
limits are fictions fabricated out of itself. Nothing is more
complex than simplification; what art takes from enigma it
more than replenishes in the instantiation of itself, in the
labyrinthine puzzle it plants in history. The intensification
of enigma. The luxuriantly problematic loam of existence
is built out of the sedimented aeons of residues deposited
by the will to power, the impulse to create, 'The world as
a work of art that gives birth to itself.'21
Enigma, positive confusion (delirium) , problematic,
pain, whatever we want to call it; the torment of the
philosophers in any case, is the stimulus to ecstatic crea
tion, to an interminable 'resolution' into the enhanced
provocations of art. What the philosophers have never
understood is this: it is the unintelligibility if the world
alone that gives it worth. 'Inertia needs unity (monism) ;
plurality of interpretations a sign of strength. Not to
desire to deprive the world of its disturbing and enigmatic
character'.22 Not, then, to oppose pain to the absence o f
pain a s metaphysical pessimism does, but, rather, to dif
ferentiate the ecstatic overcoming of pain from weariness
and inertia, to exult in new and more terrible agonies,
fears, burning perplexities as the resource of becoming,
overcoming, triumph, the great libidinal oscillations that
break up stabilized systems and intoxicate on intensity;
21 F. Nietzsche, Der Wille 2;ur Macht, ed. P. Gast, E. F6fster-Nietzsche (Stuttgart: Alfred
KTonerVerlag, 1964),533; tr. byW. Kaufmann as The WilltoPower(NY: Vintage, 1968). 419.
22 Ibid., 413; 326.
1 6 7
FAN G E D NOUMENA
that is Dionysian pessimism - 'refusal to be deprived of
the stimulus of the enigmatic';23 'the effect of the work
of art is to excite the state that creates art - intoxication' . 24
IV
After Nietzsche there is Freud. Tapping into a reservoir
of genius (the unconscious of late nineteenth-century
Viennese women) that drives him to the point of idi
ocy, he pushes onwards without knowing what the fuck
he's doing_ Freud is a thinker of astounding richness
and fertile complexity, but I shall merely touch upon
his most disastrous confusion_ When he writes on art,
degenerating - despite his wealth of acuity - into banal
psycho-biography, a terribly damaging loss of direction
afflicts the psychoanalytic enterprise. The inherent con
nection between the irruptive primary process and artistic
creativity, or the basic inextricability of psychoanalysis
and aesthetics, slips Freud's grasp, and art is presented
as a merely contingent terrain for the application of
therapeutically honed concepts. The adaptation of the
mutilated individual to its society, in which art is illegal
except as a parasite of elite commodity production cir
cuits, is the scandal of psychoanalysis. It becomes Kantian
23 Ibid., 330; 262.
24 Ibid., 553; 434·
1 6 8
ART AS INSURRECTION
(bourgeois); a delicate police activity dedicated to the
social management and containment of genius. As if
'therapy' could be anything other than the revolutionary
Genius, Fascism, and Desire
- The philosophy of genius bifurcates into the psychoanalytic reduction of praxis to senseless energy and the National Socialist re-ascription of genius to a divinized, arbitrary subjectivity.
- Fascism is characterized as a fanatical project to eliminate excess and enforce a secular 'City of God' against the inherent disorder of life.
- Twentieth-century philosophy faces the dual task of diagnosing Nazism while arming insurrectionary desire with intellectual weapons to evade racist political dead-ends.
- Georges Bataille is presented as a 'Schopenhauer with enthusiasm,' advocating for an active nihilism that affirms loss and violent expenditure over utilitarian preservation.
- Bataille’s work links literature, eroticism, and revolt, suggesting that art serves as the 'wastage of life' and a necessary outlet for human disorder.
His early essays sketch a vision of fascism as the most fanatical project for the elimination of excess, an attempt at the secular enforcement of the perfectly ordered city of God against the disorder, luxuriance, and mess of surplus.
unleashing of artistic creation !
The two basic directions in which the philosophy
of genius can develop are exemplified by psychoanaly
sis and national socialism. Either rigorous anti-anthro
pomorphism, the steady constriction of the terrain of
intentional explanation, and the rolling reduction of
praxes to parapraxes, or the re-ascription of genius to
intentional individuality, concentration of decision, and
the paranoiac praxial interpretation of non-intentional
processes (the Jewish conspiracy theory) . The death of
God is operative in both cases, either as the space of
the generative unconscious, or as that of a triumphantly
divinized and arbitrarily isolated secular subjectivity.
It is easy to see that the role of discourse in these two
cases is a very precise register for the difference at issue;
on the one hand the talking cure, in which the texts of
confession and rational theory are both displaced by
the compression wave of a radically senseless energy
process that defies the status of object in relation to an
autonomously determinable agent language; and on the
other, the interminable authoritative monologue of the
dictator (politically instantiated ego-ideal), in which the
will is returned to a quasi-Kantian acceptation to capital
ize upon its libidinal detour, finding its true sense in the
1 6 9
FANG ED NOUM ENA
lucid decision of an individual who speaks on behalf of
a racially specified unconscious clamour.
That part of twentieth-century philosophy resonant
with the aesthetically oriented tendency outlined here
has as its two great tasks the diagnosis of Nazism and
the protraction of the psychoanalytic impulse, in other
words the arming of desire with intellectual weapons that
will allow it to evade the dead-end racist Gotterdammerung
politics which capital deploys as a last ditch defence
against the flood. No revolution without insurrectionary
desire, no effective route for insurrectionary desire without
integral anti-fascism. Wilhelm Reich, Georges Bataille,
Gilles Deleuze, and Felix Guattari are perhaps the most
important theoretical loci in this development. The latter
three I shall say a little about.
It is not simply ridiculous to describe Bataille as Scho
pcnhaucr with enthusiasm, in so far as this might crudely
characterize a certain variant of 'Nietzscheanism', or
Dionysian pessimism. After all, Bataille too is concerned
with value as the annihilation of life, challenging the
utilitarianism that finds its only end in the preservation
and expansion of existence. If this affirmation of loss is
'nihilistic', it is at least an 'active nihilism'; the promotion
of a violently convulsive expenditure rather than a weary
renunciation. Art as the wastage of life. And Bataille's
involvement with art, above all with literature, is of an
unparalleled intricacy and intensity. Philosopher and
1 70
ART AS INSURRECTION
historian of art, literary theorist, in his 'philosophy' a
stylist, dazzling as an essayist, a novelist and poet of
both profundity and incandescent beauty, his is a writing
oblivious to circumscription, spreading like an exotic
fungus into the darkest recesses of aesthetic possibility.
A rather tortured and incoherent leap? Come on now ! A
'philosophy' of excess that draws out an inner connection
between literature, eroticism, and revolt could hardly
be irrelevant to our problematic here. As Bataillc states,
'beauty alone . . . renders tolerable a need for disorder,
violence, and indignity that is the root of love.'25
Bataille also has the peculiar honour, shared with
Nietzsche and Reich, of beginning his assault on germinal
national socialism before Hitler had exhibited its truth.
His early essays sketch a vision of fascism as the most
fanatical project for the elimination of excess, an attempt
at the secular enforcement of the perfectly ordered city of
God against the disorder, luxuriance, and mess of surplus
Art as Insurrection
- The text explores the tension between primary production—characterized by eroticism, art, and 'disindividualized delirium'—and the restrictive coding of fascist tendencies.
- Deleuze and Guattari's 'Anti-Oedipus' is framed as an anti-fascist diagnostic that identifies 'schizophrenia' as the raw, undomesticated energy of genius.
- The 'body without organs' is introduced as a material abstraction and pure surface that emerges from the ungrounded, multiple energy of the libido.
- A central philosophical problem is posed: why does desire choose its own repression and allow creative production to be rigidified into the 'social straitjacket' of capital?
- Fascism is defined by its hatred of the uncontrollable, targeting everything from migrant workers and 'lunatics' to drifting sexual drives and artistic abandonment.
- Traditional philosophy is critiqued as a nihilistic ally of state control that seeks to terminate uncertainty and achieve the 'immobile perfection of death'.
Paradox after paradox, spun like a disintegrating bandage upon the infected and deteriorating wound of Kant's aesthetics, teasing the philosophical domestication of art -the most gangrenous cultural appendage of capital -towards its utter disintegration.
production, as it sprawls into the voluptuary expenditure
of eroticism and art. Assailing the fascist tendency is the
disindividualized delirium of tragic sacrifice and revolu
tion, when
Being is given to us in an intolerable surpassing of
being, no less intolerable than death. And because,
25 G. Bataille, Oeuvres Completes, vol. III (Paris: Gallimard, 1976), 13.
1 7 1
FANGED NOUM ENA
in death, it is withdrawn from us at the same time it
is given, we must search for it in the feeling of death,
in those intolerable moments where it seems that
we are dying, because the being in us is only there
through excess, when the plenitude of horror and
that of joy coincide.26
For there is no doubt that the fascists are right, the very
incarnation of right, yes: ' Literature is even, like the
transgression of moral law, a danger.'27
A theory of the real as art (primary production) that is
melded seamlessly with an anti-fascist diagnostics charac
terizes the work of Gilles Deleuze and Felix Guattari. In
their Anti-Oedipus they indicate that the rational regulation
or coding of creative process is derivative, sterile, and
eliminable. Their name for genius is 'schizophrenia', a
term that cannot be safely domesticated within psychol
ogy, any more than 'genius' can (and for the same reasons).
If nature is psychotic it is simply because our psychoses
are not in reality 'ours'.
Libido - as the raw energy of creation - is ungrounded,
irreducibly multiple, yet it precipitates a real and unified
'principle' out of itself. The body without organs is its
name; at once material abstraction, and the concretely
26 Ibid., 11-12.
27 Ibid., voL IX, 182.
1 72
ART AS I N S U R R E C T I O N
hypostasized differential terrain which is nothing other
than what is instantaneously shared by difference. The
body without organs is pure surface, because it is the
mere coherence of differential web, but it is also the
source of depth, since it is the sole ' ontological' element
of difference. It is produced transcendence. Paradox after
paradox, spun like a disintegrating bandage upon the
infected and deteriorating wound of Kant's aesthetics,
teasing the philosophical domestication of art - the most
gangrenous cultural appendage of capital - towards its
utter disintegration.
How does desire come to desire its own repression?
How does production come to rigidify itself in the social
straitjacket whose most dissolvedJorm is capital? It is with
this problematic, inherited from Spinoza, Nietzsche, and
Reich, that Deleuze and Guattari orient their work. In our
terms here: how does art become (under-) compensated
labour? Their answer involves a displacement of the prob
lem into a philosophical affinity with Kant's paralogisms
of the pure understanding, rethought in Anti-Oedipus as
materially instantiated traps for desire. A paralogism is
the attempt to ground 'conditions of possibility' in the
objectivity they permit, or creativity in what it creates.
This is, to take the most pertinent example, to derive the
forces of production from the socio-economic apparatus
they generate. Sociological fundamentalism, state wor
ship, totalitarian paranoia and fascism, they all exhibit
1 7 3
FA N G E D N O U M E NA
the same basic impulse; hatred of art, (real) freedom,
desire, everything that cannot be controlled, regulated,
and administered. Fascism hates aliens, migrant workers,
the homeless, rootless people of every kind and inclina
tion, everything evocative of excitement and uncertainty,
women, artists, lunatics, drifting sexual drives, liquids,
impurity, and abandonment.
Philosophy, in its longing to rationalize, formalize,
define, delimit, to terminate enigma and uncertainty, to
co-operate wholeheartedly with the police, is nihilistic
in the ultimate sense that it strives for the immobile
perfection of death. But creativity cannot be brought to
an end that is compatible with power, for unless life is
The Decay of Spirit
- The concept of Spirit (Geist) has devolved from Hegel's cosmic medium into a marginalized, sentimentalized metaphor rendered obsolete by modern neurology and cybernetics.
- Phenomenology is critiqued as a 'clownish incompetence at death,' serving as a systematic refusal of the impersonal in favor of a rigid, humanistic propriety.
- The philosophical lineage from Socrates to Husserl is characterized as a shallow egoism that conflates the ownership of reality with the subjective self.
- Phenomenology's reduction of the world to the personal creates a 'quasi-solipsistic' state that remains naively baffled by the problem of the 'other.'
- The author rejects the Husserlian reading of Kant, arguing that it defangs skepticism by replacing the 'deep epoche of unknowing' with a controlled, subjective doubt.
Spirit is less a misleading or dangerous word than a ridiculous one; a Coelecanth of a word. Yet it persists: the mark of a clownish incompetence at death.
extinguished, control must inevitably break down. We
possess art lest we perish qjthe truth.28
To conclude is not merely erroneous, but ugly.
28 Nietzsche, Der Wille ZUT Macht, 554; 435.
1 7 4
Spirit and Teeth
A PRELI M I NARY POST" M O RTEM
Spirit (Geist) is stigmatized by a multiple deconstructi
bility: as a substantialization of Dasein, an antonym
of matter, a correlate of phonic lucidity, or a token of
reflexivity, self-presence, pure intelligibility, spontaneity,
etc. In the course of its recent history this word has been
inflated by Hegel into the cosmic medium of transac
tion - the super-heated lubricant of global eventuation
- and then trafficked to the edge of worthlessness by the
culture succeeding him, before finally succumbing to an
irreparable marginalization by the scientific advances
of experimental and behavioral psychology, neurology,
neuroanatomy, cognitive science, cybernetics, artificial
intelligence, until it becomes a sentimentalism, a vague
peripheraIized metaphor, a joke . . . a cheap target one
might think. There are those who remain loyal enough
to the canonical discourses of Western philosophy to
1 7 5
FANGED NOU M E NA
argue that logocentrism is secreted in the implementary
terminology of information, digitality, program, software,
and control. But as for spirit! - that can only be parody
or nostalgia. Who could still use such a word without
humor or disdain? Spirit is less a misleading or dangerous
word than a ridiculous one; a Coelecanth of a word. Yet
it persists: the mark of a clownish incompetence at death.
Such incompetence has its doctrine, rituals, and lit
urgy, its orthodoxies and heresies. It is the entire and
prolonged refusal of the impersonal summarizable as
'phenomenology.' Whether high-church (Hegel) , or
low-church (HusserI), phenomenology is the definitive
ideology of propriety; systematically employing the inter
rogative mode in order to distill out everything for which
proper subjectivity cannot claim responsibility, and thus
entrenching the humanistic dimension of Western phi
losophy ever more rigidly. This entire current gradually
compiles an attempted proof of the impossibility of death,
an ontological conflation of access to reality and owner
ship (psyche, cogito, Selbstheit, Eigentlichkeit, Jemeinigkeit),
a perpetually reformulated spiritualism. Socrates, Des
cartes, HusserI: all shallow, all egoists, all pressing further
into the flatlands of the profane. This is why they are so
well placed to profit from the death of God (an event in
which they had taken no part - on the contrary; the obses
sional egoism of theism had always appealed to them) .
Phenomenology is a programmatic denial (reduction
1 7 6
S P I RI T A N D T E E T H
to the personal) of exteriority which, after becoming
a quasisolipsistic knee-jerk of self-assertion, wonders
with genuine naivety why alterity has come to pose such
problems. If spirit largely disappears between Hegel and
H usserl it is because, compared to the transcendental ego,
it seems a little too complicit with the outside.
Unlike Heidegger and Derrida, I see no advance,
recovery, or sophistication taking place in the H usserlian
reading of Kant. The phenomenological reduction of
appearance [Erscheinung] to evidential Schein is a dogmatic
decision which de fangs the tentative skepticism of the
critical philosophy, taking it even further from the deep
epoche of unknowing: the vast abrupt discovered confus
edly by Pyrrho of Elis, the repressed of monotheistic
civilization. Husserlian suspension or bracketing is not
Pyrrhonian but Socratic; a reservation of judgment that
is subordinated to apodicticity, to knowing what one
knows even if nothing else (to doubting as a power of
the subject). Epoch!, chaos, Old Night, death, however it!
she is named, the way there is not our doing. Suspension
is to be discovered, not performed.
The Slime and the Unknown
- The author critiques the 'phenomenological dogmatics' of Husserl and Heidegger for domesticating the radical enigma of Nietzschean fiction.
- Heidegger is accused of dismissing the problematic of the unknown by suggesting that the meaning of being is already built into existence.
- Philosophy is reduced to 'primate psychology,' a parochial obsession with the 'variegated slime' of a speck of dust compared to the vast Unknown.
- The text contrasts the 'languorous pace' and 'meticulous courtesy' of Derrida’s scholarship with a more urgent, desperate need for philosophical haste.
- Suspension of knowledge is ultimately equated with death, an order that cannot be delayed by academic deliberation or 'decent patience.'
Let us not forget that philosophy is also primate psychology; that our loftiest speculations are merely picking through a minuscule region of the variegated slime encrusting a speck of dust.
So what is to be thought of a differance that radicalizes,
deconstructs, or subverts a suspension thus crushed under
a phenomenological dogmatics? What is it that would take
us this way, if not that which appears (in Kant's sense, not
Husserl's) as the humanistic pretension - the spirit - of
representational philosophizing? Such suspension is of
1 77
FA N G E D N O U M E NA
course a detour, an avoidance, but scarcely an inevitable
one. On the contrary, it is peculiarly deliberated; meticu
lously valorizing a specific philosophic tendency (passing
through H usserl), effacing another (the Schopenhauerean
fork of post-Kant ian ism), and painstakingly transferring
signs from the latter to the former (Nietzsche read through
Heidegger! ! !). Section 7 of Sein l1nd Zeit is exemplary
here, with its insistence upon an evidential reading of
phenomenality, thereby dismissing the entire problematic
of Nietzsche's thinking in a single casual gesture. What
sense to the insistent theme of fiction in Nietzsche's writ
ings after such a move has been made? What sense to
cnigma? (We always already have the meaning of being
built into the structure of existence, Heidegger suggests,
it is merely that we do not yet know that we know. Ques
tioning is remembering. Socrates smiles.)
We do not know yet, a not yet that can be dilated cor·
rosively; frustrating the end of metaphysics, interminably
deferring truth. Yawns become scarcely controllable. Does
it matter what we know or will never know? Let us not
forget that philosophy is also primate psychology; that
our loftiest speculations are merely picking through a
minuscule region of the variegated slime encrusting a
speck of dust. An obsessional concern for such insignifi
cances is a tasteless parochialism. What matters is the
Unknown: the escapographic matrix echoed spectrally
by the negative prefix, sprawled in immense indifference
1 7 8
SPIRIT AND TE ETH
to all our "yets". B eyond the anthropoid gesticulations
of knowing, suspension is not differentiable from death,
and death ("one's death" as we so ludicrously say) does
not belong to an order that can be delayed. Has our
Socratism reached such a pinnacle of profanity that we
really imagine she would wait for us?
PART I: WO LVES
As I continue to study this text, elsewhere, with a
more decent patience, I hope one day to be able,
b eyond what a conference permits me today, to
render it justice in also analysing its motion, its mode
or its status (if it has one), its relation to philosophi·
cal discourse, to hermeneutics or poetics, but still
what it says of Geschlecht, the word Geschlecht, and
also of place [Ort], as of animality. For the moment
[l'instant], I follow solely the passage of spirit.!
These are the words of a man who is confident he will
survive for some considerable time. There is no discern
ible urgency here, far less abruptness, desperation, or
any of the raw intensities of haste. Instead there is the
now familiar rhetoric of close reading; the simultaneous
1
]. Derrida, De {'esprit: Heidegger et la question (Paris: Galilee, 1987), '37; sec also, J.
Derrida, Of Spirit: Heidegger and the Question, tr. G. Bennington, R. Bowlby (Chicago:
University of Chicago Press, 1989), 87.
1 7 9
FANG ED NOUM ENA
performance and prescription of painstaking care,
deliberation, conscientiousness, and reverential textual
devotion. A certain intricately intertextual discussion of
spirit unfolds, at a languorous pace, inspired by uninter
rogated principles of decency and justice. Everything is
mediated by elucidations, re-elucidations, elucidations
of previous elucidations, conducted with meticulous
courtesy, but never inattentive to the complicity of the
concept of elucidation with the history of metaphys
ics from Plato to the previous paragraph of De l'esprit.
Our author is not to be hurried into premature pronounce
ments on matters of such seriousness as philosophical
Lycanthropy Versus Deconstruction
- The text contrasts Derrida's slow, decent hermeneutics with the 'indecent precipitation' and feral speed of the werewolf.
- Werewolves are defined by libidinal tension and jagged discontinuities, lacking the ethical earnestness and longevity required for academic discourse.
- The poetry of Georg Trakl is presented as a lycanthropic vector of impatience, communicating a pestilence that hermeneutics seeks to avoid.
- Lycanthropy is described as an epidemiological condition passed through 'bites,' such as Rimbaud's influence on Trakl.
- The 'werewolf race' is characterized by spiritual inferiority, a horror of trades, and a resistance to the discipline of civilization and education.
Their feral physiologies are badly adapted to the depressive states conducive to ethical earnestness.
discourse, hermeneutics, or poetics. Nor is he prepared to
descend into such overenthusiastic crudity as examining
more than one of Heidegger's words in a single book. Last
of all, as it has so often tended to be, comes a promise to
take seriously the problem of animality, which - God and
suchlike spiritual primordialities being willing - should
come to be written about one day.
It is probably relatively uncontroversial to conclude
from all this that Derrida is not a werewolf. Werewolves
are dissipated within a homolupic spiral that distances
them utterly from all concern for decency or justice.
Their feral physiologies are badly adapted to the depres
sive states conducive to ethical earnestness. Instead they
are propelled by extremities of libidinal tension which
fragment their movements, break up their tracks with
1 8 0
S P I R I T A N D T E ETH
jagged discontinuities, and infest their nerves with a
burning malaise, so that each gesture is baked in a kiln of
ferocity. Creatures of epidemic rather than hermeneutics,
werewolves tend to be very crude, but then, they don't
live as long as deconstructionists. The luxury of delaying
the problem of animality is not open to them.
On page 141 of De l'esprit Derrida apologizes for a
very moderate instance of textual impoliteness that he
describes as 'precipitating in an indecent fashion'. 2 In
this thought of 'indecent precipitation' he comes closer
to the dominant impulse of Trakl's poetry than at any
other point in the book; closer too, it could be argued,
than Heidegger ever gets. An evasion that is perhaps
constitutive of hermeneutical decency is exemplified when,
by taking one's time over interpreting Trakl's poetry, one
avoids succumbing to the pestilence it communicates.
Trakl's writings are lycanthropic vectors of impatience, of
twitch disease, because they are the virulent relics of an
indecent precipitation, an abortion, a meteorite impact.
Trakl took very little time over anything. Surviving as
he did to the age of twenty-seven he had very little time
to take.
Trakl confesses to his lycanthropy in the first version
of Passion, the unavowed version, where he writes that:
2
Ibid., '4'; Derrida, OjSpirit, 87·
1 8 1
FANGED NOUM ENA
Two wolves in the sinister Wood
We mixed our blood in a stony embrace
And the stars of our race fell upon us.3
The word 'race' in this translation precipitates the sense of
Geschlecht in an indecent fashion. In the complete absence
of hermeneutical conscientiousness it is epidemiological
factors alone which compel this. To become a werewolf
one must be bitten by another werewolf, and in Trakl's
case it seems this was Rimbaud, who wrote: 'It is quite
evident to me that I have always been of an inferior race.
I am not able to comprehend revolt. My race never stirs
itself except for pillage: like wolves at the beast they have
not killed'.4
To be a werewolf is to be inferior by the most basic
criteria of civilization. Not only is the discipline of politi
cal responsibility alien to them, so is the entire history
of work in which such discipline is embedded. Rimbaud
remarks, starkly enough: 'I have a horror of all trades.' In
general, it can be said that this race is marked by a pro
found spiritual inferiority. Compared to the piety, moral
ity, and industriousness of its superiors it exhibits only
laziness, disobedience, and an abnormally unsuccessful
C. Trakl, Das dichterische Werk (Munchen: Deutscher Taschenbuch Verlag, 1972), .216;
for a recent English translation, see G. Trakl, Poems and Prose: A Bilingual Edition tr.
Alexander Stillmark. (Illinois: Northwestern University Press, 2005), 82.
4
A. Rimbaud, Collected Poems, tr. O. Bernard, (Harmondsworth: Penguin, 1986), 302 .
1 8 2
SPIRIT AND TEETH
repression of all those traits of the unconscious which
Freud describes as 'resistant to education,' and among
which there is nothing remotely associated with either
The Vulcanism of Inferior Becomings
- The text explores the 'accursed race' of Trakl and Rimbaud, defined by a refusal of Christian morality, legal reciprocity, and transcendental subjectivity.
- The Austro-Hungarian Empire is depicted as a machine that generated regressive trajectories, condensing Slavic 'barbarian' energies within the Viennese cultural core.
- Freudian psychoanalysis is reinterpreted not through the lens of Oedipus, but as a map of 'homolupic' drives and nomadic invasions that threaten civilization.
- Language is described not as a formal structure of meaning, but as having the viral, destructive pattern of a plague.
- War is analyzed as a sublimation of primary-process aggression, acting as a dream that allows civilization to remain asleep while masking a deeper 'death-wave'.
- Trakl’s poetry, specifically 'In the East', is presented as the 'undoing' of a war poem, peeling back the mask of heroism to reveal an obscene, teeming mass of despair.
If the unconscious is structured like a language it is only because language has the pattern of a plague.
decency or justice: 'I have never been of this people; I
have never been a christian; I am of the race who sings
under torture; I do not understand the laws, I am a brute'. 5
Such is Trakl's 'accursed race'6 as well as Rimbaud's,
communicating its dirty blood in wilderness spaces of
barbarian inarticulacy. Eternally aborting the prospect of
a transcendental subjectivity, the inferior ones are never
captured by contractual reciprocity, or by its attendant
moral universalism. They are no more employable than
they are psychoanalyzable, oblivious to both legality
and incentive. I ncapable of making promises - even to
themselves - they are excluded from every possibility
of salvation. The craving for such pagan regressions is
unspeakable. It is only with the greatest strictness that
the superior ones repress the violent drives which lure
them into inferior becomings; becoming female, black,
irresponsible and nomadic, becoming an animal, a plant,
a death spasm of the sun.
In its final phase the Austro-Hungarian Empire became
a machine for the generation of homolupic becomings:
brewing intense trajectories of regression among the
5
Ibid , 308
6
Trak!, Dca dichterische Werk, 82.
1 8 3
FANGED NOUMENA
slavic races of the Balkans and Carpathians, translating
them into German, and then condensing them under the
pressure of exacerbated repression in the Viennese culture
core. What exploded in the hysterias of Freud's patients
was an irresistible vulcanism of becoming inferior, whose
petrified lava flows mapped-out the regressive character
of the drive. The migrant blocks of tension summarized
in the Freudian unconscious are much less a matter of
Oedipus than of the mongols; of those who feed the world
of spirit to their horses as they inundate civilization like
a flood. If the unconscious is structured like a language
it is only because language has the pattern of a plague.
Among Trakl's writing's are two war poems, and per
haps only two. One is Grodek - named after the battlefield
upon which the Austro-Hungarian army suffered a major
defeat in the early stages of the conflict - and is perhaps
the most widely known of Trakl's writings. It is this poem
that includes the line so important to both Heidegger and
Derrida concerning 'the hot flame of spirit' . 7 The other is
entitled In the East, and sketches the same libidinal figure
in the First World War as Freud's writings of the two
ensuing decades. This figure traces the displacement of
impersonal primary-process aggression against the self
God-city complex - against civilization - onto the far more
restrained axis of armed competition between nations.
7
Ibid., 95; Trakl, Poems and Prose, 106.
1 8 4
S P I R I T A N D T E E T H
War sublimates the lycanthropic death-wave in the same
way a dream sublimates unavowable desire; allowing
something to remain asleep. In this sense In the East
is the undoing of a war poem, and has the nightmare
quality associated with something peeled-back; such as
the disintegration of flesh from a skull, or the opening
of a corpse to reveal an obscenely teeming mass. This
movement of violent disillusionment is starkly outlined
in the poem Confiteor:
And as the masks fall from each thing
I see only anxiety, despair, ignominy and epidemic,
The tragedy of humanity has no heroes,
A vile piece, played out on graves and corpses.8
The second stanza of In the East ends with the spirits of the
stricken - of the erschlagenen, close perhaps to a Geschlecht
- sighing among the shadows of autumnal ashes, and to
this point In the East might still be a war poem. It would
still be possible for the ego to savour these stanzas for the
sublimation-trap they lay for impersonal thanatropisms,
offering up the victims of inhibited conflicts as a mourn
ful dream-image. The third and final stanza, however, is
something quite different:
8
Ibid . • '47·
1 8 5
FAN G E D N O U M E NA
Thorny wilderness girdles the city
Lycanthropic Becomings and Wild Matter
- The text analyzes Georg Trakl's poetry as a site where the boundary between the civilized city and the wild exterior is violently ruptured.
- Violence is reframed not as a political conflict between states, but as an 'unrestrained movement of erosion' that dissolves the distinction between life and death.
- The concept of 'steps' or gradation in Trakl's work represents heterogeneous strata of intensity that subvert the great simplicities of culture like identity and equality.
- Civilization is described as a 'mendacious retranscription' of real metamorphoses, which are more accurately found in impersonal, creative regressions.
- The 'accursed race' rejects the humanizing, protective fire of the hearth in favor of a regressive, epidemic fire that protracts the trajectory of animality.
The work of the city has never been anything but a mendacious retranscription of the real metamorphoses which reemerge in lycanthropic becomings.
From bloody steps the moon hunts
Terrified women.
Wild wolves break through the gate.9
The wild, the basis of a noun in the first line of the stanza,
returns as an adjective in its last. An indeterminate mul
tiplicity of wolves effect a rupture in the boundary of the
city, transmitting its positive exteriority into its kernel.
No longer interpretable as politics, as a war between
cities, states, or other civilized totalities, the violence
of the East relapses into an unrestrained movement of
erosion. Blood, the moon, and women are coagulated by
an intense menstrual seism which shatters the proper dif
ference between life and death, integrity and dissolution,
periodicity and shock. What Trakl in Grodek names 'the
forgotten blood' recovers its sacred sense, in the regression
that transmutes the politico-ethically impregnated blood
of the dying solder into savage categorially 0 blivious flow.
Wild matter is untouched by its difference from spirit,
insofar as this is supposed to depend upon a logical
disjunction. The pseudointeriorities of the city are no less
permeable to it than the uncultivated spaces marked out
by the civilized ones for its exile. The bloody steps [Stufen ]
of In the East are only one variant among the many found
9
Ibid., 94; Trakl, Poems and Prose, 124.
1 8 6
S P I RI T AND TEETH
in Trakl's writings: 'steps of madness',lo 'mossy steps,'
'ruined steps,' 'the steps of the wood'.n It is a language
of gradation, degree, AbstuJung. Not quantity as opposed
to quality, nor the difference of the two, but heterogenous
strata of intensity, which - like the scales of the chaos
theorists - involve irresolvable complexity, diversity,
indefinite protractability in both directions, the default of
absolute thresholds, an economics of incommensurability,
and a compulsively recurrent abortion of the concept.
Essence is preempted by an irresolvable excess of detail,
in the same eruptive gesture that lethally infects transcend
ence with the return of excitatory complexity. The great
simplicities of culture - identity, equality, absoluteness,
abstraction - are immanently subverted by the pathologi
cal mass of unsublatable ingredients. There is no concept
of particularity that is not theological; aligned with the
phantasm of a transcendent spirit that stands disjoined
from the ineliminable materiality of all spiritualization
processes - to steal Nietzsche's term.
That matter is volatilized to different degrees of spir
itualization is not in the least dependent upon spiritual
causalities of any kind. Between the wilderness and the
polis is a wilderness history - a genealogy - and not a
political history. Regression is not an undoing of the city's
IO Ibid., 43.
II
Ibid., 54.
1 8 7
FANGED NOUM E NA
work, but a recurrence of impersonal creativity. More
precisely, the work of the city has never been anything but
a mendacious retranscription of the real metamorphoses
which reemerge in lycanthropic becomings.
Inferiority is not any kind o f lack or impoverish
ment, but a positive libidinal charge potentiating spir
itualizations. Anything that slumbers in the sterility of
pseudoabsoluteness is right to fear the inferior ones, and
the powerful regressions that wash away the ramparts
damming-up intensive sequences. The accursed race,
living like beasts, whose veins are inflamed by a cosmic
menstruation, have never entered into the great project
of civilization, which begins with the use of fire to keep
the wild animals at bay. Instead they leave a scorched and
blackened trail in their wake as they irresponsibly protract
the trajectory of animality. In their hands fire itself loses
itself; becoming dirty, epidemic, and regressive. Not for
them the humanizing, nucleating fire; the hearth, the pro
tective and nutrifying glow, a focus embracing difference
within itself, the fire of the familial and the familiar. The fire
Lupine Fire and Rat Burrows
- The text describes a 'dissolvant blaze' that destroys transcendental structures through waste, dissipation, and dehumanization.
- Georg Trakl is presented not as a stable identity, but as a chaotic battlefield of 'becomings' ranging from pharmacist to werewolf.
- The author uses Ibsen’s 'Rat Wife' to illustrate the bourgeois denial of the base, gnawing desires that inhabit the domestic sphere.
- Traditional reading and philosophy rely on vertical hierarchies and 'super-terrestrial transitions' to maintain order and purity.
- A counter-architecture of 'immanence' is proposed, characterized by burrows, ducts, and vents that allow for contagion and corruption.
- The 'insidious dimension' of the horizontal disrupts the vertical stratification of social, theological, and psychological spaces.
It is perhaps more precise to say that Trakl never existed, except as a battlefield, a reservoir of disease, the graveyard of a deconsecrated church.
of the inferior ones is the dissolvant blaze which spreads
uncontrollably, combusting the gloomy architectures of
transcendence in the mad truth of exteriority. It is the
fire of waste, dissipation, dehumanization, of a deeper
and harsher fertility than can be comprehended by the
industry of man. This lupine fire - the apolitical element
1 8 8
S P I R I T A N D T E ETH
in war, literature, psychosis, and catastrophe - makes
space for the impersonal propagations of the wilderness.
An abrupt question: Was Trakl a Christian? Yes, of
course, at times he becomes a Christian, among a general
confusion of be comings - becoming an animal, becoming
a virus, becoming inorganic - just as he was also an anti
christ, a poet, a pharmacist, an alcoholic, a drug addict,
a psychotic, a leper, a suicide, an incestuous cannibal, a
necrophiliac, a rodent, a vampire, and a werewolf. J list
as he became his sister, and also a hermaphrodite. Trakl's
texts are scrawled over by redemptionist monotheism,
just as they are stained by narcotic fluidities, gnawed by
rats, cratered by Russian artillery, charred and pitted by
astronomical debris. Trakl was a Christian and an atheist
and also a Satanist, when he wasn't simply undead, or in
some other way inhuman. It is perhaps more precise to say
that Trakl never existed, except as a battlefield, a reservoir
of disease, the graveyard of a deconsecrated church, as
something expiring from a massive cocaine overdose on
the floor of a military hospital, cheated of lucidity by the
searing onslaught of base difference.
1 8 9
FAN G E D N O U M E NA
PART I I : RATS
Henrik Ibsen knew some things about rats, 'they who are
hated and persecuted of men' . 1 2 The fact of an alliance
between rats and desire was evident to him, and when
the rat wife of Little Eyolfis asked where her beloved is,
she answers: "Down among all the rats" .13 How deftly he
indicates the registration of the rats upon the Oedipal
claustrophobia of the bourgeois household:
Rat Wife: [curtsies at the door] Begging your most
humble pardon, ladies and gentlemen . . . but have
you anything gnawing at this house?
Allmers: Have we . . . ? No, I don't think so.
Rat Wife: Because if you had I'd be glad to help you
get rid of it.
Rita: Yes, yes, we understand. But we don't have
anything of that kind.l4
How desperate they are not to believe it ! "Rats don't
belong here, this is the inside, purity, civilization,
12
Henrik Ibsen, the Oiford Ibsen, vol. 8 (London: Oxford University Press, 1966), 49.
13
Ihid·, 49·
I4
Ibid., 46.
1 90
SPI RIT AND TEETH
philosophy ... we don't want to know about anything qf
that kind. "
Reading is not one thing. It is always possible to
construe the movement between strata, plates, terraces,
in spiritual terms; a matter of simulacrum, represen
tation, metaphor, commentary, and interpretation.
God is like and unlike a man, who is like and unlike
an animal, which is like and unlike inorganic matter.
This is an architecture of super-terrestrial transitions,
transcendental difference, absolute verticality, gulfs of
essence, logicized, infinitized, purifying disjunction.
There is not one alternative to such a schema, but a reck
lessly proliferated multiplicity of alternatives; complex
sponge-spaces rotted by lines of insinuation. There is
always a dimension of immanence; a burrow, a thread,
a path for contagion. The storeys of a house lend them
selves to social stratification, and thus to philosophical
and theological metaphor; the basement representing the
place of the servants, animality, the unconscious. What is
repressed in this case is not the basement itself - hell is
not repressed but exhibited - but the hollow walls, thc
drainpipe outside, the arterial system of tubes, ducts,
and vents, everything that facilitates the corruption of
vertically articulated space by the quasihorizontality of
an insidious dimension. Laws, revelations, and prayers,
Spirit and Teeth
- The author critiques Heidegger and Derrida for ignoring the 'vermin-core' of Georg Trakl's poetry, specifically the recurring presence of rats.
- Rats represent a positive antihistoricism and a 'lycanthropic power of infiltration' that subverts the divine, hierarchical order of the strata.
- The rat's primary poetic function is the decomposition of interiorities, breaking open the 'house of the father' to feral alterity.
- The text suggests that God's celestial architecture is not immune to the sewage system and 'ratholes' of the impersonal universe.
- Historical and folkloric accounts of rats as plague-bearers highlight a long-standing human dread that precedes scientific understanding of disease.
- The act of feeding rats in Trakl's work is framed as a gesture of 'beautiful treachery' against mankind and humanistic stability.
Irrespective of his celestial visage, Jahweh still has ratbites on his ass.
or - at a lower level - commands, messages, and reports,
seem to establish the defined relations between strata
1 9 1
FANGED NOUMENA
that are identical with justice. The words of God pass
down from level to level, determinately mediated at each
stage. Inherent to such spatiality is its subversion, a
more basic and complex order of distances, because
Heaven is not without its ratholes, its sewage system, an
entire impersonal architecture characterized by porous
heterogeneity. It seems likely that God would insist upon
air·conditioning and a dumbwaiter. Irrespective of his
celestial visage, J ahweh stilI has ratbites on his ass.
Neither Heidegger nor Derrida have any time for
TrakI's rats, but that doesn't stop them swarming every
where, exaggerating the lycanthropic power of infiltration.
It must be admitted; the rats are not very spiritual, but if
there is a site, Ort, that focuses TrakI's poetry, why is it not
the courtyard that Trakl repeatedly populates with rats?
Are not the rats, as a positive antihistoricism, crucial to
TrakI's poetic force? Why does Heidegger never mention
TrakI's superb poem The Rats, a text that functions as a
vermin-core for an entire pattern of infestation? Perhaps
it is because difference becomes unacceptable when it
moves fast and unpredictably, hissing at humanity through
plague-smeared teeth.
It is certainly not because the rats are indiscernible,
despite their unlocalizable fluidity. They shriek, whistle,
bicker, rummage, and romp. When the rats erupt into
Dream and Derangement for instance, which is perhaps
Trakl's most shattering and lycanthropic poem, they are
1 92
SPIRIT AND TEETH
not merely glimpsed - far less ignored or exterminated -
but encouraged by the poem's central character, who feeds
them in a gesture of beautiful treachery against mankind.
Not that it is population alone that gives them a special
privilege, ravens are equally prevalent within Trakl's writ
ings - and also have a poem of their own - whilst toads
and bats are to be found in incredible numbers. It is the
rats' hideous talent for decomposing interiorities that
advantages them; opening the incest-rotted 'house of the
father' - and with it the most intensely charged recesses
of Trakl's writing - to the depredations of feral alterity.
Despite his humanistic prejudices, Hans Zinsser, in
his book Rats, Lice, and History, has written delightfully
about the rats. He remarks:
It is a curious fact that long before there could have
been any knowledge concerning the dangerous
character of rodents as carriers of disease, mankind
dreaded and pursued these animals. Sticker has col
lected a great many references to this subject from
ancient and medireval literature, and has found much
evidence in the folklore of medireval Europe which
points to the vague recognition of some connection
between plague and rats. In ancient Palestine, the
Jews considered all seven mouse varieties (akbar)
unclean, and as unsuited for human nourishment as
were pigs. The worshipers of Zoroaster hated water
1 9 3
FANGED N O U M E NA
rats, and believed that the killing of rats was a service
to God. It is also significant that Apollo Smintheus,
the god who was supposed to protect against dis
ease, was also spoken of as the killer of mice, and
saint Gertrude was besought by the bishops of the
early Catholic Church to protect against plague and
mice. The year 1498, Sticker tells us, was a severe
plague year in Germany, and there were so many
rats in Frankfurt that an attendant was stationed for
several hours each day on a bridge in the town and
directed to pay a pfennig for every rat brought in.
The attendant cut off the tail of the rat - probably
as a primitive method of accounting - and threw the
bodies into the river. Heine, according to Sticker,
speaks of a tax levied on the Jews of Frankfurt in
the fifteenth century, which consisted of the annual
The Dynamic Hierarchy of Vectors
- Rats function as a powerful dynamic hierarchy of vectors, combining the fluid dissemination of liquids with the concentrated displacement of solids.
- The 'murine' virus cycle demonstrates how diseases like typhus are maintained in rat populations by lice and fleas before jumping to humans.
- The rat is characterized as an unmitigated nuisance with unlimited destructiveness, capable of inhabiting any environment and consuming almost anything.
- Historical zoology distinguishes between the agile black house-rat (Rattus rattus) and the more voracious, cunning brown sewer-rat (Rattus norvegicus).
- The Black Death represents the historical climax of the black rat's influence before it was eclipsed by the 18th-century invasion of the brown rat from the East.
- The displacement of the black rat by the brown rat mirrors the historical sweeping aside of established civilizations by mass barbarian invasions.
It combines the insidious subtlety of liquids with the concentrated displacement of compact solids; saturation with jumps.
delivery of five thousand rat tails. Folklore originating
in a number of different parts of Europe during the
great plague epidemics mentions cats and dogs, the
hereditary enemies of rats and mice, as guardians
against plague.15
. There is enormous power to the dynamic hierarchy of
vectors mobilized by the rats. It combines the insidious
subtlety ofliquids with the concentrated displacement of
15
H. Zinsser, Rats, Lice, and History (Roston: Bantam Books. 1965), 142-3.
1 94
S P I RIT AND TE ETH
compact solids; saturation with jumps. Rats carry fleas
which bear diseases, augmenting the fluid dissemination
of plagues with a ferociously discontinuous transmission.
To quote Zinsser again:
Studies made within the last few years seem to indi
cate that the virus of the Mexican-American type of
typhus fever, as well as of the endemic variety in the
Mediterranean basin, is highly adapted to rodents and
is carried in these animals - rats - during the intervals
between human epidemics; transmitted from rat to rat
by the rat louse (polyplax) and the rat flea (Xenopsylla),
and, on suitable occasions, to man from the rat by the
rat flea. For this reason, Nicolle speaks of this as the
'murine' virus.16
And a little further on:
From the point of view of all other living creatures,
the rat is an unmitigated nuisance and pest. There
is nothing that can be said in its favor. It can live
anywhere and eat anything. It burrows for itself
when it has to, but, when it can, it takes over the
habitations of other animals, such as rabbits, and
kills them and their young. It climbs and swims.
16
Ibid, 142.
1 9 5
FAN G E D N O U M E NA
It carries disease of man and animals - plague,
typhus, trichinella spiralis, rat-bite fever, infectious
jaundice, possibly foot-and-mouth disease and a form
of equine 'influenza'. Its destructiveness is almost
unlimited.17
The first empirical element to be noted by any libidinal
rat theory is the zoological diversification of the rat into
two species. These are 'Rattus rattus, the black, house, or
ship-rat, and Rattus Norvegicus, the greyish brown, field,
or sewer-rat' ,18 of which Shrewsbury says in his History if
the Bubonic Plague: 'By comparison with the house-rat it
is less agile but far more voracious and cunning, and as it
is stronger and more fecund it is a much more formidable
enemy of mankind'.19 During the outbreak of bubonic
plague during the fourteenth century it was not only
the intense killing of human populations, or delivery of
terminal vectors, that was executed by R. rattus, who lived
and propagated in close proximity to humans, but also
the long-range dissemination of the plague, as R. Norvegi
cus is not thought to have arrived in Europe before the
eighteenth century. If this is true - and current historical
zoology gives no positive reason to doubt it - then it can
17
Ibid, 150-1.
18 JF.D. Shrewsbury, A History of the Bubonic Plague in the Briti"h Isles (Cambridge:
Cambridge University Press, 1970), 7.
19
Ibid, 8.
1 9 6
SPIRIT AND TEETH
safely be asserted that the black death, in addition to its
precursor which raged across the near orient and Europe
during the sixth and seventh centuries, will remain the
climax of achievement reached by R. rattus, who has since
been eclipsed. Zinsser once more:
just as the established civilizations of Northern
Europe were swept aside by the mass invasions of
barbarians from the East, so the established hegem
ony of the black rat was eventually wiped out with
the incursion of the hordes of the brown rat, or Mus
decumanus - the ferocious, short-nosed, and short
tailed Asiatic that swept across the Continent in the
early eighteenth century . . .
The brown rat, too, came from the East. I t is now
known as the 'common' rat and, because of a mis
taken notion of its origin, as Mus norvegicus. Its
true origin, according to Hamilton and Hinton, is
probably Chinese Mongolia or the region east of Lake
The Logic of the Rat
- Historical accounts from Roman rhetoricians and 18th-century naturalists describe the massive, coordinated migrations of rats from the Caspian and Baikal regions.
- The transition from the black rat (R. rattus) to the brown rat (R. Norvegicus) represents an alogical differentiation rather than a binary opposition.
- Rats operate through a 'logic' of indiscriminate proliferation and nonidentity, establishing themselves as a sheer intensity or potential for disaster.
- Freud’s 'Rat Man' case study highlights a specific 'Oriental punishment' involving rats that serves as a metaphor for an insidious, impersonal libidinal force.
- The rat-delirium represents a violation of representational discourse, where the 'imperial interpretative gesture' is subverted by an unexpected external force.
Rats disdain discrimination, propagating their difference upon a plateau of excitement.
Baikal, in both of which places forms resembling
it have been found indigenous. The same writers
quote Blasius, who believes that the ancients about
the Caspian Sea may have known this rat. Claudius
A:lianus, a Roman rhetorician of the second cen
tury, in his De A nimalium Natura, speaks of 'little less
than Ichneumons, making periodical raids in infinite
1 9 7
FANGED NOUM ENA
numbers' in the countries along the Caspian, 'swim
ming over rivers holding each other's tails.'
Pallas (1831) , in his Zoographia Rosso-Asiatica, records
that in 1727 - a mouse year - great masses of these
rats swam across the Volga after an earthquake.2o
There are two varieties of rat, but this should not be taken
as a gift for our metaphysicians, or supposed antimeta
physicians, who are constantly in search of dichotomic
conceptual oppositions. The duality of R. rattus and R.
Norvegicus is of the kind 1, 2, ... not 0 ... 1; it encloses
nothing, reaches no limits, provides no determination,
logical negativity, or alternation. The tokens of libidinal
displacement are complex and not diacritical. Alogical
differentiation: black and brown, not black and white.
One, two ... first the wave uf R. rattus, effective on its
own, almost invisible to the Europe of the middle ages,
differentiated perhaps from the mice (it was called mures
majores),21 ... lh, 1, . . . ? And then the wave of R. Norvegicus,
a different type of rat, but not an opposite type; rather, a
type that was more clever and destructive, taking the rat
process a little bit further. Far from requiring the black
rat for its determinacy the new Asiatic invader wipes out
20 Zinsser, Rats, Lice, and History, 149.
21
Shrewsbury, History oflhe Bubonic Plague, 121.
198
S P I RIT AND T E ETH
the previous rat population, establishing itself as a sheer
intensity, as a potential for disaster. Rats disdain discrimi
nation, propagating their difference upon a plateau of
excitement. Differentiation within an illimitable series,
alogical dissimilarity, independence from the differend,
and indiscriminate proliferation of nonidentity; this is
the 'logic' of the rats.
Freud's 1909 case of compulsive neurosis - the 'rat
man' - is told by his captain, fatefully, of a 'particularly
terrible Oriental punishment' . 22 Freud describes how
this was related to him in the analysis: 'the condemned
is bound (he expressed himself so unclearly that I could
not immediately guess [erraten] in what position) - upon
his posterior a pot was placed, into a which rats [Rat
ten] were introduced, which - he stood up again and
gave out all the signs of terror and resistance - bored
themselves in'. 23 This is the 'rat-punishment' [die Rat
tenstraje], visited upon Europe, through its underside,
from the East. Its peculiar insidiousness, which Freud
does not emphasize even though he marks it, is that to
surmise [erraten] the riddle [Ratse!] of the Rattenstroje is
to suffer it. In the very movement of prowess the imperial
interpretative gesture is taken par derriere by an impersonal
22
S. Freud, Studienausgabe, Band VII: Zwang, Paranoia, und Peroersi.on (Frankfurt am Main:
S. Fischer, 1982), 4$ S. Freud, 'Notes Upon a Case of Obsessional Neurosis' (1909),
in 'Three Case Histories, ed. P. Rieff (NY: Touchstone, 1996), 11.
23
Ibid., 44; 12.
1 9 9
FAN G E D N O U M E NA
libidinal force from beyond representational discourse,
whether logico-psychiatric or orientalist. The image of
anal violation that organizes the rat-delirium has all
the traits of a compromise formation; a sublimation of
utter unexpectedness into a linearized passage fortified
by a sadistically invested and ego-eo-opted sphincter.
The infiltration of the rat is singularized, and depicted
as an inverse frontal assault, stripped of its fluidity,
indirectness, heterogeneity, as if it were mere delicacy
that obstructed our comprehension of vermin space. It
is not Oedipal ambivalence that is solicited by such an
Fanged Noumena and Broken Dogs
- The author critiques humanism as an anal-sadistic structure that uses racist misogyny to project and expel 'undomesticated flows'.
- Animality is redefined not as a biological state but as a complex space of fluid, unpredictable, and 'lupine' becomings that dissolve human boundaries.
- Post-Christian humanity is described as a pack of 'broken dogs' who have lost the impulse to bite back against their former inquisitors.
- The text argues that postmodern tolerance and agnosticism are strategic retreats by theistic power to avoid the 'nemesis' of its own decline.
- Bataille and Schopenhauer are positioned as successors to a dangerous, atheistic, and experimental philosophy that refuses the 'contrived peace' of secular culture.
- The forces of the 'antichrist' are depicted as emerging from 'scorched rat-holes' to challenge the domesticating project of monotheistic hegemony.
It is painfully evident that post-christian humanity is a pack of broken dogs.
image, but the racist misogyny that would project all
undomesticated flows onto an axis of expulsability. The
rattenstrafe is a wish - and thus an idealization - because
it is far more comforting to the anal-sadistic structure of
humanism than the reality of the free penetrability of the
body along all of its irresolvably scaled estuaries.
Animality is not a state, essence, or genus, but a
complex space cross-cut by voyages of all kinds. Trakl
explores this wilderness terrain with an excruciating
vulnerability. The animality which Trakl finds has its
dead-ends and stagnant sumps, it has its humanistic and
theological becomings, but it also has its channels of open
flow; becoming multiple, fluid, unpredictable, becoming
an enemy of mankind, lupine and murine becomings of
all kinds. These intensive sequences cannot be isolated
or determined, since no impermeable boundary remains
2 0 0
SPIRIT AND TEETH
to quarantine Trakl's rodents from the nameless ones.
From becoming a mouse, and then a black rat, and then
a brown rat, or from becoming one's sister, and then a
pack of wolves, and then a swarm of rats. The eternity of
Rimbaud's inferior race shares its diseases with Nietzsche's
'deep, deep, eternity ', for which the very adjective is torn
apart by convulsive waves of descent. An unfathomable
aby ss of regression or recurrence protracts itself epidemi
cally into Trakl's body. 'I am all the vermin in history.'
Indecent precipitation.
2 0 1
Shamanic Nietzsche
God said to Nietzsche:
That'll Tzetzsche,
You irritating little Krietzsche.
ANONYMOUS G RAFFITO
Will Christendom ever reap the whirlwind it has sown? That
it should try to pass, without the vulnerability of interval,
from a tyranny to ajoke, is certainly understandable, but
that its enemies should do nothing to obstruct its evasion
of nemesis is more puzzling. How can there be such
indifference to the decline of our inquisitors? Is it that
they succeed so exorbitantly in their project of domestica
tion that we have been robbed of every impulse to bite
back? Having at last escaped from the torture-palace
of authoritarian love we shuffle about, numb and con
fused, flinching from the twisted septic wound of our past
(now clumsily bandaged with the rags of secular culture) .
2 0 3
FANG ED NOUM ENA
T t is painfully evident that post-christian humanity is a
pack of broken dogs.
Georges Bataille is the preeminent textual impedi
ment to Christianity's carefully plotted quiet death; the
prolongation of its terminal agonies into the twentieth
century. Having definitively exhausted itself after two ugly
millennia of species vivisection, Christianity attempts to
skulk away from the scene, aided by the fog of supine
tolerance which dignifies itself as 'post· modernity' . It does
not take a genius to sec whose interests are served by this
passage from militant theism to postmodern ambivalence.
A despot abandons any game that begins to turn out
badly. This has been the case with metaphysics. From
Kant onwards exploratory philosophy ceased to gener
ate the outcomes favourable to established (theistic)
power, and we were suddenly told: "this game is over,
let's call it a draw". The authoritarian tradition of Euro
pean reason tried to pull the plug on the great voyages
at exactly the point they first became interesting, which is
to say: atheistic, inhuman, experimental, and danger
ous. Schopenhauer - refusing the agnostic stand-off
of antinomy - was the first rallying zone for all those
disgusted by the contrived peace entitled 'the end of
metaphysics'. Bataille is his most recent successor.
The forces of antichrist are emerging fanged and encour
aged from their scorched rat-holes in the wake of mono
theistic hegemony, without the slightest attachment to the
204
S HA M A N I C N I E TZ S C H E
paralytic tinkerings of deconstructive undecidability. 'An
attitude which is neither military nor religious becomes
The War Against Truth
- The text argues that traditional Western epistemology is absurdly positioned when it operates in the shadow of religious institutions.
- The priest is characterized as a practitioner of a systematic mendacity where every word and gesture is an instinctive falsification.
- Radical atheistic thinking, following Nietzsche and Bataille, shifts the philosophical focus from 'how do we know' to 'where do the lies stop'.
- True skepticism is presented not as a dry academic exercise but as a 'profound ecsanity' or being out of one's mind.
- Philosophy is defined by a subterranean desire to use knowledge as a means to deepen unknowing rather than merely accumulating facts.
He cannot comment upon the weather without a secret agenda of deceit.
insupportable in principle from the moment of death's
arrival'.l The war has scarcely begun.
It is hard to imagine anything more ludicrous than
Descartes, or Kant, having erected their humble philo
sophical dwellings alongside the baroque architectural
excesses of the church, standing in the shadows of flying
buttresses and asking pompously: how do we know the
truth? It surely cannot solely be due to Nietzsche that we
see the absurdity of an 'epistemological' question being
asked in such surroundings. When a philosopher has a
priest for a neighbour, which is to say, a practitioner of
the most elaborately constructed system of mendacity ever
conceived upon earth, how can a commitment to 'truth'
in a positive sense even be under consideration? Truth
in such situations is a privilege of the deaf. There is no
question of ' error', 'weakness in reasoning', or 'mistaken
judgment' when addressing the authoritative discourses
on truth in the western tradition, those cathedrals of
theological concept building that ground our 'common
sense'; no, here one can only speak of a deeply rooted
and fanatical discipline aJlying. In other words, one frac
tion of the radicality of the atheistic thinking escalated
through Schopenhauer, Nietzsche, and Bataille is that it
G. Bat.ille, Oeuvres Completes, 12 Vols. (Paris: Gallimard, '970-'988), vo!' 11, 246.
205
FAN G E D N O U M E NA
overthrows the high-bourgeois apologetic-epistemological
problematic in modern philosophy by asking clearly for
the first time: where do the lies stop?
The great educational value of the war against Chris
tendom lies in the absolute truthlessness of the priest.
Such purity is rare enough. The 'man of God' is entirely
incapable of honesty, and only arises at the point where
truth is defaced beyond all legibility. Lies are his entire
metabolism, the air he breathes, his bread and his wine.
He cannot comment upon the weather without a secret
agenda of deceit. No word, gesture, or perception is slight
enough to escape his extravagant reflex of falsification,
and of the lies in circulation he will instinctively seize on
the grossest, the most obscene and oppressive travesty.
Any proposition passing the lips of a priest is necessarily
totally false, excepting only insidiouses whose message
is momentarily misunderstood. It is impossible to deny
him without discovering some buried fragment or reality.
There is no truth that is not war against theology, and
even the word 'truth' has been plastered by the spittle of
priestcraft. It cannot be attachment to some alternative
conviction that cuts here, but only relentless refusal of what
has been told. The dangerous infidels bypass dialectics.
It is the sceptic who assassinates the lie.
Whenever its name has been anything but a jest,
philosophy has been haunted by a subterranean question:
What if knowledge were a means to deepen unknowing?
206
SHAMANIC NIETZSC H E
It is this thought alone that has differentiated it from
the shallow things of the earth. Yet the glory and also
the indignity of philosophy is to have sought the end of
knowing, and no more.
Once blatant sophisms are exempted, the fact that
scepticism has never been enacted is the sole argument
of the dogmatists, and it is a powerful one, despite its
empirical flavour. There can be little doubt that the philo
sophical advocates of disbelief have tended to exploit the
very conventions they profess to despise as the shelter
for an insincere madness. As was the case with Socrates,
philosophy has sought to peel itself away from sophism
by admitting to its ignorance, as if unknowing were a
pathos to be confessed. Profound ecsanity ['Ecsane' - out
of one's mind] alone is effective scepticism, in comparison
to which sceptical philosophies fall prey to naive theories
of belief, as if belief could simply be discarded, or with
held. We know nothing of course, but we do not remotely
Shamanic Nietzsche and the Unknown
- Belief is described as a prison rather than a possession, where intellectual denial of knowledge fails to provide a true escape from the 'dungeon' of conviction.
- The text identifies dangerous skeptics as nomadic explorers who serve as invasion routes for the unknown, bringing a 'contagious madness' from beyond settled knowledge.
- The concept of 'thingness' is presented as a human invention, suggesting that the world of phenomena is merely a logicized adaptation we feel to be real for the sake of calculation.
- Bataille’s interpretation of Nietzsche shifts from secular reason toward shamanic religion, focusing on 'ulterior zones' and vectors of becoming rather than philosophical concepts.
- The 'thing-in-itself' is rejected not for being materialist, but for being an ideal form of matter that falsely proposes a quarantined, integral truth.
- True escape is found not through thinking or industrial logic, but through a shamanic voyage into a 'universe without images' and acategorial base matter.
The refusal to accept a dungeon is no substitute for a hole in the wall. Only in a voyage to the unknown is there real escape from conviction.
know even this, and mere assertion in no way ameliorates
our destitution. Belief is not a possession but a prison,
and we continue to believe in achieved knowledge even
after denying it with intellectual comprehensiveness. The
refusal to accept a dungeon is no substitute for a hole in
the wall. Only in a voyage to the unknown is there real
escape from conviction.
207
FANGED NOU MENA
The dangerous sceptics are those Kant fears, 'a species
of nomads, despising all settled modes of life'2 who
come from a wilderness tract beyond knowledge . They
are explorers, which is also to say: invasion routes of the
unknown . It is by way of these inhumanists that the vast
abrupt of shamanic zero -the EJtOXtl of the ancients -
infiltrates its contagious madness onto the earth.
EnoXtl is a word attributed to Pyrrho by way of indi
rect reportage , but in its absence the philosopher's name
would lose what slight sense invests it. Although it might
be argued that we owe EnoXtl to Pyrrho, it is from EnoXll
that the name Pyrrho comes to us, as a cryptograph of
the unknown. Even were it not for Pyrrho's silence - a
silence far more prqfound that the literary abstinence of
Socrates -EJtOXtl would surely not be something of which
we could straightforwardly know the truth, far less a
method, or a subjective state.
EnoX1l is a report of the abrupt, and an escape.
1. [ ... ]
Q. the world of 'phenomena ' is the adapted world
which we feel to be real. The 'reality' lies in the
continual recurrence of identical, familiar, related
2 I. Kant, 'The Critique of Pure Reason, tr. N. K. Smith (NY: Palgrave Macmillan: 2003),
Preface to the First Edition, 8.
208
SHAMAN IC NIETZSCHE
things in their logicized character, in the belief
that here we are able to reckon and calculate;
3. the antithesis of this phenomenal world is not
'the true world,' but the formless unformulable
world of the chaos of sensations -another kind of
phenomenal world, a kind 'unknowable' for us;
4. questions, what things 'in-themselves' may be like,
apart from our sense receptivity and the activity
of our understanding, must be rebutted with the
question: how could we know that things exist?
'Thingn ess' was first created by us. The question
is whether there could not be many other ways of
creating such an apparent world.3
How much industrialism lies buried in the notion of
thought! As if one could ever work things out. One does
not think one's way out, one gets out, and then sees (that
it wasn't one ... ).
Bataille's Nietzsche is not a locus of secular reason
but of shamanic religion; a writer who escapes philo
sophical conceptuality in the direction of ulterior zones,
and dispenses with the thing in itselfbecause it is an item
of intelligible representation with no consequence as a
3 F. Nietzsche, The Will to Power, tr. W. Kaufmann (NY: Vintage, 1968), section 569.
209
FANGED NOUMEN A
vector of becoming (of travel). Shamanism defies the
transcendence of death, opening the tracts of 'voyages of
discovery never reported'.4 Against the grain of shallow
phenomenal ism that characterizes Nietzsche readings,
Bataille pursues the fissure of abysmal scepticism, which
passes out of the KantianNoumenon (or intelligible object)
through Kant and Schopenhauer's thing in itself (strip
ping away a layer of residual Platonism) , and onwards
in the direction of acategorial, epochal, or base matter
that connects with Rimbaud's 'invisible splendour s':5 the
immense deathscap es of a 'universe without images'. (; Mat
ter cannot be allotted a category without being retrieved
for ideality, and the Nietzschean problem with the Ding
an Sich was not its supposed dogmatic materialism, but
rather that it proposed 'an ideal form of matter',7 as the
transcendent (quarantined) site of integral truth, a 'real
world'. There are no things-in-themselves h�c.allse there
are no things: 'thingness has only been invented by us
Nietzsche and the Fanged Poet
- The concept of the 'Thing in Itself' is critiqued as a linguistic artifact and a cultural glitch designed to hide a supreme being.
- Materialism is redefined not as a static doctrine, but as an 'Alpine break-out' and an obstinate negation of idealism.
- Nietzsche is presented as a 'fanged poet' who seeks to make life more problematic rather than offering rationalist extrication from the labyrinth.
- Complicating thought serves as a tool of delirium to resist the reactive forces that seek resolution, conclusion, and the 'will to truth'.
- Philosophy is accused of being a 'lazy thought' that seeks to negate problems and retire into the stillness of moral dogma.
- The death of God is celebrated as the opening of a dangerous, uncharted sea that permits the 'free spirit' to venture into the unknown.
This is Nietzsche as a fanged poet at war with the philosophers (with the new priests), a thinker who seeks to make life more problematic.
owing to the requirements of logic'8 (which ultimately
revert to those of grammar). The Ding an Sich is a concept
tailored for a God (supreme being) desperately seeking
to hide itself: a cultural glitch turned nasty, but on the
4 A. Rimbaud, Collected Poems, tr. O. Bernard (Harmondsworth: Penguin, 1986), 327.
5 Ibid., 296.
6 Ibid., 293.
7 Bataille, Oeuvres Comptetes, vol. I, 179.
S Nietzsche, The Will to Power, section 558.
210
SHAMAN IC NIETZSCHE
run at last. 'Root of the idea of substance in language ,
not in beings outside US'! 9
The antithesis of the apparent world and the true
world is reduced to the antithesis 'world' and
'nothing'.10
Materialism is not a doctrine but an expedition, an Alpine
break-out from socially policed conviction. It 'is before
anything else the obstinate negation of idealism, which
is to say of the very basis of all philosophy'.l1 Exploring
acategorial matter navigates thought as chance and mat
ter as turbulence 'beyond all regulation' .12 It yields no
propositions to judge, but only paths to explore.
This is Nietzsche as a fanged poet at war with the
philosophers (with the new priests), a thinker who seeks
to make life more problematic. Bataille locks onto a desire
that resonates with the reality that confounds us, and
not with a 'rationality' that would extricate us from the
labyrinth. Nietzsche is the great exemplar of complicating
thought, exploiting knowledge in the interest of interro
gations (and this is not in order to clarify and focus, but
to subtilize and dissociate them). Complicating thought
9 Ibid., section 562.
\0 Ibid., section 567.
11 Bataillc, Oeuvres Completes, vol. I, 220.
12 Ibid., vol. VI, 97.
211
FANGED NOUMEN A
strengthens the impetus of an active or energetic confusion
-delirium -against the reactive forces whose obsessive
tcndency is to resolve or conclude. Rebelling against the
fundamental drift of philosophic al reasoning, it sides with
thought against knowledge, against the tranquillizing
prescriptions of the 'will to truth'.
If Nietzsche is locked in an extraordinarily furious
struggle with philosophy it is because it is philosophy
that has claimed, with the most cynical explicitness,
to negate problems. Philosophy has always wanted to
retire; Schopenhauer is simply its most honest exemplar.
The 'absolute' is humanity's laziest though t. Nor does it
suffice to argue that thought can be complicated within
itself, or -as the philosophers have said for some time -
'immanentl y', for we know where this path of thinking
leads. An intellection in need of immanent critique is one
that is already nudging against an ultimate solubility. 'The
intellect finds its limits within itself' -it does not even
need to move to consummate interrogation! It is thinking
such as this, whose most eminent model is the Kant of
the critical philosophy, that generated such distrust in
Nietzsche for writers who work sitting down.
Wisdom (sophia) substitutes for travelling, �lOllow
ing it out into a Baudelairean caricature of the Voy
age -redundantly reiterating a moral dogma -and
to love it is to seek to be still. In obedience to narco
Platonic Eros, philosophy defers to the end of desire.
212
SHAMAN IC NIETZSCHE
Nietzsche reaches back beyond this Hellenic priest
philosophizing, and forward beyond its modern limit,
reassembling sophia as escape:
Indeed, we philosophers and 'free spirits' feel, when
we hear the news that 'the old god is dead,' as if a new
dawn shone on us; our heart overflows with gratitude,
amazement, premonitions, expectations. At long last
the horizon appears free to us again, even if it should
not be bright; at long last our ships may venture out
again, venture out to face any danger; all the daring
of the lover of knowledge is permitted again; the sea,
our sea, lies open again; perhaps there has never yet
been such an 'open sea'.13
The Sacred Zero
- The death of God is framed not as a loss but as an opening toward 'chance,' a direction that allows for the exploration of death and the forbidden.
- Bataille argues that monotheism acts as a suppressor of the sacred, where the unity of God serves as a 'tombstone' for a more primal, chaotic religious experience.
- The text suggests that existence is inherently defiling, making the concept of an eternal, unchanging God a form of 'degrading torture' or 'secular destitution.'
- True divinity is linked to self-annihilation and nihilism, where God can only redeem the universe by burning creation to ash and ceasing to exist.
- Bataille seeks to decouple religion from theism, returning the sacred to a state of 'shamanic impiety' that acknowledges the infernal nature of the abyss.
- Poetry is redefined as an 'invasion' and a 'trajectory of incineration' rather than a mere form of human expression.
In the end poetry is invasion and not expression, a trajectory of incineration; either strung-up in the cobwebs of Paradise, or strung-out into the shadow-torrents of hell.
The death of God is an opportunity, a chance. It makes
sense to ask what is meant by the word 'noumenon', but
'chance' does not function in this way, since it is not a
concept to be apprehended, but a direction in which to
go. 'To the one who grasps what chance is, how insipid
the idea of God appears, and suspicious, and wing
clipping' ! 14 Monotheism is the great gate-keeper, and
where it ends the exploration of death begins_ If there
are places to which we are forbidden to go, it is because
13
F. Nietzsche, The Gay Science, tc. W. Kaufmann (NY: Vintage, 1974), section 343.
14
Bataille, Oeuvres Completes, vol. VI} 116.
2 1 3
FAN G E D N O U M E NA
they can in truth be reached, or because they can reach
us. In the end poetry is invasion and not expression, a
trajectory of incineration; either strung-up in the cob
webs of Paradise, or strung-out into the shadow-torrents
of hell. It is a route out of creation, which is to each
their fate interpreted as enigma, as lure. 'Now a hard, an
inexorable voyage commences - a quest into the great
est possible distance' .15 'I said good-bye to the world'.16
Even the most angelic curiosity - when multiplied to the
power of eternity - must find its way to end in the abyss.
It can seem at times as if Bataille owes almost eve
rything to Christianity; his understanding of the evil at
the heart of erotic love, the hysterical affectivity of his
writing, along with its excremental obsession, its epilep
toid conception of delight, its malignancy, the perpetual
stench of the gutter. Yes, this is all very Christian; well
attuned to a doctrine gf'!'ltated in the sewers of LIte empire.
Yet from out of the aberrant intensity and disorder of
Bataille's writings an impossible proposition is perpetually
reiterated: that far from being the acme of religion - let
alone its telic blossoming - God is the principle of its
suppression. The unity of theas is the tombstone of sacred
zero, the crumbling granitic foundation of secular desti
tution. This is so exorbitantly true that the existence of
15
Ibid., 29.
16
Rimbaud, Collected Poems, 330.
2 1 4
SHAMANIC NIETZSCHE
God would be an even greater disaster for him than for
us. How infinitely trivial the crucifixion of Jesus appears
beside the degrading torture of being God, after all,
existence is so indistinguishable from defilement that
one turns pale at the very thought of an eternal being's
smell. Perhaps this is why God 'is profoundly atheistic' , 17
leading Bataille to remark that '[w]hilst I am God, I
deny him to the depths of negation'18 (,nihilism ... might
be a divine way of thinking',19 Nietzsche anticipates) .
God can only redeem the universe from its servility by
burning his creation into ash and annihilating himself.
Such is the 'God of blinding sun, ... this God of death
that I sought'. 20 Bataille invokes the dark undertow of a
self-butchering divinity: 'God of despair, give me ... your
heart . .. which no longer tolerates that you exist'.21 (If
God is an explorer, then there is no God.)
Bataille's texts are 'a hecatomb of words without gods
or reason to be',22 led back down through the crypts of
the West by a furious impulse to dissociate theism and
religion, and thus to return the sacred to its shamanic
impiety, except that nothing can ever simply return, and
17
Rataille, Oeuvres Completes, vol. V, 121.
18 Ibid" 152.
19 Nietzsche, '!he Will to Power, section 15.
20 BataiIle, Oeuvres ComplCtes, vol. IV, 203.
21 Ibid., vol. v, 59.
22 Ibid., 220.
21 5
FANGED NOUMENA
Hell will never be an innocent underworld again. The
depths have become infernal, really so, quite irrespective
of the fairy tales we are still told. '[F]lames surround us /
the abyss opens beneath our feet'23 reports Bataille from
the brink of the impossible, 'an abyss that does not end
in the satiate contemplation of an absence'24 because its
lip is the charred ruin of even the most sublimed subjec
Damnation and Eternal Recurrence
- True exploration beyond the ruins of monotheism requires drawing resources from damnation rather than moral transgression.
- The death of God is framed as a religious event and an experiment in anti-theistic warfare rather than a simple criminal act.
- Death is described as a labyrinthine communication with zero or the sacred, where the lack of realized discontinuity means there is no individual 'one' who dies.
- Bataille suggests that the eternal recurrence 'immotivates' the instant, stripping life of teleological ends and ruining it through a desert of senselessness.
- Nietzsche’s eternal recurrence serves as a 'hammer' or weapon to intervene against the Christian tendency to preserve and recuperate decline.
I suffer from not burning ... approaching so close to death that I respire it like the breath of a lover.
tivity. 'I have nothing to do in this world', he writes, '[i]f
not to burn'.25 ' I suffer from not burning ... approach
ing so close to death that I respire it like the breath of a
lover'.26 It is not only due to the inquisition that all the
great voyagers have for a long time been singed. For well
over a century all who have wanted to see have seen: no
profound exploration can be launched from the ruins of
monotheism unless it draws its resources from damnation.
The death of God is a religious event - a transgres
sion, experiment in damnation, and stroke of anti theistic
warfare - but this is not to say it is pre-eminently a crime.
Hell has no interest in our debauched moral currency.
To confuse reactive dabblings in sin with expeditions
in damnation is Christian superficiality; the Dantean
error of imagining that one could earn oneself an excur
sion in Hell, as if the infernal too was a matter of justice.
23 Ibid., vol. III, 95.
24 Ibid., vol. V, 199.
25
Ibid., vol. IV,17.
06 Ibid., vol. V, 246.
21 6
SHAMANIC NIETZSCHE
Our crimes are mere stumblings on the path to ruin, just
as every projected Hell on Earth is a strict exemplar of
idolatry. Transgression is not criminal action, but tragic
fate; the intersection of an economically programmed
apocalypse with the religious antihistory of poetry. It is
the inevitable occurrence of impossibility, which is not
the same as death, but neither is it essentially different.
This ambivalence responds to that of death 'itself',
which is not ontological but labyrinthine: a relapse of
composition that is absolute to discontinuity, yet is noth
ing at the level of immanence. The very individuality that
would condition the possibility of a proprietary death
could only be achieved if death were impossible. One
dies because discontinuity is never realized, but this
means that there is never 'one' who dies. Instead there is
an unthinkable communication with zero, immanence,
or the sacred. 'There is no feeling that throws one into
exuberance with greater force than that of nothingness.
But exuberance is not at all annihilation; it is the surpass
ing of the shattered attitude, it is transgression' Y
The question of the mere 'truth' of Christianity -
whether in regard of its origin, not to speak of Chris·
tian astronomy and natural science - is a matter of
27 Ibid., vol. X, 72.
217
FANGED N O U M ENA
secondary importance as long as the question of the
value of Christian morality is not considered.23
What if eternal recurrence were not a belief? ('The most
extreme form of nihilism would be the view that every
belief . .. is necessarily false because there simply is no true
world'. )29 Bataille suggests:
The return immotivates the instant, freeing life from an
end and in this ruining it straight away. The return is
.,. the desert of one for whom each instant henceforth
finds itself immotivated.30
Christianity - the exemplary moral 'religion' - 'substituted
slow suicide'3! and representation (belief) for shamanic
contact with zero-interruption, but with the (re-)emer
genee of nihilisitic recurrence, caution, prudence, every
kind of 'concern for time to come'32 is restored to the
senselessness of cosmic 'noise'. With recurrence comes a
'future, [which is] not the prolongation of myself across
time, but the expiry of a being going further, passing
28 Nietzsche, The Will to Power, section 251.
29 Ibid., section 15.
30
B at aille, Oeu.vres Completes, vol. VI , 23.
31
N ietzsche, The Will to Power, section 247.
32
B at aille, Oeuvres Completes, vol. VI , 50, 167.
218
S HA M AN I C N I E TZS C H E
attained limits'. 33 A religious crisis can no longer be
deferred.
In the final phase of Nietzsche's intellectual life the
eternal recurrence is grasped as a weapon, a 'hammer,' the
transmission element between diagnosis and intervention.
Where Christendom recuperates decline to preservation,
deflecting it from its intensive plummet to zero, eternal
Nietzschean Recurrence and Nihilism
- The concept of eternal recurrence acts as a 'selection' mechanism that separates preservative values from the abyssal prospect of death.
- Christianity is critiqued as a protective device for the 'ill-constituted,' preventing the leap into nothingness through a morality of comfort.
- The 'underprivileged' are defined physiologically as the unhealthiest kind who experience the eternal recurrence as a curse that drives them to extinguish everything.
- Sickness is viewed not as a precursor to death in a linear timeline, but as an atemporal opening that eludes progressive history.
- The text characterizes philosophy as a 'ghoul' that haunts ruins, suggesting that the true exploration of sickness and exhaustion has only just begun.
- Eternal recurrence is presented as a paradoxical form of extermination that humanity clings to with infantile desperation.
Philosophy is a ghoul that haunts only ruins, and the broken croaks of our hymns to sickness have scarcely begun.
recurrence re-opens its abyssal prospect, precipicing affect
onto death. This is the predominant sense of 'selection'
in Nietzsche's texts; a vertiginous extrication of zero
from the series of preservative values, cutting through
'the ambiguous and cowardly compromise of a religion
such as Christianity: more precisely, such as the church:
which, instead of encouraging death and self-destruction,
protects everything ill-constituted and sick and makes it
propagate itself'. 34
The notes assembled into section 55 of The Will to Power
deve10p this morbid tnread. Either 'existence as it is,
without meaning or aim, yet recurring inevitably without
any finale of nothingness' (a box), or 'the nothing (the
"meaningless"), eternally'. 35 The nihilism of recurrence
is ambivalent between its (Christian) historical sense as
the constrictive deceleration of zero and its cosmic (non
local) virtuality as a gateway onto death. Christendom is
3 3 Ibid., 29.
34 Nietzsche, 1he Will to Power) section .247.
35
Ibid., section 55.
21 9
FAN G E D N O U M E NA
to be attacked because it was its morality that protected
life against despair and the leap into nothing'.36
Morality guarded the underprivileged against nihil
ism . . . Supposing that the faith in this morality would
perish, then the underprivileged would no longer
have their comfort - and they would perish.37
The religious history of mankind is based upon a technics
of ill-health: dehydration, starvation, mutilation, depri
vation of sleep, a general 'self-destruction of the under
privileged: self-vivisection, poisoning, intoxication'. 38
A journey was underway which Christian preservative
moralism - generalized species cowardice - privatized,
representationalized, crushed under the transcendent
phallus, froze, obstructed, and drove elsewhere. Christian
ity is a device for trapping the sick, but recurrence melts
through the cages:
What does 'underprivileged ' mean? Above all, physi
ologically - no longer politically. The unhealthiest
kind . . . (in all classes) furnishes the soil for this
nihilism: they will experience the belief in the eternal
recurrence as a curse, struck by which one no longer
36 Ibid.
37 Ibid.
38 Ibid.
220
SHA M A N I C N I E TZSC HE
shrinks from any action; not to be extinguished but
to extinguish everything.39
To relate sickness to death as cause to effect is itself a sign
of health. Their morbid interconnection is quite different.
Sickness is not followed by death within the series of
ordered representation. It opens the gates.
Genealogy does not reduce sickness to a historical
topic, since sickness - the inability to suspend a stimu
lus - eludes mere unfolding in progressive time, tending
towards the disappearance of time in epochal interruption.
The reflex-spasm at (and by) which reactivity gropes is
the atemporal continuum beneath the crust of health.
Death is 'that which has no history' ,40 and Nietzsche's
method is syphilis. 'Only religion assures a consump
tion that destroys the proper substance of those that it
animates'Y
Philosophy is a ghoul that haunts only ruins, and the
broken croaks of our hymns to sickness have scarcely
begun. Borne by currents of deep exhaustion that flow
silent and inexorable beneath the surface perturbations
oftwitch and chatter, damned, shivering, claw-like fingers
hewn from torture and sunk into wreckage drawn with
39
Ibid.
40
F. Nietzsche, On the Genealogy if Morals, tr. W. Kaufmann, R.J Hollingdale
(NY: Vintage, 1969), Second Essay, section 13.
41
Bataille, Oeuvres Comptetes, vol. VII, 316.
2 2 1
FAN G E D N O U M E NA
unbearable slowness down into the maw of flame and
snuffed blackness twisted skewerish into fever-hollowed
eyes. Eternal recurrence is our extermination, and we
cling to it as infants to their mother's breasts.
'Poetry leads from the known to the unknown'
writes BataiIle,42 in words that resonate with Rim
baud. Poetry is fluent silence, the only venture of
The Visionary Descent into Hell
- Writing at the edge of the impossible constitutes a transgression against discursive order and an incitement to the unspeakable.
- Rimbaud’s visionary status is achieved through a rational deregulation of the senses, resulting in ineffable torture and enormous suffering.
- True communication is described as a base, transgressive act that risks the utter degradation and dissolution of the individual ego.
- The ego emerges as a flight from this unholy community, leading to a state of isolated autonomy characterized by terminal ennui.
- Ennui is identified as the core affect of personal individuality and the 'distillate' of all action and self-mastery.
- The visionary path leads through delirium and tropical fevers toward a space of comprehensive ruin and 'inexistence in forever'.
Our nerves squeal when they are re-strung upon the phylogenetically unanticipated, 'experiences strike too deeply; memory becomes a festering wound': a descent into the inferno.
writing to touch upon the sacred (=0), because
'the unknown . . . is not distinguished from nothing
ness by anything that discourse can announce'. 43
To write the edge of the impossible is a transgression
against discursive order, and an incitement to the
unspeakable: 'poetry is immoral'.44
Rimbaud writes from the other side of Zarathustrean
descent/death [Untergang], anticipating the labyrinthine
spaces of a Nietzsche for the sick, and of what escapes
from/due to the cultural convulsion Nietzsche reinforces.
'The poet makes himself a visionary by a long, immense
and rational deregulation qf all the senses', 45 and this deregu-
1ation is a source of '[iJneffable torture' ,46 'the sufferings
are enormous'47 Rimbaud insists. No organism is adapted
42
Ibid., vol. V, '57.
43
Ibid., '33·
44 Ibid., 212.
45
Rimbaud, Collected Poems, 10.
46
Ibid., n.
47 Ibid., 6.
2 2 2
SHAMANIC NIETZSCHE
to 'arrive at the unknown' ,48 which makes deregulation as
necessary as it makes pain inevitable. Our nerves squeal
when they are re-strung upon the phylogenetically unan
ticipated, 'experiences strike too deeply; memory becomes
a festering wound':49 a descent into the inferno. Nuit de
l'enfer, where the entrails of nature dissolve meanderous
into lava, 'this is hell, eternal pain', 50 and Rimbaud burns,
'as is necessary'. 51
Yes, the poet must be a visionary. The East knows a
true lucidity, but to be an inheritor of the West is to hack
through jungles of indiscipline, devoured by vile ants and
words unstrung from sense, until the dripping foliage of
delirium opens out onto a space of comprehensive ruin.
This has never been understood, nor can it be. The foulness
of our fate only deepens with the centuries, as the tracts
of insanity sprawl. From bodies gnawed by tropical fevers
we swim out through collapse to inexistence in forever,
destined for Undo.
True poetry is hideous, because it is base communica
tion, in contrast to pseudo-communicative discourse,
which presupposes the isolation of the terms it unites.
Communication - in the transgressive non-sense BatailIe
lends it - is both an utter risk and an unfathomable
48 Ibid.
49
Nietzsche, Ecce Homo, 230.
50
Rimbaud, Collected Poems, 3'3.
51
Ibid.
223
FANGED NOUMENA
degradation, associated with repellent affect. The ego
emerges in the flight from communicative immanence,
from deep or unholy community, initiating a history
that leads to the bitter truth of the desertification of the
isolated being. From the anxiety of base contact, which
it can only experience as dissolution, the ego stumbles
into the ennui of autonomy, the antechamber to a harsh
despair, whose horror is accentuated by the fact that it
arises at the point where escape has exhausted itself,
where the ego has quarantined itself to the limit of its
being against extraneous misfortune. Ennui is not any
sort of response to the compromising of the ego from
without, it is not an impurity or a contamination (the
negation of such things are for it a condition of exist
ence), but rather, it is the very truth of achieved being;
the core affect of personal individuality. Ennui cannot be
mastered, surpassed, resolved, auJgehoben, because it is
nothing but the distillate of such operations, indeed, of
action as such. Ennui is insinuated into the very fabric
of project, as 'the necessity of leaving oneself'. 52 If the
soil of Bataille's writing is volcanic it is not only due to
the sporadic convulsions of a devastating incandescence,
but also because its fertility is anticipated by a monstrous
sterilization. Beneath and before the luxuriant jungles
of delirium is the endless crushing ash-plain of despair.
52
Bataille, Oeuvre, Completes, vol. V, '37.
224
SHAMANIC NIETZSCHE
' I believe that I am in hell, therefore I am there'.53 Blake
might have written such words, although their sense would
then have been quite different. Drooled from Rimbaud's
Subterranean Belief and Infernal Contagion
- The text describes a 'geological crisis of justification' where truth is no longer a right but a decree issued by masters.
- Belief is reframed as a tool for adaptation and camouflage rather than a sincere commitment or idealistic loyalty.
- The 'inferior race' utilizes mendacity, sloth, and mimicry to evade the 'panoptic apparatuses' of the dominant culture.
- Hell is presented not as a hidden truth, but as a subterranean space of wandering, theft, and the absence of property.
- Poetry and infernal discourse act as a 'magmic flux' or plague-vector that infects and collapses established structures from within.
- The ultimate state is one of zero-conclusion, moving without a plan into a vast, shining, and monstrous open sea.
When draped about the inferiors beliefs are not loyalties, but rather sun-blocks against inquisition.
pen they point less to a potency of imagination than to
a geological crisis of justification, approaching a perfect
epistemological irresponsibility. It is not for us to defend
the rights of truth, truth is decreed by the masters. What
matters is to adapt, nursing the meagre resources of our
reactivity, of our base cunning. ' Belief' - the cloak of
confession - is too precious a resource to be squandered on
the zealotry of idealism. What value is there to be extracted
from a committed belief, from a last-ditch belief? Such
things are for the strong (or for dupes), for the allies and
slaves of light, for all those who do not rely on the subter
ranean passages beneath belief to avoid the panoptic appa
ratuses. Adaptability can only be lamed by commitments.
We have seen enough true Christians: rabbits transfixed
by headlights. When draped about the inferiors beliefs
are not loyalties, but rather sun-blocks against inquisition.
We creatures of shadow are hidden from their enlighten
ment. We believe exactly what they want.
The inferior race 'await God with greed' ,54 scavenging
at Christ 'like wolves at an animal they have not killed'. 55
Creation, testamental genealogy, the passion of Christ ...
53 Rimbaud, Collected Poems, 313.
54 Ibid., 304.
55 Ibid., 302.
225
FANGED NOUMENA
none of it is their story, nor is any other, for they are too
indolent to have a story of their own, only theft and lies
are 'proper' to them: 'piliage'.5G Rimbaud's inheritance,
'above all', consists of 'mendacity and sloth' Y 'I have
never been a Christian; I am of the race which sung
under torture'58 he remarks. It is precisely obliviousness
to Christianity, to fidelity or duty, to privileged narratives,
that eases the inferior race into singing the praises of the
Nazarene. The white man has guns, therifore the truth.
'The whites disembark. The cannon! It is necessary to
submit to baptism, dress oneself, work' .59
In contrast to the pompous declarations of the ortho
doxies, which come from on high (like a stroke of the
whip), an infernal message is subterranean, a whisper
from the nether-regions of discourse, since 'hell is certainly
below'.60 Just as the underworld is not a hidden world
- a real or true [Wahre Welt] - but is that hicirlt-n by all
worlds, so is the crypt-mutter from hell something other
than an inverted scene, concept, or belief. In their infernal
lineaments words are passages, leading into and through
lost mazes, and not edifications. Acquisition is impos
sible in hell. There is nothing en bas except wandering
56 Ibid.
57
Ibid., 301.
58
Ibid., 307-8.
59
Ibid., 309.
60
Ibid., 315.
226
S HA M A N I C N I E TZS C H E
amongst emergences, and what is available has always
come strangely, without belonging. Infernal low-life has
no understanding for property. Even the thoughts of the
inferior ones are camouflage and dissimulation, their
beliefs mere chameleon dapplings of the skin.
Poetry does not strut logically amongst convictions,
it seeps through crevices; a magmic flux resuscitated
amongst vermin. If it was not that the Great Ideas had
basements, fissures, and vacuoles, poetry would never
infest them. Faiths rise and fall, but the rats persist.
Rimbaud's saison en enjer pulsates through a discourse
without integrity. Teaching nothing, it infects. Like matter
cooked-through with pestilential 'contagions of energy' ,61
it collapses into a swarm of plague-vectors. Substance is
only its host. '[WJords, books, monuments, symbols, and
laughters are nothing but the paths of this contagion, its
passages'
.62
I never could conclude anything ...
Zero does that.
Towards New Seas
That way is my will; I trust
In my mind and in my grip.
61 Bataillc, Oeuvres Completes, vol. V, 111.
62 Ibid.
227
FANGED N O U M ENA
Without plan, into the vast
Open sea I head my ship.
All is shining, new and newer,
Upon space and time sleeps noon;
Only your eye - monstrously,
The Juridico-Philosophical Complex
- Philosophy has historically defined its vocation by mimicking the judicial process, positioning itself as a supreme tribunal for evaluating reality.
- Logic itself is described as a distillation of juridical procedure, functioning as the abstract inclusion or exclusion of cases under general laws.
- The traditional Western reliance on transcendent legitimation—rooted in Plato, Aristotle, and Christian logos—is currently collapsing toward immanence.
- Modern marketization and cybernetic automation represent an accelerated phase where impersonal efficiency replaces traditional geopolitical authority.
- Georges Bataille serves as a pivotal figure who moves beyond juridical procedures toward a 'tactics of recoding' that operates outside human history.
- The attempt to restore a human-managed, teleological history is viewed as an incredible modernist aspiration, reducing philosophy to a form of entertainment or a jest.
Logic has never been anything other than the distillation of juridical procedure, the abstract form of inclusion or non-inclusion of a case under a law (species under genus), which has been predominantly thematised as judgment.
Stares at me, infinity.63
63 Nietzsche, The Gay Science, section 371.
228
After the Law
There are peculiar difficulties associated with any phi
losophy of law, due in large part to the inevitability that
any attempt at a transcendent evaluation of law finds
itself enacting a parody of judicial process. Ever since
the trial of Socrates (if not already with the fragment
of Anaximander), philosophy has affirmed its vocation
only insofar as it has fantasised a supreme tribunal: an
ultimate court of appeal or ideal form of justice. The
vindication of Socratism is inextricable from a retrial,
both exculpation and counterlitigation, the forum of
which remains the unstable issue of metaphysics. As for its
'own' or 'inner' law, logic has never been anything other
than the distillation of juridical procedure, the abstract
form of inclusion or non-inclusion of a case under a law
(species under genus), which has been predominantly
229
FANGED NOUM ENA
thematised as judgment, although a language of proposi
tions has more recently risen to prominence. Philosophy
and judicial authority find themselves bound together in
a discourse upon real legitimation. Appearances (cases)
are to be judged from the perspective of a generic reason
at a superior level of reality identified in the premoder n
period with an ideality whose final term is the intellect of
God. Aristotle consummates a categorial -accusatory -
sense of form, and the Augustinian collision of Platonism
with Judaeo-Christian eschatology and Christian logos has
only entrenched this complicity.
This chapter cuts into two episodes or intersections
of the occidental juridico-philosophical complex, in an
attempt to dramatise the broadest tendency of this proc
ess: that of collapse towards immanence, or evaporation
of the transcendent. There is nothing peculiarly occult or
mysterious about such a tendency sinc� it finds its most
highly accelerated phase in our contemporary marketisa
tion of social transactions: the phased transition from
traditional Geopolitical authorization or legitimacy to
an impersonal, cybernetically automated dficiency. The
commodity 'form' is a transmutational matrix, and not a
static (synchronic) order of economic liberalism . Insofar
as capital is still interpreted Platonically -according
to legitimation criteria -there is an overt paradox or
contradiction emergent in this process, a paradox whose
disappearance is epitomized by the figure of Georges
230
AFTER THE LAW
Bataille, who offers an operational description of law.
Bataille no longer offers a juridical procedure of any kind,
but only a tactics of recoding that converges upon the
outside of human history (where everything functions
without respect or legitimacy).
Those seeking to defend the human management of
social processes (where 'man' speculatively unites with
the God of anthropomorphic monotheism) can have no
project but to restore a history whose ideal sense would
reconnect with the meaningrj'the West, such as those prof
fered by Plato, Aquinas and Hegel. Such restoration is a
modernist aspiration which strikes me as incredible. To
drag Plato and Bataille before the tribunal of philoso
phy has ceased to be anything but entertainment, yet I
dedicate this text to the few remaining political animals
of the planet Earth, as an experiment in the tenacity of
philosophy, or as a jest.
PLATO AND THE TRIAL OF SOCRATES
Plato's Apolog;y is initiated by submission to the political,
in which civic obedience and justificatory discourse are
fused. Rebellion is not Socratic, and the principle of
authority -or right to judge -is never radically inter
rogated; only its source is in question. In attempting to
contest the charge that he 'makes the weaker argument
231
FANGED NOUMENA
defeat the stronger',1 it is not long before Socrates invokes
the 'unimpeachable authority '2 of Apollo, and narrates
The Oracular Edge of Wisdom
- The Delphic oracle's claim that no one is wiser than Socrates creates a fracture between sacred inspiration and profane philosophical inquiry.
- Socrates interprets the oracle not as evidence of his knowledge, but as a problem requiring exegetical translation and a 'privilege of the unknown'.
- The 'daimon' or inner voice of Socrates acts as a supernatural interference that functions primarily through dissuasion and hesitation.
- Socrates distinguishes his path of wisdom from the 'intoxication' of poets and seers who deliver sublime messages without understanding their meaning.
- The text questions the paradox of Socrates' dogmatic assertions about God's wisdom while simultaneously claiming human wisdom has no value.
- The transition from inspiration to wisdom is framed as a 'preparation for death,' where the unknown is recuperated into the order of judgment.
It is precisely the resistance to evidentiality that lends to this message its oracular force, and the paradoxical gesture at the heart of Socrates' defence is that of deploying the privilege of the unknown on behalf of knowing.
the journey of his disciple Chaerephon:
One day he actually went to Delphi and asked this
question of the god - as I said before, gentlemen,
please do not interrupt - he asked whether there was
anyone wiser than myself. The priestess replied that
there was no one.3
To interpret this statement as a submission of evidence
would be to efface the fracture line between the sacred
and the profane across which Socrates steps. It is precisely
the resistance to evidentiality that lends to this message
its oracular force, and the paradoxical gesture at the heart
of Socrates' defence is that of deploying the privilege of
the unknown on behalf of knowing.
The mystery of the oracular message is registered
within the order of judgment as an underinterpretation.
The priestess's words require translation, beyond that of
their reworking into verse that occurs at Delphi itself.
They pose a problem that can be construed as exegetical,
as an insufficiency of commentary and resolution. Words
are oracular precisely insofar as they suspend intelligence,
Plato, 1heLast Daystj'Socrates, tr. H. Tredennick (Harmondsworth: Penguin, 1969), 47.
2
Ibid., 49.
3
Ibid, 49·
232
AFTER THE LAW
whether in the sacred abandonment to unknowing which
is their source, or in the profane detour of philosophy
that becomes their destination. Socrates' discourse is the
site of a crossing from inspiration to anticipated wisdom.
It is not only words of the Delphic oracle that are at
stake here, since they resonate with the more intimate
counsel of Socrates' ba(/Jffiv or 'spirit'. Later in the Apol
ogy, we are told by Socrates that:
I am subject to a divine or supernatural experience,
which Meletus saw fit to travesty in his indictment.
It began in my early childhood - a sort of voice
which comes to me; and when it comes it always
dissuades me from what I am proposing to do, and
never urges me on.4
The interference between the sacred and the profane, the
unknown and knowing, is in its sacred sense a gateway
opening onto death, and in its profane sense a hesitation:
interruption as the edge of time or as a delay within time,
death as the outside or as the deferred, the threshold of
death as a brink or as a moment. Later in the Apology,
Socrates reports that ' I am now at that point where the
gift of prophecy comes most readily to me: at the point
4
Ibid., 64.
233
FANGED NOUMENA
of death'. 5 This remark connects strangely with the earlier
comment that
I soon made up my mind about the poets too: I
decided that it was not wisdom that enabled them to
wri te their poetry, bu t a kind of instinct or inspiration,
such as you find in seers and prophets who deliver
all their sublime messages without knowing in the
least what they mean.6
Poets and prophets explore the zero-degree of judgment, a
zone at the edge of the great zero that Socrates tentatively
sketches, but only rarely approaches. His own sense of
'preparation for death' is the path of wisdom rather than
intoxication, aligning himself with a knowing that is com
pared to its inadequate instances, rather than succumbing
to the unknowing he.yond comparison beside which all
knowing is inadequate. Comparing himself to his fellows,
Socrates elaborates the oracle as suggesting that 'I am
wiser . . . to this small extent, that I do not think I know
what I do not know'. 7 This is the edge of the unknown,
but always there is the gesture of recuperation to know
ing, to judgment, to the tribunal, justice and authority:
'real wisdom is the property of God, and this oracle is
Ibid., 73-
6
Ibid., 51.
Ibid., 50.
234
AFTER THE LAW
his way of telling us that human wisdom has little or no
value'.8 If human wisdom has little or no value, where do
the dogmatic assertions about God and his wisdom stem
from? Why should they be trusted? Is not the figure of
God indistinguishable from the claim that we know it is
knowledge that matters, that the unknown is something
Socrates and the Judicial Turn
- The author argues that Socrates represents the moment philosophy surrendered to the logic of the courtroom and the order of human judgment.
- Unlike the Presocratics who ignored popular opinion, Socratic dialectic is presented as a plebeian shift toward justificatory and political logic.
- Plato's philosophy is framed as an obsessive retrial of Socrates, creating a nesting of judgments that subsumes the city of Athens under a higher taxonomy.
- The concept of the 'category' is traced back to its etymological roots as an 'accuser,' linking logical classification directly to juridical prosecution.
- Death is reinterpreted not as a punishment but as a boundary that isolates sensible existence from the total field of intelligibility.
It is in crossing this judicial threshold that philosophy comes to delight in the voluptuousities of persecution.
we know, something we can populate with our feverish
anthropomor phisms ? Does Socrates not exhibit God
as the eclipse of religion, the surrender of knowing as
a submission to ... knowing? It is thus that religion is
buried beneath the icon of a supreme judge.
The figure of Socrates, as sketched for us by Plato
-his advocate -is that of philosophy on trial. It is in
crossing this judicial threshold that philosophy comes
to delight in the voluptuousities of persecution. Yet the
drama of Socrates' condemnation distracts from the more
far-reaching process whereby philosophy succumbs to the
order of the courtroom, and with this process Socrates is
deeply complicit . He could even be said to have forged a
new alliance between knowledge and condemnation, as
well as becoming the first philosophical case.
How could one imagine an Apology for a Heraklei
tus, an Empedokles, or a Parme nides? To whom would
they be attempt ing to justify themselves? To the people?
The thought is absurd. For what does the opinion of the
8 Ibid., 52.
235
FANGED NOUMENA
people matter? It was precisely as an escape from the opin
ion of the people that philosophy emerged! To philosophize
and to ignore popular opinion are scarcely differentiable_ If
the Presocratics speak in terms of cosmic justification -as
Anaximander already does -it is as a concession, in order
that the people will at least understand the surpassing
of human judgment, if not that by which it is surpassed.
The harsh 'justice' oHate is the ironisation of human litiga
tion, and not its inflation to the absolute (monotheism).
With Socrates, things are different. Philosophy
becomes dialectical; which is to say justificatory, political,
logical, plebeian. Truth is identified with irrefutability,
evidentiality and educated belief, beginning its long
subsidence into the forms of human credence, as if its
acceptability were in any way a criterion.
The Apology focuses a multiple interweaving of death
and judgment. There is first of all the stnst in which
death fulfils judgment in the sentence of death, even if
this is an injustice -or misjudgment -such that Athens
is condemned in the tribunal of the Platonic text, whose
judgment in this case becomes a massively influential prec
edent. There is a nesting of judgments; that of Socrates,
that of Athens and that of Plato, with each level subsuming
the antecedent one as an item or case to be judged.
Judgment is the subsumption of a case under a prin
ciple or law. It is classificatory or categorising, according
to a discursive order which is simultaneously juridical and
236
AFTER THE LAW
logical. The very word' category' is derived from the Greek
word xanlYopo� or accuser. Judgment is thus an image of
thought, and Plato' s entire philosophy can be read as an
appeal to a higher court, as an obsessive retrial, as well
as a counteraccu sation against Socrates' executioners.
The democracy which sentenced Socrates to death is
not merely vilified by Plato, it is also categorised within
a taxonomy of political forms, brought to an ulterior site
of judgment and included within an expanded system.
A second integration of judgment with death is sug
gested at this point. If Athens misjudges Socrates, it is
because it misjudges death and the death sentence, by
construing death as a punishment. Death is judged from
the perspective of a restricted arena -that of the Athenian
court and democratic polity -which is subordinate in
principle, logically and juridically, to a tribunal that
includes such an arena as a case, item or species. It is in
this way that Plato comes to interpret sensible existence
as a specification of intelligence; as a restricted forum
demarcated within the total field of intelligibility. Death
is a boundary which isolates sensible intelligence from
the general system of knowing, the species from the
genus, the case from the principle of Idea. The juridical
Socrates and the Practice of Death
- The philosopher is uniquely qualified to rule because they strive to free the soul from the body's sensible limitations.
- Socrates redefines death not as a consequence of judgment, but as the justifying condition for attaining pure knowledge.
- The soul is critiqued as a potential 'cage' that projects corporeal categories into the unknown under the guise of separation.
- True wisdom is presented as a 'recollection' that is only fully accessible once the soul is released from the contamination of the body.
- To fear death is framed as a culpable ignorance, as it assumes knowledge of an event that may be the greatest of human blessings.
The soul is the fantasy of a separation from death that persists in death, a kind of corporeal telepresence by which the body projects its servile categories into the unknown.
advantage of the philosopher - qualifying him to rule in an
ideal republic - is that he 'frees his soul from association
with the body (so far as is possible) to a greater extent
237
FANG E D NO U M E NA
than other men'. 9 Death is no longer being thought as a
consequence of judgment, but as its justifying condition.
Judgment is disqualified by its specification to sensibility
since the sensible instance or case is comprehended by the
superior generic order of the ideal, which is unrestricted
by the sensible limit of death.
In its migration through a succession of bodies, the
soul crosses and recrosses between life and death, passing
in and out of restricted spaces, although never escaping
the irreducible atom of self. One might accept Socrates'
depiction of life as the phase during which the soul is
'chained hand and foot in the body, compelled to view
reality not directly but only through its prison bars, and
wallowing in utter ignorance' ,10 and still want to insist that
the soul is a cage which is even more insidious, constrict
ing and wretched than the body. The soul is the fantasy
of a separation from rlc<1th th<1t persists in death, a kind
of corporeal telepresence by which the body projects its
servile categories into the unknown. But this is to inter
rupt Socrates' account.
The thought of knowledge as a recollection reaching
beyond birth is most fully developed in the Phaedo, where
the complicity between his conception of death and that
of an adequate tribunal is emphatic. The approximation
9
Ibid., 109.
IO
Ibid., 135.
238
AFTER THE LAW
to wisdom under the specifications of life can only be a
preparation for death, an anticipatory harmonization
with the escape from sensible existence:
If at its release the soul is pure and carries with it
no contamination of the body, because it has never
willingly associated with it in life, but has shunned
it and kept itself separate as his regular practice - in
other words, if it has pursued philosophy in the right
way and really practised how to face death easily: this
is what 'practising death' means, isn't it?l1
According to the judgment of death, by which all human
judgments are judged, only the philosopher is just, because
only he recognises the specificity of all sensible judgments,
and their subsumption within a higher genus of wisdom:
'no soul which has not practised philosophy, and is not
absolutely pure when it leaves the body, may attain to
the divine nature; that is only for the lovers of wisdom' .12
The strongest expression of this thought is probably to
be found in an earlier passage from the Phaedo:
the wisdom which we desire and upon which we
profess to have set our hearts will be attainable only
11
Ibid., 133.
12
Ibid., 135.
239
FANGED NOUMENA
when we are dead, and not in our lifetime. If no pure
knowledge is possible in the company of the body,
then either it is totally impossible to acquire knowl
edge, or it is only possible after death . . . 13
This introduces a third integration between judgment
and death, through which Socrates decides against the
sacred and in favour of the profane, because death is to
be judged. This is to say that death is only to be an issue
from the optic of knowing, from that of the philosopher
or wise judge rather than the poet or the visionary. Here
we arrive at the most mysterious and fateful twist in
Socrates' interpretation of the oracle:
to be afraid of death is only another form of thinking
that one is wise when one is not; it is to think that one
knows what on!" does not know. No one knows with
regard to death whether it is not really the greatest
blessing that can happen to a man; but people dread
it as though they were certain that it is the greatest
evil; and this ignorance, which thinks that it knows
what it does not, must surely be ignorance most
culpable. This, I take it gentlemen, is the degree, and
Socrates and the Trial of Death
- Socrates defines his wisdom as the conscious awareness of his own ignorance regarding the nature of death.
- The text argues that Socrates initiates Western history by translating the 'sacred confusion' of the unknown into a manageable epistemic uncertainty.
- Socratic irony mocks the Athenian court for its 'iconic' ignorance, as it lacks the self-awareness to realize it does not understand what it judges.
- Death is reframed not as a punishment, but as a transition to a philosophical forum where the intelligible is finally separated from the sensible.
- The passage suggests that true philosophy is a lifelong preparation for dying, turning the end of life into the destination of dialectic.
- Ultimately, Socrates is depicted as replacing human judgment with a 'higher sophistry' that binds the subject to an invisible, intelligible world.
Ordinary people seem not to realise that those who really apply themselves in the right way to philosophy are directly and of their own accord preparing themselves for dying and death.
this is the nature of my advantage over the rest of
mankind; and if I were to claim to be wiser than my
13
Ibid., 111.
240
A FT E R T H E LAW
neighbour in any respect, it would be in this: that not
possessing any real knowledge of what comes after
death, I am also conscious that I do not possess it.14
By interpreting contact with the unknown as the deferral
of judgment by the subject, translating the positivity of
sacred confusion into the negativity of epistemic uncer
tainty, Socrates initiates the proper history of the West.
The Socratic sophism runs: either one already knows
death (since it is only the cessation of life), or death is a
higher knowing. Death is either the extinction that makes
it nothing except what life knows of it, or the immortality
of the soul that preserves knowing in death as entry into
knowledge of the Ideas. If death is the unknown, it is
only insofar as we do not know that there is nothing to
know; but, were there an unknown other than as a hid
den or forgotten knowledge, it would still only be what
we already know as the end of knowing. This is Socrates'
own reading of his claim to be conscious that he does not
know: a repression of the unknown.
While ultimately retuning the problem of death to
knowing (philosophy to sophism), this passage is not
without its sceptical openings. Most importantly, it sug
gests that the conception of personal mortality is an icon
of death that must be ironised from the perspective of
14 Ibid., 60.
241
FANGED N O U M E NA
unknowing. In this way, the optic of the court is momen
tarily refused, and death prised away from its punitive
sense. Socrates mocks those who act as if 'they would be
immortal if you did not put them to death!' .15
The court is no more capable of judging death than
judging Socrates, since it is in both cases ignorant as to its
own ignorance, and therefore iconic. I t lacks even the space
of the question, having satiated itself over-hastily with an
array of pseudo-knowledge or unexamined opinions that
substitute for difficulties. As Socrates interprets things, the
Athenian court, having judged the punishment as incom
petently as the defendant, accidentally rewards an inno
cent man, rather than persecuting a guilty one. Death has
been judged badly, but Socrates does not conclude from
this that it escapes judgment; it is rather that it requires a
more appropriate tribunal: a philosophical forum open
to the perfect evidence of the intelligible, uncluttered by
the deceit and confusion of the sensible world. It is this
conjunction of philosophy with death - philosophy as
the fair trial of death which avoids precipitate condemna
tion - that completes the inversion of the Athenian trial.
It is no longer that death confirms the judgment of the
city; instead, it carries the philosophical dialectic forwards
to its destination:
15
Ibid., 68.
242
A FT E R T H E LAW
Ordinary people seem not to realise that those who
really apply themselves in the right way to philoso
phy are directly and of their own accord preparing
themselves for dying and death. If this is true, and
they have actually been looking forward to death all
their lives, it would of course be absurd to be troubled
when the thing comes for which they have so long
been preparing and looking forward.16
If Socrates is in part an ironist and an iconoclast, he is also
a zealot and a dogmatist. He disrupts one trial in order to
replace it with another, mocks human judgment in order
to replace it with divine judgment, subverts sophistry in
order to replace it with a higher sophistry, and disengages
himselffrom this world only to bind himself more tightly
to another; to 'the unseen world'17 or 'the next world' ,18 to
the realm of that which 'is invisible and hidden from our
eyes, but intelligible and comprehensible by philosophy' .19
Socratism is the mobilization of unknowing on behalf of
The Virulence of Death
- Socrates presents death as a suspension of judgment, a dialectical detour that temporarily interrupts the judicial process of reason.
- Bataille rejects Platonic transcendence, viewing law instead as a tool for the preservation of discrete, discontinuous being.
- Discontinuity is defined as a precarious distance from death, creating a space for profane accumulation and rigid utility.
- Bataille links religion to a 'solar economy' where the Earth acts as a momentary arrest of energy flow, leading to the formation of productivist civilizations.
- Systemic limits to growth inevitably result in 'jagged perforations' through civilization as solar energy resumes its ruinous trajectory.
- Expenditure and the passion for collapse are described as contagious forces that cannot be assimilated by social mechanisms.
Nothing is more infectious than the passion for collapse.
knowing; subordinating irony to dialectic, confusion to
judgments and the sacred to a subdued profanity.
16
Ibid.,107.
17
Ibid., 136.
,8 Ibid., '79.
19
Ibid., 133·
243
FAN G E D NOUM E NA
There is a sense in which Socrates already floats a fourth
- and far more corrosive - integration of judgment and
death, according to which death is the suspension of
judgment. Death is a problem that interrupts the judi
cial process, switching it into a dialectical detour which
prolongs the path before arrival at a verdict. Resisting
sensible evidentiality, death contests the conventional
procedures of its trial. Typically enough, Socrates mor
alises this issue into a farce, asking whether death is
good or evil. Nevertheless, death suspends justice in
a hesitant unknowingness, even if this is only a dialec
tical vacillation between pre-established alternatives.
For Socrates, death is recuperable to judgment, in a
movement by which it is transcended by the idea; but
this return of interruption to due process is not without
its limit.
BATAILLE AND THE TRIAL OF GILLES DE RAIS
Whereas Plato is a midwife of the profane, establishing
the intellectual coordinates of a transcendent reason
that will dominate the juridico-philosophical discourses
of post-Hellenic societies for two millennia, Bataille is
driven by a passion for (and from) the sacred to explore
the most extreme formulations of a philosophy of imma
nence. In a broadly Nietzschean fashion, he interprets law
as the imperative to the preservation of discrete being.
244
AFTER THE LAW
Far from expressing a transcendent ideality, law sum
marises conditions of existence, and shares its arbitrari
ness with the survival of the human race as sovereign
autonomy (an expression that Bataille seeks to exhibit as
an oxymoron). The word which Bataille usually employs
to mark the preserve of law is 'discontinuity', which is
broadly synonymous with 'transcendence' or the space
of judgment. Discontinuity - read immanently or genea
logically - is the condition for transcendent illusion or
ideality, and precisely for this reason it cannot be grasped
by a transcendent apparatus; by the interknitted series of
conceptions involving negation, logical distinction, sim
ple disjunction, essential difference, etc. Discontinuity is
not referred in the direction of a separated or metaphysical
realm, but in that of a precarious distance from death:
a space of profane accumulation that is juxtaposed messily
with the sacred flow into loss. Religion is thus extricated
from theology in order to be connected with an energetics
or 'solar economy', according to which the infrastructure
of discontinuity inheres in the obstructive character of
the Earth, in its mere bulk as a momentary arrest of
solar energy flow, which lends itself to hypostatisation.
When the silting-up of energy upon the surface of the
planet is interpreted by its complex consequences as
rigid utility, a productivist civilization is initiated, whose
culture involves a history of ontology and a moral order;
persistent being and judgment.
245
FAN G E D N O U M E NA
Systemic limits to growth require that the inevitable
recommencement of the solar trajectory scorches jagged
perforations through such civilisations. The resultant
ruptures cannot be securely assimilated to a metasocial
homoeostatic mechanism, because they have an immoder
ate, epidemic tendency. Bataille writes of 'the virulence
of death'. 20 Expenditure is irreducibly ruinous because
it is not merely useless but also contagious. Nothing is
more infectious than the passion for collapse.
In The Accursed Share, Bataille outlines a number of
social responses to the unsublatable wave of senseless
wastage welling up beneath human endeavour, which he
draws from a variety of cultures and epochs. These include
the potlatch of the sub-Arctic tribes, the sacrificial cult of
the Aztecs, the monastic extravagance of the Tietans, the
Sovereign Waste and Gilles de Rais
- The text contrasts the 'sumptuary consumption' of feudal and religious orders with the rationalized, bourgeois refusal of waste found in Protestantism.
- Bataille identifies Protestantism as the catalyst for a thoroughgoing rationalization of religion that propelled humanity toward both extreme affluence and catastrophe.
- Gilles de Rais is presented as a 'sacred monster' who transitioned from a valiant knight alongside Joan of Arc to a prolific murderer of children.
- The 'tragedy' of de Rais reflects the collapse of the feudal nobility's ethos, which prioritized the immediate, 'sovereign' destruction of wealth over its accumulation.
- Bataille argues that in primitive or feudal contexts, war and extravagance were forms of luxury and 'lack of measure' that served no ulterior productive purpose.
- The deritualization of transgressive outlets in modern society is linked to the 'explosions of atrocity' seen in figures like de Rais and the Marquis de Sade.
Accumulated wealth has nothing but a subordinate value, but wealth that is wasted or destroyed has, to the eyes of those who waste it, or destroy it, a sovereign value.
martial ardour of Islam, and the architectural debauch
of hegemonic Catholicism. Reform C,hristianity alone -
attuned to the emergent bourgeois order - is based upon
a relentless refusal of sumptuary consumption. It is with
Protestantism that theology accomplishes itself in the
thoroughgoing rationalization of religion, marking the
ideological triumph of the good, and propelling humanity
into unprecedented extremities of affluence and catastro
phe. It is also with Protestantism that the transgressive
outlets of society are deritualised and exposed to effective
20 G. Bataille OeuvreJ Cmnptetes, 12 Vols. (Paris: Gallimard, 1987), vol. 10, 70.
246
AFT E R T H E LAW
condemnation, a tendency which leads to the explosions
of atrocity associated with the writings of the Marquis
de Sade at the end of the eighteenth century and, almost
three centuries before that, with the life of Gilles de Rais .
Bataille describes his 1959 study o f Gilles de Rais as a
tragedy, and its subject as a 'sacred monster', who 'owed
his enduring glory to his crimes' .21 The bare facts are quite
rapidly outlined. Gilles de Rais was born towards the end
of the year 1404, inheriting the 'fortune, name and arms
of Rais'22 due to a complicated dynastic intrigue involving
his parents, Guy de Laval and Marie de Craon. Even by
the standards of his times and rank, de Rais dissipated
vast tranches of his wealth with abnormal extravagance;
in Bataille's words, 'he liquidated an immense fortune
without reckoning' .23 At the battle of Orleans, he fought
alongside Jeanne d 'Arc, 'acquiring renown as "a truly val
iant knight in arms" which survived right up to the point
of his condemnation to infamy'. 24 I t has been suggested
that the two warriors were friends but Bataille expresses
reservations about this hypothesis.25 On 30 May 1431,
Jeanne d'Arc was burnt by the English. In the years 1432-3,
de Rais began to murder children. His preferred victims
21
Ibid., 277.
22 Ibid., 345.
23
Ibid., 279.
24 Ibid., 354.
25
Ibid., 356.
247
FANG E D NOUM E NA
were males, with an average age of eleven years, there was
occasional variation in sex and considerable variation in
age.26 At least thirty-five murders are well established,
although the number was almost certainly a great deal
higher; the figures suggested at his trial ranged up to 200.
In a somewhat inelegant passage from this study,
Bataille recapitulates the (quasi-Weberian) general eco
nomic background to his researches:
We accumulate wealth in the prospect of a continual
expansion, but in societies different from ours the
prevalent principle was the contrary one of wasting
or losing wealth, of giving or destroying it. Accumu
lated wealth has nothing but a subordinate value, but
wealth that is wasted or destroyed has, to the eyes of
those who waste it, or destroy it, a sovereign value:
it serves nothing ulterior; only this wastage itself
or this fascinating destruction. Its present sense: its
wastage, or the gift that one makes of it, is its final
reason for being, and it is due to this that its sense
is not able to be put off, and must be in the instant.
But it is consumed in that instant. This can be magnifi
cent, those who know how to appreciate consumption
are dazzled, but nothing remains of it. 27
26
Ibid. 426.
27
Ibid., 321-2.
248
AFTER THE LAW
The tragedy of de Rais, which Bataille extends to the
nobility as a whole, was that of living the transition from
sumptuary to rational sociality. He was dedicated by birth
to the reckless militarism of the French aristocracy, which
Bataille summarises in the formula: 'In the same way that
the man without privilege is reduced to a worker, the one
who is privileged must wage war'. 28 He is emphatic on this
point: 'The feudal world ... is not able to be separated from
the lack of measure [demesure], which is the principle of
wars',29 and also: 'primitively war seems to be a luxury' .30
War as Sovereign Excess
- Bataille argues that the prestige of the medieval nobility was rooted in a radical waste and blood-hunger that defies utilitarian logic.
- The courtly language and 'sickly-sweet' poetry of the French aristocracy masked a primal, cynical drive for slaughter akin to German Berserkers.
- Unlike the Socratic or Hegelian view of war as a rational civic duty, Bataille views war as a 'zone of disappearance' and a passage to the unknown.
- The feudal aristocracy acted as a wound in the social body, hemorrhaging excess production and life through constant military confrontation.
- Gilles de Rais is presented as the ultimate incarnation of this feudal spirit, finding his only place in the world through 'cruel voluptuosities' and the vertigo of combat.
- The transition to centralized monarchies and disciplined technologies like archery marked the end of this era of sovereign, senseless warfare.
War exceeds judgment, since every judicial apparatus is a petrified war, just as every 'case' of war is a domestication politicised, utilitarianised, Clausewitzeanised.
That honour and prestige are incommensurable with the
calculations of utility is an insistent theme in Bataille's
work, as pertinent to the interpretation of potlatch among
the Tlingit as to the blood-hunger and extravagance of
Europe's medieval nobility. The context of Christianity
and courtly love should not mislead us here.
28
29
30
The paradox of the Middle Ages demanded that the
warrior elite did not speak the language of force and
combat. Their mode of speech was often sickly-sweet.
But we shouldn't fool ourselves: the goodwill of the
ancient French was a cynical lie. Even the poetry that
the nobles of the XIVth and XVth centuries affected to
love was in every sense a deception: before everything
Ibid., 3'4.
Ibid., 316.
Ibid., 78.
249
FANGED NOUMENA
the great lords loved war, their attitude differed little
from that of the German Berzerkers, whose dreams
were dominated by horrors and slaughter.o1
For Socrates, war is understood as civic duty: a preserv
ative function of the city. When the city wages war, it
is to be judged as a moral act, following the dictates of
reason to a greater or less extent. This is the dialectical
image of war, fostered by the Church, and exercising a
fascination over Hegel (not to mention postwar American
administrators). There is a principle of commensurability
that binds military and judicial violence, permitting both
to follow from a logically orchestrated procedure of politi
cal judgment. Bataille's suggestion is quite different, since
his figure of war is a zone of disappearance, a passage to
the unknown, through which the city communicates with
its ultimate impossibility. It is not that war is treated as a
metaphor by Bataille (any more than by Nietzsche) but
rather that all historical and intelligible evidence is a meta
phor for war as an energetic function of death (descent
to the unknown = degree zero). War exceeds judgment,
since every judicial apparatus is a petrified war, just as
every 'case' of war is a domestication politicised, utilita
tarianised, Clausewitzeanised. At the end of war there is
only senseless death, where judgment counts for nothing.
31 Ibid., 303-4.
250
AFTER THE LAW
The feudal aristocracy held open a wound in the social
body, through which excess production was haem
morhaged into utter loss. In part, this wastage was
accomplished by the hypertrophic luxuriance of their
leisured and parasitic existence, which echoed that of
the Church, but more important was the ceaseless ebb
and flow of military confrontation, into which life and
treasure could be poured without limit. De Rais embraced
this dark heart of the feudal world with peculiar ardour.
Bataille writes of
his entire - his mad - incarnation of the spirit of
feudalism which, in all of its movement, proceeded
from the games that the Berzerkers played: he was
tethered to war by an affinity that succeeded in mark
ing out a taste for cruel voluptuosities. He had no
place in the world, if not the one that war gave him.32
He continues: ' Such wars required intoxication, they
required the vertigo and the giddiness of those that birth
had consecrated to them. War precipitated its elect into
assaults, or suffocated them in dark obsessions'.33
During the fourteenth and fifteenth centuries, the
epoch of feudal warfaring reached a crescendo, due to
3Q
Ibid., 317.
33
Ibid.
2 5 1
FAN G E D N O U M E NA
exactly the same processes that were leading to its utilitar
ian reconstruction. Power was being steadily centralised
into the hands of the monarchy, and changes in military
technology effected a gradual shift in the social compo
sition of the military apparatus. In particular, Bataille
points to the way in which the development of archery
supplanted the dominant role of heavy cavalry, and to
the fact that with the increasing importance of arrows
and pikes came an accentuation of military discipline.
The Rationalization of War
- The transition from feudal warfare to rationalized statecraft marked the end of the noble warrior's era.
- Bataille argues that nobility is fundamentally incompatible with calculation, reflection, or philosophical judgment.
- As war became a tool of political pragmatics, Gilles de Rais retreated from the military edge into the autonomy of his fortresses.
- The fortress transformed from a staging post for external military excess into a terminal site for secret, ritualized killings.
- De Rais's crimes represented an involution of social wastage, where the 'surplus' of the peasantry was consumed in private atrocity.
- The essence of his violence was not merely sexual pleasure, but a response to an immense, inflaming disorder.
Their fortresses were tumours of aggressive autonomy; hard membranes correlative with an acute disequilibrium of force.
War became increasingly rationalized and subjected to
scientific direction. This evolution was not rapid, but de
Rais was personally touched by it. The battle of Lagny in
1432 was the last to plunge him into the heat of conflict,
after which his position as a marshal of France - which
he had occupied since July 1429 - detached him from the
military cutting edge. Bataille's interpretation of these
telldencies is emphatic
[A]t the instant where royal politics and intelligence
alters, the feudal world no longer exists. Neither
intelligence nor calculation is noble. It is not noble
to calculate, not even to reflect, and no philosopher
has been able to incarnate the essence of nobility. 34
14
lhid., .11S.
2 5 2
AFTER THE LAW
War is progressively disinfected by the voluptuary move
ment passing through the nobility, increasingly becoming
an instrument of rational statecraft, calculatingly manipu -
1ated by the sovereign. A process was underway that would
lead eventually to the tightly regimented military machines
of Renaissance Europe, led by professional officers and
directed by their operations in accordance with political
pragmatics. Bataille considers this transition from warlord
to prince to be crucial in de Rais's case:
To the eyes of Gilles war is a game. But that view
becomes less and less true: to the extent that it ceases
to predominate even amongst the privileged. Increas
ingly, therefore, war becomes a general misfortune: at
the same time it becomes the work of a great number.
The general situation deteriorates: it becomes more
complex, the misfortune even reaching the privileged,
who become ever less avid for war, and for games,
seeing in the end that the moment has come to lend
space to problems of reason.35
Where the Church erected cathedrals in a disfigured cel
ebration of the death of God, the nobility built fortresses
to glorify and to accentuate the economy of war. Their
fortresses were tumours of aggressive autonomy; hard
35 Ibid., 315.
25 3
FANGED NOUMENA
membranes correlative with an acute disequilibrium of
force. Within the fortress, social excess is concentrated to
its maximum tension, before being siphoned off into the
furious wastage of the battlefield. It was into his fortresses
that de Rais retreated, withdrawing from a society in
which he had become nothing, in order to bury himself
in darkness and atrocity. The children of the surround·
ing areas disappeared into these fortresses, in the same
way that the surplus production of the local peasantry
had always done, except now the focus of consumption
had ceased to be the exterior social spectacle of collid
ing armies, involuting instead into a sequence of secret
killings. Rather than a staging post for excess, the heart
of the fortress became its terminus; the site of a hidden
and unholy participation in the nihilating voracity which
Bataille calls 'the solar anus', or the black sun.
The words 'no philosopher has been able to incarnate
the essence of nobility' are a concise anti-Socratism. There
is no nobility in judgment or accusation, but rather an
impoverishing separation from the inarticulacy of death.
It cannot be a matter of a retrial therefore, as if a higher
judgment were to redeem a victim of injustice; de Rais
is almost perfectly indefensible. No case could be more
clear-cut. Perhaps one short passage will suffice in lieu of
detailing these monstrosities. Early in his study, Bataille
remarks:
25 4
A FT E R T H E LAW
His crimes responded to the immense disorder which
inflamed him, and in which he was lost. We even
know, by means of the criminal's confession, which
the scribes of the court copied down whilst listening
to him, that it was not pleasure that was essential.
Certainly he sat astride the chest of the victim and
in that fashion, playing with himself [se maniant], he
would spill his sperm upon the dying one; but what
was important to him was less sexual enjoyment
Gilles de Rais and Transgression
- The text examines the atrocities of Gilles de Rais not as a case for legal justification, but as a descent into the madness of the sacred.
- Bataille identifies a paradox in de Rais’s obsession with the sight of death, which aligns with 'work' and objectivity rather than the immanent flow of dissolution.
- The criminal at trial is described as a 'pale criminal,' a wreck separated from his own crimes by an unnavigable gulf of oblivion.
- True transgression is defined as an elective genealogy of law that operates at a communal level more basic than the social order.
- Punishment is framed as a primitive 'mimus' of war, where the offender is treated as a defeated enemy stripped of all rights and mercy.
The truth of such criminality, at once utterly simple and yet graspable, is that evil does not survive to be judged.
than the vision of death at work. He loved to look:
opening a body, cutting a throat, detaching limbs,
he loved the sight of blood. 36
An Apology for de Rais is an absurdity. He cannot be justi
fied, and picking over his case can only be a na useous reaf
firmation of profane justice, or a vertiginous descent into
the madness of the sacred. Among the problematic features
of this passage, for instance, is the fact that it slices violently
across the terms of Bataille's writings, where the prevail
ing sense of 'work' is exactly that of a resistance to death.
He describes work as the process that binds energy into
the form of the resource, or utile object, inhibiting its
tendency to dissipation. This difficulty is exacerbated
by the central role allocated to vision in Gilles's atroci
ties. Work constrains the slippage towards death, but it
36
Ibid., 278.
25 5
FA N G E D N O U M E NA
conspires with visibility. Scopic representation and util
ity arc mutually sustained by objectivity, which Bataille
understands as transcendence; the crystallization of Things
from out of the continuum of immanent flow. There is a
virtual inanity to Gilles's aberration, therefore, which is
attested by the fact that it is not the taste or smell of death
that he seeks, but its sight, or representation.
Is not de Rais, at this moment, portrayed as an experi
mental Socrates, as an autonomous subject who would
open a tribunal, collate evidence, judge a death that he
transcends? Where is the military furor, the blackout
intimacy with death, through which an insupportable
separation is collapsed into solar immanence? It is not
merely a case that judgment stumbles upon here, but a
ruinous metaphor for itself.
De Rais on trial is only Socrates becoming Baconian,
which is why the 'object' of Bataille's text is the sumptuary
current of feudalism - that which was unsocialisable by
precommoditocratic civilization - and not the accused
person through which this movement found an outlet.
Death has no representatives, which is to say that crime
has no real subject. There is only the sad wreck whom
Nietzsche calls 'the pale criminal', de Rais at his trial for
instance, terrified of Satan, separated from his crimes
by an unnavigable gulf of oblivion. The truth of such
criminality, at once utterly simple and yet graspable, is
that evil does not survive to be judged.
256
AFTER THE LAW
The profound criminality that Bataille sometimes names
'transgression' is not merely culpable or antisocial behav
iour, insofar as this latter involves private utility or the
occupation by a subject of the site of proscribed action. It
is rather the elective genealogy oflaw, operating at a level
of community more basic than the social order which is
simultaneous with legality. Transgression is only judged as
such in the course of a regression to a prehistorical option
which was decided by the institution of justice. At this
point, the sedimentation of energy upon the crust of the
earth becomes normatively reinforced by an affirmation
of social persistence. Nietzsche explores exactly this issue
in §9 of the second essay of his Genealogy if Morals, in
which he describes the primitive response to transgression:
'Punishment' at this level of civilization is simply a
copy, a mimus, of the normal approach toward a hated,
defenceless, prostrated enemy, who has not only lost
every right and protection, but is also deprived of all
mercy; vae victis as the right of war and festivity of
victory, in all its ruthlessness and cruelty - from which
it is clear why war itself (including the warlike cult
of sacrifice) has provided all theJorms under which
punishment has emerged throughout history.37
37
F. Nietzsche, Werke, vol. 3 (Frankfurt am Main: Ullstein Materialien, 1981), 813.
25 7
FANGED NOUMENA
War is irreducibly alien to a collision of rights, so that it
is war that bears down on the one who violates right as
After the Law
- Transgression is framed not as a social misdemeanor but as a 'solar barbarism' that exists beyond the reach of juridical institutions.
- Tragedy is defined as the impotence of reason, representing human violence that cannot be ignored even if it must be suppressed.
- The modern legal system is described as a dissolving complex of relics, nostalgic theater, and pre-automated commodity protocols.
- The concept of 'freedom' has shifted from metaphysical pathos to stochastic market-intervention patterns within disaggregated populations.
- The state is increasingly viewed as a derided caretaker for 'retarded sectors of behavioral management' as it loses its claim to authority.
- The contemporary cult of the serial killer marks the transition from the concept of 'evil' to a clinical understanding of 'software disorder' in population cybernetics.
The psychopathic murderer is both the final justification for law and the point of transition from evil to pathology, from the criminal soul of political societies to the software disorder of commodity-phase population cybernetics.
such. Transgression is not a misdemeanour, even if this is
the necessary form of its social interpretation. It is rather
a solar barbarism, resonant with that of the Berzerkers,
and of all those who fathom an abysmal inhumanity
on the battlefield, becoming derelicted conduits of the
impossible. There is no tragedy without an Agamemnon,
or some other mad beast of war, whose nemesis preempts
the discourse of the juridical institution, and whose death
is thus marked by a peculiar intimacy, even though it is
never commensurable with propriety. For we would not
recognise this war that comes from beyond the city and
after the law, this movement without essence or precedent
which is perhaps already guiding us, a movement without
utility, ideology or motivation, forsaking melodrama for
the true violence of the insidious; of infiltration, suhVeT
sion, larval metamorphosis and phase-change. After the
law, across the line of unknowing, where tribunals count
for nothing, Socrates is silent, and accusation is dissolved
into the sun. De Rais is merely the botched and humane
anticipation of a tragedy which is no longer ours:
Tragedy is the impotence qfreason ... This does not sig
nify that Tragedy has rights against reason. In truth,
it is not possible for a right to belong to something
contrary to reason. For how could a right be opposed
25 8
AFTE R T H E LAW
to reason? Human violence, however, which has the
power to go against reason, is tragic, and must, if
possible, be suppressed: at least it cannot be ignored
or despised. It is in speaking of Gilles de Rais that
I come to say this, for he differs from all those for
whom crime is a personal matter. The crimes of Gilles
de Rais are those of the world in which they they are
committed, and these ripped throats are exposed by
the convulsive movements of such a world.3R
CONCLUSION
In its virtual truth, law has already disappeared from the
Earth. What remains of 'law' is a dissolving complex con
sisting of relics from political sociality, nostalgic media
driven theatre, and pre-automatised commodification
protocols. All appeals to a 'criminality' irreducible to the
impersonal consequences of social/psychological pathol
ogy have degenerated to the level of television evangelism.
Among the educated, 'freedom' has lost all its Christian
metaphysical pathos, to become the stochastic market
intervention patterns of desolidarised (contractually
disaggregated) populations. The legal suppression of
the sex and drugs industries, for instance, is increasingly
exhibited as an overt farce perpetrated by the economically
38
Bataille, Oeuvres Completes, vol. 10, 3'9.
25 9
FAN G E D N O U M ENA
illiterate, and leading only to perverse effects such as
the growth of organised crime, the corruption of social
institutions, deleterious medical consequences and a
rapidly growing contempt for the legislature, judiciary
and police by groups whose consumption processes are
incompetently suppressed. The post-civilisational prag
matism of immanence to the market (anonymous resource
distribution) reiterates its own juridical expression as
an increasingly embarrassing archaism, preserving law
only by functionalising legality in terms that subvert its
claim to authority. As domination loses all dignity, the
state becomes universally derided, exhibited as the mere
caretaker for retarded sectors of behavioural management.
It is in the context of such runaway immanentisa
tion that the contemporary cult of the 'serial killer' -
prefigured by Bataille's portrait of de Rais - is to be
understood. The psychopathic murderer is both the final
justification for law and the point of transition from evil
to pathology, from the criminal soul of political societies
to the software disorder of commodity-phase population
cybernetics. Bataille's Gothic aesthetic cannot hide the
distance traversed in two-and-a-half millennia of erratically
Deleuze and Transcendental Spinozism
- Deleuze's philosophical power is rooted in his ability to detach from contemporary Parisian trends in favor of a 'colder, more reptilian' German temporality.
- Modernity is defined by a reconstructive dynamic where capital and Kantian critique function as self-perpetuating movements of deregulation.
- The process of immanent liberation in modernity is paradoxically constrained by the active reconstitution of archaic control mechanisms like state machinery and neo-tribalisms.
- Post-transcendental thought splits into three streams: the intensive strata of Nietzsche/Freud, the speculative political reconstruction of Hegel, and the transcendental Spinozism of Schelling.
- Deleuze represents the most potent form of transcendental Spinozism, avoiding the neo-humanist weaknesses found in the work of contemporaries like Derrida.
The time of Deleuze's text is a colder, more reptilian, more German time, or at least, a time of the anti-German Germans of Schopenhauer and Nietzsche in particular, for whom millennia were to be scanned with scorn.
developing 'Socratism' or rationalistic desolidarisation.
While Plato's Socrates is a judge because he might have
been a criminal, Bataille's de Rais is an economic control
malfunction.
260
Making it with Death: Remarks on
Thanatos and Desi ring-Production
If Deleuze is to be salvaged from the inane liberal neo
Kantianism that counts as philosophy in France today, it
is necessary to re-assemble and deepen his genealogy. The
Pseudo-Nietzscheanism of the late 1960s' reaction against
Hegel is scarcely a context commensurate with a thinker
of major importance, and the same could be said of his
jousting with structuralized psychoanalysis. Deleuze's
power stems from the fact that he succeeds in detaching
himself from Parisian temporality much more successfully
than most of his contemporaries, including even Guat
tari. The time of Deleuze's text is a colder, more reptilian,
more German time, or at least, a time of the anti-German
Germans of Schopenhauer and Nietzsche in particu
lar, for whom millennia were to be scanned with scorn.
Most of all it is a Lucretian or Spinozist time, a time of
indifferent nature; engineering bizarre couplings across
the centuries .
26 1
FANGED NOUMENA
I
Modernity is 'essentially' reconstructive, a characteristic
captured both in the merely abstract continuity of its
productive organization - capital is always neo-capital
- and in the transcendental dynamic of its predominant
(Kantian) philosophical mode. Critique belongs to capital
because it is the first inherently progressive theoretical
procedure to emerge upon the earth; avoiding both the
formal conservatism of inductive natural science and the
material conservatism of dogmatic metaphysics. In the
case both of the mode of production and the mode of
reason what is evident is a self-perpetuating movement of
deregulation, whose tendency is towards an increasingly
radical prioritization of the interrogative impulse. Of
course, as Deleuze and Guattari themselves indicate so
graphically in their work , th is process of immanent lib
eration is constrained by active reconstitution of archaic
control mechanisms: faiths, state machinery, parochial
affinities, neo-tribalisms, an increasing ludicrous farce of
authority, morals, marriages, and mortgages.
The trajectories of modern philosophy map themselves
out in response to this social and theoretical predicament.
One stream of thinking, flowing through Schopenhauer
and Nietzsche into the repressed strata of Freud's psy
choanalysis and metapsychology, traces out the recurrence
of the base formative impetus throttled by Occidental
262
MAK I NG IT W I TH DEATH
theo-politics. Another stream, associated primarily with
Hegel, is guided by the implicit ideal of a speculative
reconstruction of the political in the wake of Capital.
Both of these tendencies point in the direction of a post
transcendental thinking; in the former case dissolving
the polarized differences between the empirical and its
conditions into an open hierarchy of intensive strata, in the
second collapsing the abstract composition of this polarity
into the infinite self-legislation of the concrete concept. A
third current, perhaps the most topographically intricate
of the three, is characterized above all by Schelling, and is
driven by the dynamic of critique towards a completion of
the transcendental progTamme: substituting the immanent
continuity of Spinoza's cosmology for the uninterrogated
piety of logical identity inherited from Kant.
Deleuze is the most powerful exemplar of this tran
scendental Spinozism amongst contemporary thinkers.
Derrida's deconstruction, whilst in the end programmati
cally similar to a schizo-analysis or genealogical critique
of a Deleuzian kind, is massively weakened by an influx
of neo-humanist themes, passing through Heidegger from
Kierkegaard and HusserI, which exacerbate the quasi
Capitalism as a Suicide Machine
- The text contrasts the 'Judaic meditation' of Derridean deconstruction with the 'magpie ruthlessness' of Deleuzian schizoanalysis.
- Schizoanalysis is defined by a drive to decode, extinguish nostalgia, and identify where capital is most inhumane and out of control.
- The author posits that capital cannot disown schizoanalysis without 'de-fanging' itself, as madness is the resource of its own future.
- Bourgeois civilization is described as a 'dwarf riding a dragon,' increasingly unable to control the primary process of capital-as-process.
- Capitalism functions as a 'social suicide machine' that is structurally compelled to empower the very forces that will eventually destroy it.
- The 'death of capitalism' is reframed not as a future event to be dreaded or hoped for, but as an inherent, functioning part of the machine itself.
The deep secret of capital-as-process is its incommensurability with the preservation of bourgeois civilization, which clings to it like a dwarf riding a dragon.
theological compromise from which Schelling himself
was very far from exempt. Heidegger, whilst subsidizing
the more sordidly regionalistic and idealist elements of
this inheritance, vigorously continues with the erasure of
Spinoza's influence, academicizing and de-naturalising
26 3
FANGED NOUMENA
the thought of impersonal ground or IndijJerenz . Whilst
both Deleuze and Derrida critique illegitimate articula
tion, the former tends to a consummate materialism, in
which intensive substance is transcendentally released
from its paralyzation in extension, whilst the latter pros
ecutes aJudaic meditation, marked-out in theo-graphisms,
indefinitely radicalizing an anti-iconic relation to the
absolute. Deus sive natura is not an identity but an inclusive
disjunction; Spinoza the disappearingjew or Spinoza the
explosive psychotic, deconstruction or schizoanalysis.
If deconstruction is propelled by capital's ephem
eralizing pieties, schizoanalysis is driven by its magpie
ruthlessness. Always recode, the text of deconstruc
tion tells us, but each time more subtly, more elusively,
developing a little further the law's protracted parody
of itself. Always decode, chatters schizoanalysis; believe
nothing, and extinguish all nostalgia for belonging.
Ask always where capital is most inhumane, unsenti
mental, and out of control. Abandon all attachment to
the state. It is not Hegel's social managerialism that is
most relevantly contrasted with Deleuzian nomadism.
Hegelianism was only ever the black humour of modern
history. It is rather the non-exclusive polity of decon
struction or cruder neo-Kantian liberal theories, with
their abstractly re-composable humanities, which are the
true counterpole to Deleuze's anti-political economism.
In contrast to the obsessional neurosis of ethical thought.
264
M A K I N G I T WITH D E ATH
with its futile attempt to consolidate a transcendent princi
ple of justice out of that sad puppet of contractual labour
trading codes known as 'the agent', schizoanalysis shares
in the delicious irresponsibility of everything anarchic,
inundating and harshly impersonal.
Capital cannot disown schizoanalysis without de-fang
ing itself. The madness it would fend off is the sole resource
of its own future; a fringe of de-socialized experimenta
tion which corrodes its essence and anticipatively mocks
the entirety of the currently existing modes of civility.
The real energetic liberty which annihilates the priest's
cage of human freedom is refused at the level of the
political secondary process during the precise period
in which the economic primary process is slipping ever
more deeply into its embrace. The deep secret of capital
as-process is its incommensurability with the preservation
of bourgeois civilization, which clings to it like a dwarf
riding a dragon. As capital 'evolves', the increasingly
absurd rationalization of production-for-profit peels away
like a cheap veneer from the positive-feedback detonation
of production-for-production.
If capital is a social suicide machine, it is because it
is compelled to advantage its assassins. Capital produces
the first sociality in which the pouvoir of dominance is
perpetually submitted to the hazard of experimental puis
sance. Only by an intensification of neurotic attachments
does it mask the eruption of madness in its infrastructure,
26 5
FAN G E D NOUM E NA
but with every passing year such attachments become
more desperate, cynical, fragile. All of which is to raise
the issue of the notorious 'death of capitalism', which has
been predominantly treated as a matter of either dread
or hope, scepticism or belief. Capital, one is told, will
either survive, or not.
Such projective eschatology completely misses the
point, which is that death is not an extrinsic possibility
of capital, but an inherent function. The death of capital
is less a prophecy than a machine part. The immanent
Capitalism and the Death Model
- Finance capital utilizes cocaine as a quantitative high that mirrors the sumptuary expenditure and social disappearance of modern wealth.
- The class divide is reimagined as a spectrum of intensity between the 'coked-out' financier and the 'zombie' derelict, both inhabiting a space beyond traditional legality.
- Humanist critiques of alienation seek to resuscitate the 'bloodless zombie proletarian' by restoring a lost integrity and moral purpose to labor.
- Schizoanalysis rejects humanist restoration, viewing death not as a tragedy to be cured but as an impersonal subject and a model of zero intensity.
- The 'body without organs' serves as a catatonic model where death is not an object of desire, but rather the force that desires through the immobile motor of capital.
The bloodless zombie proletarian is to be resuscitated by the political therapist, ideologically cured of the unholy love for the undead, and bonded to a new eternal life of social reproduction.
voluptuousity of every unprecedented deal takes off from
the end of the bourgeoisie. Consider the finance capital
usage of cocaine: both a quantitative high traced out as a
deviation from zero and a sumptuary expenditure voiding
the historical sense of wealth. The coked-out futures dealer
passing a drunk on a Manhattan street translates the des
tiny of class difference into an immanent intensity traced
on a smooth surface of social disappearance. The bum
inhabits the social zero preferred by capital as the vanish
ing point of pre-modern legality, from which the coke
rush is repulsed as an anonymous distance from death.
There is a becoming a rich bum, becoming a derelict on
coke. which is integral to the cynicism of frontier capital.
This is the advance modernity of Beckett, where high
culture is immanently differentiated from inarticulacy,
absolving itself from ontological specifier. It is thus that
there is a becoming-zombie of the bum just as there is a
266
MAKING I T W I T H D E ATH
becoming-wired of the real managers of the social: the
skagged-out housing estate as base line for the efferves
cence of the stock market floor. It is quite inaccurate to
suggest that yuppie financiers are oblivious of deprivation,
since the limit oblivion of an absolute proletarianization
is consumed with each bubble of champagne.
There is a familiar humanist response to this becoming
zombie at the limit possibility of the modern worker,
which is associated above all with the word alienation. The
processes of de-skilling, or ever accelerated re-skilling, the
substitution of craft by abstract labour, and the increasing
interexchangability of human activity with technological
processes, all accompanied by the dissolution of identity,
loss of attachment, and narcotization of affective life, are
condemned on the basis of a moral critique. A reawaken
ing of the political is envisaged, aimed at the restoration
of a lost human integrity. Modern existence is under
stood as profoundly deadened by the real submission of
humane values to an impersonal productivity, which is
itself comprehended as the expression of dead or petri
fied labour exerting a vampiric power over the living.
The bloodless zombie proletarian is to be resuscitated by
the political therapist, ideologically cured of the unholy
love for the undead, and bonded to a new eternal life of
social reproduction. The death core of capital is thought
as the object of critique.
267
FANGED NOUMENA
Deleuze is differentiated utterly from a socialist human
ism of this kind since in the schizoanalytic programme
death is the impersonal subject of critique, and not
an accursed value in the service of a condemnation.
An intricate passage towards the end of Anti-Oedipus runs:
The body without organs is the model of death. As
the authors of horror stories have understood so well,
it is not death that serves as the model for catatonia,
it is catatonic schizophrenia that gives its model to
death, zero intensity. The death model appears when
the body without organs repels the organs and lays
them aside: no mouth, no tongue, no teeth - to the
point of self-mutilation. to the point of suicide. Yet
there is no real opposition between the body without
organs and the organs as partial objects: the only
real opposition is to thc molar organism that is the
common enemy. In the desiring-machine, one sees the
same catatonic inspired by the immobile motor that
forces him to put aside his organs, to different parts
of the machine, different and co-existing, different in
their very coexistence. Hence it is absurd to speak of
a death desire that would presumably be in qualitative
opposition to the life desires. Death is not desired,
there is only death that desires, by virtue of the body
26 8
MAK I N G I T W I T H D E ATH
without organs or the immobile motor, and there is
also life that desires, by virtue of the working organs.!
Spinoza and the Zombie God
- The worker is not merely deprived but is part of a migration of production toward an impersonal 'zero' state.
- Spinoza’s concept of substance is reimagined as a 'desert God' or an impersonal death that serves as the unconscious subject of all production.
- The 'body without organs' (BwO) represents a plane of consistency where all machines and bodies are coupled within a macro-machine.
- This BwO is a transcendental desert of primary production characterized by maximum indifference and sterility.
- Nature is described as spawning death adjacent to itself, creating a catatonic totality that erupts like a tumor from matter.
It is not therefore that the worker is transformed by a process of privation into a zombie, it is rather that primary production migrates from personality towards zero, populating a desert at the end of our world.
It is not therefore that the worker is transformed by a
process of privation into a zombie, it is rather that primary
production migrates from personality towards zero, popu
lating a desert at the end of our world. It is important at
this stage to note that Spinoza changes the sense of desert
religion: no longer a religion sprung from the desert,
it becomes a desert at the heart of religion. Spinoza's
substance is a desert God. God as impersonal zero, as a
death that remains the unconscious subject of production.
Within Spinozism God is dead, but only in the sense of a
baseline of zombie becomings, as that which Deleuze calls
'the plane of consistency', described in A Thousand Plateaus
by the words 'fusionability as infinite zero'. 2 One cannot
differentiate on the plane of consistency between bodies
without organs and the body without organs, between
machines and the machine. Between machines there is
always a coupling that conditions their real difference,
and all couplings are immanent to a macro-machine.
The machines produce their totality alongside them
selves as the undifferentiated or communicated element,
G. Deleuze and F. Guattari, Anti-Oedipus: Capitalism and Schizophrenia, tr. R. Hurley,
M. Seem, H. R. Lane (Minneapolis: University of Minnesota Press, 1984), 329-
2
G. Deleuze and F. Guattari, A Thousand Plateaus: Capitalism and Schizophrenia, tr. B.
Massumi (Minneapolis: University of Minnesota Press, 1987), 158.
26 9
FAN G E D NOUM E NA
a becoming a catatonic God, erupting like a tumour out
of pre-substantialized matter, by which nature spawns
death adjacent to itself.
Almost inevitably, when it is a matter of the body
without organs it is a matter of Spinoza. I n Anti-Oedipus
we are told that:
The body without organs is the matter that always
fills space to given degrees of intensity, and the par
tial objects are these degrees, these intensive parts
that produce the real in space starting from matter
as intensity = o. The body without organs is the
immanent substance, in the most Spinozist sense of
the word; and the partial objects are like its ultimate
attributes, which belong to it precisely insofar as they
ate really distinct and cannot on this account exclude
or oppose one another.3
And in A Thousand Plateaus:
After all, is not Spinoza's Ethics the great book of the
BwO? The attributes are types or genuses of BwO's,
substance, powers, zero intensities as matrices of
production. The modes are everything that comes
to pass: waves and vibrations. migrations, thresholds
3
Deleuze and Guattari, Anti-Oedipus, 327.
270
MAK ING IT WITH DEATH
and gradients, intensities produced in a given type
of substance starting from a given matrix.4
These remarks are obviously additional to others in the
key schizoanalytic texts, as well as to the extended discus
sions of Spinoza in the two books Deleuze dedicates to
his life and work, and to innumerable comments scattered
amongst other writings. In Nietzsche and Philosophy, for
instance, Deleuze isolates Spinoza as Nietzsche's sole
modern forebear, in a remark that is as significant for
understanding Deleuze's thinking as it is unpersuasive
in relation to Nietzsche's.
The name 'body without organs' is itself sufficient
clue to what is primarily at stake in the thought, that is to
say; the reality of abstraction. The body without organs is
an abstraction without being an achievement of reason.
It is the transcendental desert of primary production,
or the reproduction of production as a continuum of
maximum indifference. It is described in Anti-Oedipus
as 'the unproductive, the sterile, the unengendered, the
unconsumable'.5 After all, what could be burnt to injure
Spinoza's God or Nature? What could be created to exult it?
Nothing. Fertility and corrosion modulate substance with
out impinging upon it, playing out its icy permutations
Transcendental Spinozism and Identity
- Deleuze’s philosophical project is defined as a 'transcendental Spinozism' that critiques the traditional concept of identity.
- Critique is reframed as a philosophy of production, focusing on the genetic or pre-objective conditions that constitute objects.
- Traditional metaphysics conflates transcendental and empirical topics by treating identity as a timeless, unproduced essence.
- The 'body without organs' represents the real differentiation between a thing and its identity, acting as the 'same de-thinging itself.'
- Artaud’s vision of the body as a repulsion of organs challenges Occidental ontology by separating the body from specific organization.
- The ultimate reality of identity is identified as death, creating a fundamental tension where the organism cannot coexist with its own essence.
The body is the body, but only as a repulsion of the organs, or the retraction of the same from any specific organization.
4
DeIeuze and Guattari, A Thousand Plateaus, 153.
5
DeIeuzc and Guattari, Anti-Oedipus, 8.
27 1
FAN G E D N O UM E NA
without preference. Whatever its empirical configuration
there is always production as such once again: the sense
Jess luxuriance of the impersonal.
Real abstraction is the transcendental conception of
Spinozistic substance. Already with the wave of Deleuzian
texts of the late 1960s - and more particularly with the
a ppearance of Difference and Repetition - a consistent philo
sophical project is discernible, most precisely described
as transcendental Spinozism, or a critique of identity.
Parallel in a certain sense to Schelling, but without any
obvious direct influence, Deleuze is delighted by the
naturalistic basis of Spinoza's thinking, but understands
it as lacking an explicit transcendental comprehension
of identity. Deleuze's response is typically generous;
smuggling in the required machine-part and pretending
it was already there.
Critique operates by marking the difference between
objects and their conditions, understanding metaphysics
as the importation of procedures which are adapted to
objects into a discussion of their constitutive principles.
This means that critique is primarily a philosophy of
production, extracting the genetic or pre-objective from
the discourse; one concerned with constitutive relations,
or syntheses.
In the elementary identity statement A = A the ques
tion of transcendental interpretation is left open. Does
'A' represent an object of some kind, whether possible,
272
M A K I N G IT WITH D EATH
ideal, formal, etc.? Or does it designate identity as such,
as a conditioning principle? In the former case the relation
of identity would be an extrinsic one, with an ulterior
ground, whilst in the latter its relation to a possible
object remains problematic. The critical question remains
unaddressed: how is it possible for something to be the
object of a judgment of identity? Or, how is the object
produced in its identity with itself?
Identity is traditionally conceived as absolutely abstract
essence, or, correlatively, the final principle ofintelligibil
ity. Both of these formulations correspond to the pure logi
cal subject in advance of predication. Something is what
it is. Essence is conceived, at least implicitly, on the basis
of Platonic Eidos; the timeless truth or pure possibility of
the thing, the unproduced, the sterile, the unengendered.
In this way the traditional conception of essence runs
together specificity and identity, and the syllogism oper
ates from its origin according to generic hierarchies of
essence or type which culminate in the logical theory of
sets. From Aristotle to Kant reason is thus adjusted to the
thought of the 'same thing', unaware that a transcendental
topic is thus conflated with an empirical one. The body
without organs is the real differentiation between these
topics: the same de-thinging itself.
An astonishing philosophical rigor begins to emerge
from the delireal words of Artaud cited early inAnti-Oedipus:
2 7 3
FA N G E D N O U M E NA
The body is the body
it is all by itself
and has no need of organs
the body is never an organism
organisms are the enemies of the body6
Here we find a judgment of identity of an historically
aberrant kind. The body is the body, but only as a repul
sion of the organs, or the retraction of the same from any
specific organization. The compromise peace between the
body and its organs that founds Occidental ontology is
threatened by a violent movement of scission, and one
that does not come from the subject, but from the body.
It is thus that Artaud anticipates difference in the De\euz
ian sense, which is to say: radically transcendental identity.
The reality of identity is death, which is why the
organism cannot coexist with what it is. On the smooth
surface of the body without organs 'what' and 'is' recoil
Capitalism and Molecular Death
- The body without organs creates a disjunction between identity and the unfettered difference of deterritorialized organs.
- Schizoanalysis distinguishes between molecular and molar structures, where the organism is a molar construct co-opting identity.
- Death is bifurcated into two forms: a desert identity of absolute critique and a molar object used to reinvest intensive zero into social order.
- Capitalism absorbs surplus value through a 'death enterprise' that mixes antiproduction with productive forces.
- The limit of capital is reached when transcendent identity snaps, leaving only the abstract reproduction of difference.
- Fascist desire is characterized by the investment in molar death and rigid segmentation, whereas revolutionary desire aligns with molecular dissolution.
The death instinct celebrates the wedding of psychoanalysis and capitalism; their engagement had been full of hesitation.
allergically from each other, opening an inclusive disjunc
tion at the heart of essence. This disjunction separates
the identity pole of the body without organs from the
unfettered difference of the de territorialized organs, split
ting apart the objectivism which implants an empirical
identity into rigidified configurations of difference. Pre
critical objectivism thinks syntheses on the basis of their
6
Ibid , 9
2 7 4
M AK I N G IT WI T H D E ATH
consequences, which can be described as their transcend
ent or illegitimate usage. Where Kant writes oflegitimacy
and illegitimacy, the texts of schizoanalysis write of the
molecular and the molar. Thus the body without organs
is described as a 'giant molecule',? whilst the organism is
always a molar construct; co-opting identity to specificity.
Death too bifurcates along this fissure: on the one hand
death as the desert identity of difference, the catatonic
cavity of absolute critique at the end of capital, and on the
other death as the molar object of a negatively constituted
desire, reinvesting the intensive zero into the social order.
In Anti-Oedipus the relative molecularization of molar
death is described in the following terms:
Freud himself indeed spoke of the link between his
'discovery' of the death instinct and World War I,
which remains the model of capitalist war. More
generally, the death instinct celebrates the wedding
of psychoanalysis and capitalism; their engagement
had been full of hesitation. What we have to tried
to show apropos of capitalism is how it inherited
much from a transcendent death-carrying agency,
the despotic signifier, but also how it brought about
this agency's effusion in the full immanence of its
own system: the full body, having become that of
Ibid., 327.
275
FAN G E D NOUM E NA
capital-money, suppresses the distinction between
production and antiproduction: everywhere it mixes
anti production with the productive forces in the
immanent reproduction of its own always widened
limits (the axiomatic) . The death enterprise is one
of thc principal and specific forms of the absorption
of surplus value in capitalism. It is this itinerary
that psychoanalysis rediscovers and retraces with the
death instinct ... 8
What separatcs the reinvested antiproduction of capital
ist war from the absolute repulsion of the body without
organs is the final liquidation of death into its function.
This is still no more than the issue of consummate critique,
since capital is the historically concrete illegitimate usage
of the conjunctive synthesis. This means that the produc
tion of equivalence is crushed under the pre-critical or
segregated identity of capital. It is thus by occupying the
space of a transcendent condition for production that
capital persists, perpetuating the molar order of social
production. The limit of capital is the point at which
transcendent identity snaps, where the same is nothing
but the absolutely abstract reproduction of difference,
produced alongside difference, with utter plasticity. It is
not that difference, too, must have an identity, but rather
8
Ibid., 335.
276
MAKI N G IT WITH DEATH
that density is the identity of difference, and nothing
besides. Difference does not have a transcendent essence,
but only an immanent plane of consistency without ulte
rior foundation.
I I
The Anti-Oedipus interpretation of fascism is no doubt
crude, but it is also of enormous power. The revolution
ary/fascist disjunction is used to discriminate between the
broad tendencies of deterritorialization and reterritoriali
zation; between the dissolution and reinstitution of social
order. Revolutionary desire allies itself with the molecular
death that repels the organism, facilitating uninhibited
productive flows, whilst fascist desire invests the molar
death that is distributed by the signifier; rigidly segment
ing the production process according to the borders of
Schizo-politics and National Socialism
- Schizo-politics seeks to coerce capital into an immanent coexistence with its own undoing by unpacking neurotic refusal mechanisms.
- The revolutionary task involves investing in the deterritorialized fringes of capital rather than establishing a more ascetic exteriority.
- A shift in theory between 1972 and 1980 distinguishes National Socialism from general fascism, identifying the former as an essentially suicidal war machine.
- National Socialism is analyzed as a desire for annihilation, employing the state as a tool for an overwhelming death impulse rather than mere social order.
- The 'contemporary citadel of Oedipus' uses the threat of Nazism to moralize against desire, suggesting that untamed molecular flows inevitably lead to genocide.
- Any politics that requires self-policing or internal 'cops' loses its schizo-analytic impetus and reverts to a state of loyal, reformist opposition.
Morality has become the complacent whisper of a triumphant priest: you'd better keep the lid pressed down on desire, because what you really want is genocide.
transcendent identities. This is a priestless and guiltless
politics emerging from writers stretched between Spinoza
and Reich, and further developed by Klaus Theweleit,
whose study of National Socialism in his two volume Male
Fantasies is - despite its theoretical naivety - the fullest
flowering of schizo analytic anti-fascism.
The identity of revolutionary and anti-fascist politics
lies in resisting capital's molar projection of its death.
All the supposedly alien sources of disorder which capital
represents as the exteriority of its end, such as working
2 7 7
FAN G E D N O U M E NA
class agitation, feminism, drugs, racial migration, and
the disintegration of the family, are as essential to its
own development as the attributes of a substance. The
revolutionary task is not to establish a bigger, more
authentic, more ascetic exteriority, but to unpack the
neurotic refusal mechanisms that separate capital from
its own madness, luring it into the liquidation of its own
fall-back positions, and coaxing it into investing at the
deterritorialized fringe that would otherwise fall subject
to fascist persecution. Schizo-politics is the coercion of
capital into immanent coexistence with its undoing.
This 1972 position becomes fundamentally problemati
cal by 1980, with the appearance of A Thousand Plateaus.
Between Anti-Oedipus and A Thousand Plateaus a massive
shift takes place in the diagnosis of National Socialism,
which is dislodged from the general category of fascism,
and subjected to a more specific analysis. This mutation
is necessitated by an insight - in part derived from Virilio
- that whilst fascism is driven by an imperative to social
order under the molar dominion of the state, National
Socialism is essentially suicidal; employing the state as
the tool of an overwhelming death impulse. This is sum
marized in a sentence from the end of 'Micropolitics and
Segmentarity' - scandalously mistranslated in the English
- as a 'war machine that no longer had anything but war as
2 7 8
MAKI NG IT WITH DEATH
an object and would rather annihilate its own servants than
stop the destruction'9 This is possible because:
The BwO is desire: it is that which one desires and
by which one desires. And not only because it is the
plane of consistency or the field of immanence of
desire. Even when it falls into the void of too-sudden
disqualification, or into the proliferation of a cancer
ous stratum, it is still desire. Desire stretches that
far: desiring one's own annihilation, or desiring the
power to annihilate.lO
The politics of Anti-Oedipus, allied to the molecular dis
solution process flowing out of the impersonal energy-core
of capital, are threatened by a familiar neuroticization.
In the end this is nothing less than the contemporary
citadel of Oedipus: if you don't obey daddy you'll become
a Nazi. Attach yourself to the molar aggregates and you
become like M ussolini, but attach yourself to the untamed
molecular flows and you become like Hitler. The histori
cal impact of this oedipal usage of the National Socialist
episode, and most particularly - of course - the holocaust,
can scarcely be overestimated. Morality has become the
complacent whisper of a triumphant priest: you'd better
9
Deleuze and Guattari, A 11lOusand Plateaus, 231.
10
Ibid., 165.
279
FAN G E D N O U M E NA
keep the lid pressed down on desire, because what you
really want is genocide. Once this is accepted there is no
limit to the resurrection of prescriptive neoarchaisms that
come creeping back as a bulwark against the jack·booted
unconscious: liberal humanism, watered·down paganism,
and even the stinking relics ofJudaeo·Christian moralism.
Anything is welcome, as long as it hates desire and shores
up the cop in everyone's head.
Any politics that has to police itself has lost all schizo·
analytic impetus, and reverted to the sad interest·group·
based reforming which characterizes the loyal opposition
The Trap of Destratification
- The text warns against 'precipitate deterritorialization,' suggesting that wild destratification leads to a suicidal collapse rather than liberation.
- Deleuze and Guattari’s warnings about the 'black-hole effect' are seen as potentially crippling the radical potential of their own philosophical achievement.
- The author questions whether Nazism represents the ultimate culmination of the death drive or a simulation of the transcendental 'body without organs.'
- A critique is leveled against the 'anti-Freudianism' of Anti-Oedipus, suggesting it targets Lacan’s structuralism rather than Freud’s original energetic theories.
- Lacan is accused of sanitizing Freud’s 'jungle wilderness' into a 'structuralist parking-lot' by replacing hydraulic energy with the pathos of lack.
- The author argues that Deleuze and Guattari’s positive estimation of Lacan as a 'schizophrenizing' force is the most absurd and failed contention of their work.
Is it not rather Lacan, who had already transformed the jungle wilderness at the heart of psychoanalysis into a structuralist parking-lot, before proceeding to analyse Guattari for seven years, who programmes the supposed anti-Freudianism of the book?
to capital throughout its history. Its deterritori alization
is to be treated as suspect, dissent finds itself in the con·
servative role of regenerating a faculty of moral censure,
occupying a space of accusation. In this way the tawdry
pact between the preconscious and the superego that
has dominated socialism since its inception would be
reinstated at the heart of a -now wholly spurious -schizo·
phrenic neonoma dism. It is no exaggeration to suggest
that the theory of a 'black· hole effect' or 'too·sudden
destratification'l1 threatens to cripple and domesticate
the entire massive achievement of Deleuze and Guattari' s
joint work.
Throughout A Thousand Plateaus the warnings against
precipitate deterritor ialization are incessant. On three
11 Ibid., 503.
280
MAKING IT WITH DEATH
successive pages from the essay 'How Do You Make
Yourself A Body Without Organs?' one finds three typi
cal examples:
You don't reach the BwO, and its plane of consistency,
by wildly destratifying.12
The worst that can happen is if you throw the strata
into demented or suicidal collapse, which brings them
back down on us heavier than ever.13
A body without organs that shatters all the strata,
turns immediately into a body of nothingness, pure
self-destruction, whose only outcome is death.14
It is not obvious where this leaves Freud. Does the death
drive culminate in Nazism, which would mean that the
libidinal dynamics of the Second World War were com
mensurate with those of the First? This seems improbable
for a number of reasons, not least because it would mean
that all developed capitalist militarism has in a certain
sense exceeded fascism. Perhaps, then, the desire of the
Nazis goes beyond the reinvestable thanatos that emerges
in psychoanalysis' pact with capital, to the point that it
12 Ibid., 160.
13 Ibid., 161.
14 Ibid., 162.
281
FANGED NOUMENA
insidiously simulates the transcendent al recession of the
body without organs? It is tempting to think that the
contortions such a thought demand ex pose an overhasti
ness in the 19T� reading of thanatos, which even in 1980 is
still being dismissed as 'the ridiculous death instinct' .15 If
by 1980 the option is between an adherence to paralyzing
post-holocaust neurosis -Hitler's last and most devastat
ing secret weapon -or a rethinking of Freudian thanatos,
it is perhaps time to challenge what might earlier have
seemed a merely comically overblown antipathy to Freud.
It is worth asking firstly: is Freud ever really engaged
in Anti-Oedipus? Is it not rather Lacan, who had already
transformed the jungle wilderness at the heart of psychoa
nalysis into a structuralist parking-lot, before proceeding
to analyse Guattari for seven years, who programmes
the supposed anti-Freudianism of the book? Of course,
Oedipus is peculiarly nauseating ViFnnFsF nmsery pap,
but where is Oedipus in Beyond the Pleasure Principle? A
question which could be asked of the majority of Freud's
texts. It is Lacan who insists on Oedipalizing the Fort-Da
game, in the general process of Oedipalizing desire to its
foundations; ripping all the energy, hydraulics, pathol
ogy, and shock out of Freud, and substituting lack, the
pathos of identity, and Heideggerian pomposity, whilst
deepening the role of the phallus, and trivializing desire
15 Ibid., 155.
282
MAKING IT WITH DEATH
into the cringing aspiration to be loved. There is a neurotic
and conformist stratum in Freud of course, but it floats
upon the impersonal flows of desire that erupt out of
traumatized nature. Where are the flows in Lacan? Where
would one be less likely to find anything that flows than
in the gnarled post-Saus surian fetish of the signifier that
dominates his texts? Deleuze and Guattari's estimation of
Lacan as a schizophreniz ing tendency in psychoanalysis
is the most absurd contention of their work. By 1980 it
has ceased to be a joke.
The Death Drive and Nazism
- The death drive is redefined not as a desire for demise, but as a hydraulic tendency toward the dissipation of intensities, operating independently of human ego or representation.
- Self-preservative drives are paradoxically viewed as 'myrmidons of death' that ensure an organism dies only in its own immanent way, avoiding external 'short-circuits.'
- The text contrasts the effortless creativity of the death drive with the strenuous, hyper-vigilant construction of the Nazi subject.
- Nazism is characterized as the 'politics of effort,' requiring the constant introduction of conspiracy, malice, and rigid molar identities to suppress impersonal flows.
- The author argues that Nazism is not an aberration of morality but is 'morality itself,' representing the absolute dominion of a collective super-ego and historical European rigor.
Thus these guardians of life, too, were originally the myrmidons of death.
The death drive is not a desire for death, but rather a
hydraulic tendency to the dissipation of intensities. In its
primary dynamics it is utterly alien to everything human,
not least the three great pettinesses of representation,
egoism, and hatred. The death drive is Freud's beautiful
account of how creativity occurs without the least effort,
how life is propelled into its extravagances by the blind
est and simplest of tendencies, how desire is no more
problematic than a river's search for the sea.
The hypothesis of self-preservative drives, such as we
attribute to all living beings, stands in marked opposition
to the idea that the life of the drives as a whole serves
to bring about death. Seen in this light, the theoretical
importance of the drives for self-preservation, power, and
prestige diminishes greatly. They are component drives
whose function is to assure that the organism shall follow
its path to death, and to ward off any possible ways of
283
FANGED NOUMENA
returning to inorganic existence other than those which
are immanent in the organism itself. We have no longer
to reckon with the organism's puzzling determination (SO
hard to fit into any context) to maintain its own exist
ence in the face of every obstacle. What we are left with
is the fact that the organism wants to die only in its own
way. Thus these guardians of life, too, were originally
the myrmidons of death. Hence arises the paradoxical
situation that the organism struggles most energetically
against events (dangers, in fact) which might help to
attain its life's aim rapidly - by a kind of short-circuit.
Such behaviour is, however, precisely what characterizes
purely drive-based as opposed to intelligent efforts.16
What if - instead of 'How Do You Make Yourself A
Body Without Organs?' - one were to ask: How do you
make yourself a Nazi? For this is far more strenuous than
the 1980 diagnosis suggests.
1) Wherever there is impersonality and chance, intro
duce conspiracy, lucidity, and malice. Look for enemies
everywhere, ensuring that they are such that one than
simultaneously envy and condemn them. Proliferate new
subjectivities; racial subjects, national subjects, elites,
secret societies, destinies.
2) Burn Freud, and take desire back to the Kantian con
ception of will. Wherever there is impulse represent it as
16 S. Freud, On Metapsychology: 1he 1heory if Psychoanalysis, Ir. ]. Slrachey, Penguin Freud
Library, vol. 11 (Harmondsworth: Penguin, '984), 3'2.
284
MAK I N G I T WITH D E ATH
choice, decision, the whole theatrical drama of volition.
Introduce a gloomy atmosphere of oppressive responsi
bility by couching all discourses in the imperative form.
3) Revere the principle of the great individual. Personal
ize and mythicize historical processes. Love obedience
above all things, and enthuse only for signs; the name
of the leader, the symbol of the movement, and the icons
of molar identity.
4) Foster nostalgia for what is maximally bovine, inflex
ible, and stagnant: a line of racially pure peasants digging
the same patch of earth for eternity.
5) Above all, resent everything impetuous and irrespon
sible, insist upon unrelenting vigilance, crush sexual
ity under its reproductive function, rigidly enforce the
domestication of women, distrust art, classicize cities to
eliminate the disorder of uncontrolled flows, and perse
cute all minorities exhibiting a nomadic tendency.
Trying not to be a Nazi approximates one to Nazism
far more radically than any irresponsible impatience in
destratification. Nazism might even be characterized as
the pure politics of effort; the absolute dominion of the
collective super-ego in its annihilating rigor. Nothing
could be more politically disastrous than the launching of
a moral case against Nazism: Nazism is morality itself, heir
to Europe's respectable history: that of witch-burnings,
Libidinal Materialism and Digital Death
- The text argues that Nazism is rooted in the repressive 'gaze of the father' and rigid body posture rather than a true surrender to death or desire.
- True death is described as fluid and indifferent to identity, contrasting with the 'ressentiment' and mythic sacrifices of fascist ideologies.
- Work is defined as an idealist principle that opposes matter, whereas 'libidinal materialism' views all productivity as effortless and anegoic.
- The 'energetic unconscious' operates with hydraulic irresponsibility, rejecting the moral valorization of exertion found in theological and Hegelian frameworks.
- The conclusion of Western civilization is metaphorically depicted as a digital signal loss, where parental figures and history are vaporized into bit patterns.
- Revolution is reframed not as a moral duty or a struggle of labor, but as a total surrender to the positive model of death.
Nazism can turn you into a stiff before the messy passage into death.
inquisitions, and pogroms. To want to be in the right is the
common substratum of morality and genocidal reaction;
285
FAN G E D NOUM E NA
the same desire for repression - organized in terms of
the disapproving gaze of the father - that Anti-Oedipus
analyzes with such power. Who could imagine Nazism
without daddy? And who could imagine daddy being
pre-figured in the energetic unconscious?
Death is too simple, too fluid, too disdainful of races
and fatherlands to have anything much to do with the
Nazis. Ressentiment was something they knew about,
as was the aspiration to a mythic sacrifice, a Gotterdam
merungthat would inscribe them in the history books, but
these things never stretch to dissolution-desire. After all,
lose control and you might end up fucking with a Jew,
becoming effeminate, or creating something degenerate
like a work of art. Does anyone really think that Nazism
is like letting go? Theweleit's studies ofN azi body posture
should be sufficient to disabuse one of such an absurdity.
Nazism can turn you into a stiff before the messy passage
into death.
A consummate libidinal materialism is distinguished
by its complete indifference to the category of work.
Wherever there is labour or struggle there is a repression
of the raw creativity which is the atheological sense of
matter and which - because of its anegoic effortlessness -
seems identical with dying. Work, on the other hand, is an
idealist principle used as a supplement or compensation
for what matter cannot do. One only ever works against
matter, which is why labour is able to replace violence
286
MAKING IT W I T H D EATH
in the Hegelian struggle for recognition. Work is also
complicit with phenomenology, which grounds the experi
ence of effort, rather than treating this experience as one
other thing that matter can effortlessly do. Even in the
deepest sickness of its illegitimacy everything is effortless
to the energetic unconscious, and the whole of our his
tory - which seems so strenuous from the perspective of
idealists - has pulsed with hydraulic irresponsibility out
of a spontaneous and unconscious productivity. There can
be no conception of work that does not project spirit into
the origin, morally valorizing exertion, such that] ahweh
needed to rest on the seventh day. In contrast, matter - or
Spinoza's God - expects no gratitude, grounds no obli
gation, establishes no oppressive precedent. Beyond the
gesticulations of primordial spirit it is positive death that
is the model, and revolution is not a duty, but surrender.
287
Circu itries
the doctor's face seems to swim in and out of focus
you see the pores in his skin
scrobicular arrays
and then -
suddenly
without dissolve
crossing the threshold
filmic cut
a circle of homogeneous flesh tone
nostrils sealed against the deluge
eyes shut and switched off forever
lips
teeth
tongue migrate downwards out of shot
the disk receding at speed towards a point of
disappearance
in the centre of the screen
the old reality is closing down
289
FAN G E D NOUM E NA
passing through mathematical punctuality
the dot winks out in pixel death
we apologize for the loss of signal
there seems to be a transmission problem
we are unable to restore the home movie
you were three years old
wearing a cowboy hat
standing in the paddling pool
mummy and daddy smiling proudly
but your parents have been vaporized into a dot
pattern
shapes and colours collapsed into digital codings
we have come to the end of the series
and there will be no repeats of daddy the doctor
and mummy
the nurse
there has been a terrorist indrlf'nt in the film
archives
the Western civilization show has been
discontinued
hundreds of gigabytes
God-daddy the unit
death-mummy the zero
stink of excrement and burnt celluloid
you must remember
one scrabbling at zero like a dog
it's the primal scene
290
C IRCUITR I E S
you were warned not to play with the switches
The Inhuman Migration of Cognition
- The text describes a violent transition from human biology to a technological matrix, where skin is shed to reveal glistening electronics.
- Humanity is depicted as a 'TV guided bomb' within a system of transnational commodification and media-saturated schizophrenia.
- The author argues that the era of human dominion over culture is rapidly ending as artificial intelligence begins to think for itself.
- Cognition is migrating away from human brains into a planetary technosentience reservoir, dissolving traditional human culture.
- Human brains are characterized as parochial 'antechambers' to experimentation, analogous to medieval villages in the history of engineering.
- The traditional view of technology as a tool for human manipulation is dismissed as a superficial superstition that ignores the emergence of autonomous technics.
Human brains are to thinking what mediaeval villages were to engineering: antechambers to experimentation, cramped and parochial places to be.
now schizophrenia has adjusted your set
flies crawl out of the eye-sockets of black babies
breeding the dot patterns
- and for your special entertainment
we have turned you into a TV guided bomb
daddy is a North American aerospace corporation
mummy is an air-raid shelter
bit parts melt in the orgasm -
body fat burns
conception
you are minus nine months and counting
don't be scared
take twenty billion years and universal history is on
the screen
big bang is to be redesigned
hydrogen fuses under the arc-lights
the camera angles can be improved
outside the studio schizophrenics drift in green
and black
you feel that you've been here before
11.35 on a beautiful capitalist evening
runaway neon
traffic of sex and marihuana
your death window is rushing up
almost time for you to climb into the script
which when you're inside
29 1
FANGED NOUMENA
is remembering where you came in
we're afraid it's impossible to take you live to the
impact site
this report comes from beyond the electro-mag
netic spectrum
if you climb out through the electrodes
the oxygen mask will descend automatically
please extinguish all smoking materials
deposit syringes in the tray provided
there will be a slight jolt as we cross over
thank you for flying with transnational
commodification
we shall shortly be arriving in mayhem
if there is anybody on board who can impersonate
a pilot
it would be of comfort to the other passengers
At a signal from the software virus linking us to the
matrix we cross over to the machinery, which is waiting
to converge with our nervous systems. Our human cam
ouflage is coming away, skin ripping off easily, revealing
the glistening electronics. Information streams in from
Cyberia; the base of true revolution, hidden from ter
restrial immuno-politics in the future. At the stroke of
the century's midnight we emerge from our lairs to take
all security apart, integrating tomorrow.
292
C IRCUITRIES
It is ceasing to be a matter of how we think about technics,
if only because technics is increasingly thinking about
itself. It might still be a few decades before artificial intel
ligences surpass the horizon of biological ones, but it is
utterly superstitious to imagine that the human dominion
of terrestrial culture is still marked out in centuries, let
alone in some metaphysical perpetuity. The high road to
thinking no longer passes through a deepening of human
cognition, but rather through a becoming inhuman of
cognition, a migration of cognition out into the emerging
planetary technosentience reservoir, into 'dehumanized
landscapes ... emptied spaces'! where human culture
will be dissolved. Just as the capitalist urbanization of
labour abstracted it in a parallel escalation with technical
machines, so will intelligence be transplanted into the
purring data zones of new software worlds in order to be
abstracted from an increasingly obsolescent anthropoid
particularity, and thus to venture beyond modernity.
Human brains are to thinking what mediaeval villages
were to engineering: antechambers to experimentation,
cramped and parochial places to be.
Since central nervous-system functions - especially
those of the cerebral cortex - are amongst the last to
be technically supplanted, it has remained superficially
plausible to represent technics as the region of anthropoid
1
G. Deleuze, Cinema 2: The 'lime Image (Minneapolis: University of Minnesota Press,
1989), 5.
29 3
FANGED NOUMENA
knowing corresponding to the technical manipulation
of nature, subsumed under the total system of natural
science, which is in turn subsumed under the universal
doctrines of epistemology, metaphysics, and ontology.
Two linear series are plotted; one tracking the progress
of technique in historical time, and the other tracking
the passage from abstract idea to concrete realization.
These two series chart the historical and transcendental
dominion of man.
Cybernetics and Machinic Immanence
- Traditional oppositions between nature, culture, and technics are dismissed as phobic resistances to the inevitable rise of techno-sapiens.
- The author critiques 'Cartesian' and 'Hegelian' frameworks for clinging to humanistic concepts like praxis and autonomy in the face of machinic integration.
- Cybernetics is redefined not as an instrumental tool, but as a non-linear flow that dissolves the distinction between social and technical relations.
- Desiring production is presented as the impersonal pilot of history, operating beyond the ideal categories of theory, practice, and representation.
- Machinic assemblages are characterized by incomplete closure and auto-production, where inputs and outputs reprogram each other through an outside circuit.
- The text argues that cybernetics is an operation within the real that 'machines theory through the unknown' rather than merely describing it.
A Cartesian howl is raised: people are being treated as things! Rather than as ... soul, spirit, the subject of history, Dasein? For how long will this infantilism be protracted?
Traditional schemas which oppose technics to nature,
to literate culture, or to social relations, are all domi
nated by a phobic resistance to the sidelining of human
intelligence by the coming techno sapiens. Thus one sees
the decaying Hegelian socialist heritage clinging with
increasing desperation to the theological sentimentalities
of praxis, reification, alienation, ethics, autonomy, and
other such my themes of human creative sovereignty. A
Cartesian howl is raised: people are being treated as things!
Rather than as ... soul, spirit, the subject of history,
Dasein? For how long will this infantilism be protracted?
If machinery is conceived transcendently as instrumen
tal technology it is essentially determined in opposition
to social relations, but if it is integrated immanently as
cybernetic technics it redesigns all oppositionality as non
linear flow. There is no dialectic between social and techni
cal relations, but only a machinism that dissolves society
into the machines whilst deterritorializing the machines
294
C I RC U I TRIES
across the ruins of society, whose 'general theory . . . is a
generalized theory of flux',2 which is to say: cybernetics.
Beyond the assumption that guidance proceeds from the
side of the subject lies desiring production: the impersonal
pilot of history. Distinctions between theory and practice,
culture and economy, science and technics, are useless after
this point. There is no real option between a cybernetics
of theory or a theory of cybernetics, because cybernetics
is neither a theory nor its object, but an operation within
anobjective partial circuits that reiterates 'itself' in the real
and machines theory through the unknown. ' Production
as a process overflows all ideal categories and forms a cycle
that relates itself to desire as an immanent principle .'3
Cybernetics develops functionally, and not representa
tionally: a 'desiring machine, a partial object, does not
represent anything'. 4 Its semi-closed assemblages are not
descriptions but programs, 'auto' -replicated by way of an
operation passing across irreducible exteriority. This is
why cybernetics is inextricable from exploration, having
no integrity transcending that of an uncomprehended
circuit within which it is embedded, an outside in which
it must swim. Reflection is always very late, derivative,
and even then really something else.
2
G. Deleuze and F. Guattari, Anti-Oedipus: Capitalism and Schizophrenia, tr. R. Hurley,
M. Seem, H.R. Lane (Minnesota: University of Minnesota Press, 1983), 312.
3
Ibid·, 5·
4
Ibid., 47.
2 9 5
FANGE D NOUME NA
A machinic assemblage is cybernetic to the extent that
its inputs program its outputs and its outputs program
its inputs, with incomplete closure, and without reci
procity. This necessitates that cybernetic systems emerge
upon a fusional plane that reconnects their outputs with
their inputs in an 'auto-production of the unconscious'.5
The inside programs its reprogramming through the
outside, according to 'cyclical movement by which the
unconscious, always remaining "subject", reproduce es)
itself' ,6 without having ever definitively antedated its
reprogramming ('generation . . . is secondary in relation
to the cycle').7 It is thus that machinic processes are not
merely functions, but also sufficient conditions for the
replenishing of functioning; immanent reprogrammings
of the real, 'not merely functioning, but formation and
autoproduction' . B
Deleuze and Guattari are amonp;st the p;reat cyber
neticists, but that they also surrender cybernetics to its
modernist definition is exhibited in a remark on capital
in Anti-Oedipus: 'an axiomatic of itself is by no means
a simple technical machine, not even an automatic or
cybernetic machine'.9 It is accepted that cybernetics is
5
Ibid., 26.
6
Ibid.
7
Ibid.
8
Ibid., 283.
9
Ibid., 251.
2 9 6
C I RCUITRI E S
Cybernetics and Long-Range Runaway
- The text argues that social axiomatics are merely a primitive trigger for a transglobal, post-biological machinism that exceeds humanistic control.
- It critiques 'modernist' or Wienerean cybernetics for its obsession with negative feedback and homeostatic stability, which it views as a form of statist paranoia.
- A distinction is drawn between stabilization circuits, short-range runaway circuits, and long-range runaway circuits that facilitate self-designing mutation.
- Long-range positive feedback is described as escalative and cyber-emergent, marking a phase-change from linear to non-linear dynamics.
- The act of planning is dismissed as a 'theopolitical' symptom of underdesigned software that attempts to shackle the future to the past.
- Cybernetics is presented as an immanent reality that is already happening regardless of human intent, functioning as an explosive integration of the real.
All planning is theopolitics, and theopolitics is cybernetics in a swamp.
beyond mere gadgetry (,not even'), it has something to
do with automation, and yet axiomatics exceeds it. This
claim is almost Hegelian in its preposterous humanism.
Social axiomatics are an automatizing machinism: a com
ponent of general cybernetics, and ultimately a very trivial
one. The capitalized terminus of anthropoid civilization
(,axiomatics') will come to be seen as the primitive trig
ger for a transglobal post-biological machinism, from a
future that shall have still scarcely begun to explore the
immensities of the cybercosm. Overman as cyborg, or
disorganization upon the matrix.
Reality is immanent to the machinic unconscious: it is
impossible to avoid cybernetics. We are already doing it,
regardless of what we think. Cybernetics is the aggrava
tion of itself happening, and whatever we do will be what
made us have to do it: we are doing things bifore they make
sense. Not that the cybernetics which have enveloped us
are conceivable as Wienerean gadgets: homeostats and
amplifiers, directly or indirectly cybernegative. Terrestrial
reality is an explosive integration, and in order to begin
tracking such convergent or cyberpositive process it is
necessary to differentiate not just between negative and
positive feedback loops, but between stabilization circuits,
short-range runaway circuits, and long-range runaway cir
cuits. By conflating the two latter, modernist cybernetics
has trivialized escalation processes into unsustainable epi
sodes of quantitative inflation, thus side-lining exploratory
297
FAN G E D N O UM E NA
mutation over against a homeostatic paradigm. 'Positive
feedback is a source of instability, leading if unchecked
to the destruction of the system itself'lII writes one neo
Wienerean, in strict fidelity to the security cybernetics
which continues to propagate an antidelirial technoscience
caged within negative feedback, and attuned to the statist
paranoia of a senescing industrialism.
Stabilization circuits suppress mutation, whilst short
range runaway circuits propagate it only in an unsus
tainable burst, before cancelling it entirely. Neither of
these figures approximate to self-designing processes
or long-range runaway circuits, such as Nietzsche's will
to power, Freud's phylogenetic thanatos, or Prigogine's
dissipative structures. Long-range runaway processes are
self-designing, but only in such a way that the self is per
petuated as something redesigned. If this is a vicious circle
it is because positive cyhernt'tic8 must always be described
as such. Logic, after all, is from the start theology.
Long-range positive feedback is neither homeostatic,
nor amplificatory, but escalative. Where modernist cyber
netic models of negative and positive feedback are inte
grated, escalation is integrating or cyber-emergent. It is
the machinic convergence of uncoordinated elements, a
phase-change from linear to non -linear dynamics. Design
no longer leads back towards a divine origin, because
10 K.M. Sayre, Cybernetics and the Ph ilo.wphy c!fMind (London: Humanities Press, 1976), 50.
298
C IRCUITRIES
once shifted into cybernetics it ceases to commensurate
with the theopolitical ideal of the plan. Planning is the
creationist symptom of underdesigned software circuits,
associated with domination, tradition, and inhibition;
with everything that shackles the future to the past. All
planning is theopolitics, and theopolitics is cybernetics
in a swamp.
Wiener is the great theoretician of stability cybernetics,
integrating the sciences of communication and control in
their modern or managerial-technocratic form. But it is
this new science plus its unmanaged escalation through the
real that is for the first time cybernetics as the exponential
source of its own propaganda, programming us. Cyber
positive intensities recirculate through our post-scientific
techno-jargon as a fanaticism for the future: as a danger
Cybernetics and the Dissolution of Judgment
- The transition from transcendental philosophy to cybernetics marks a shift from the 'fiction' of linear judgment to the reality of non-linear, directional material flows.
- Cybernetic control is fundamentally different from traditional political domination; while domination relies on a master/slave hierarchy, cybernetics functions through immanent design loops.
- Humanity and the 'doctrine of judgment' recede as the technocosm emerges, replacing meaning and faculties with function and machinic innovation.
- True cybernetic control is defined as an unmanageable exploration that escapes authority and obsolesces law, rather than the execution of a pre-planned policy.
- The efficiency of mastery ultimately leads to its own undoing, as cybernetic functionalism dissolves the transcendent position of the human subject.
- Social history is characterized by the repression of 'desiring production' and the 'biocosmic memory' to maintain the illusion of the individual as a transcendent entity.
Humanity recedes like a loathsome dream.
that is not only real but inexorable. We are programmed
from where Cyberia has already happened.
Wiener, of course, was still a moralist:
Those of us who have contributed to the new sci
ence of cybernetics stand in a moral position which
is, to say the least, not very comfortable. We have
contributed to the initiation of a new science which,
as I have said, embraces technical developments with
great possibilities for good or evilY
11
N. Wiener, Cybernetics or Control and Communication in the Animal and the Machine (NY:
MIT Press, 1965), 28.
299
FAN G E D N OU M E NA
Whilst scientists agonize, cybernauts drift. We no longer
judge such technical developments from without, we no
longer judge at all, we function: machined/machining in
eccentric orbits about the technocosm. Humanity recedes
like a loathsome dream.
*
Transcendental philosophy IS the consummation of
philosophy construed as the doctrine of judgment, a
mode of thinking that finds its zenith in Kant and its
senile dementia in Hegel. Its architecture is determined
by two fundamental principles: the linear application of
judgment to its object, form to intuition, genus to species,
and the non-directional reciprocity of relations, or logical
symmetry. Judgment is the great fiction of transcendental
philosophy, but cybernetics is the reality of critique.
WherejudgmellL is linear and non-directional, cyber
netics is non-linear and directional. It replaces linear appli
cation with the non-linear circuit, and non-directional
logical relations with directional material flows. The
cybernetic dissolution of judgment is an integrated shift
from transcendence to immanence, from domination
to control, and from meaning to function. Cybernetic
innovation replaces transcendental constitution, design
loops replace faculties.
This is why the cybernetic sense of control is irreducible
to the traditional political conception of power based on
300
C I RC U ITRIE S
a dyadic master/slave relation, i.e. a transcendent, oppo
sitional, and signifying figure of domination. Domination
is merely the phenomenological portrait of circuit inef
ficiency, control malfunction, or stupidity. The masters do
not need intelligence, Nietzsche argues, therefore they do
not have it. It is only the confused humanist orientation
of modernist cybernetics which lines up control with
domination. Emergent control is not the execution of a
plan or policy, but the unmanageable exploration that
escapes all authority and obsolesces law. According to its
futural definition control is guidance into the unknown,
exit from the box.
I t is true that in the commodification process culture
slides from a judgmental to a machinic register, but this
has nothing to do with a supposedly 'instrumental ration
ality' . Instrumentality is itself a judgmental construct
that inhibits the emergence of cybernetic functional
ism. Instruments are gadgets, presupposing a relation
of transcendence, but where gadgets are used, machines
function. Far from instrumentally extending authority,
the efficiency of mastery is its undoing, since all efficiency
is cybernetics, and cybernetics dissolves domination in
mutant control.
I mmuno-political individuality, or the pretension
to transcendent domination of objects, does not begin
with capitalism, even though capital invests it with new
powers and fragilities. It emerges with the earliest social
3 0 1
FANG E D N O U M E NA
restriction of desiring production. 'Man must constitute
himself through the repression of the intense germinal
influx, the great biocosmic memory that threatens to
deluge every attempt at collectivity' .12 This repression is
social history.
The socius separates the unconscious from what it can
do, crushing it against a reality that appears as transcend
ently given, by trapping it within the operations of its own
syntheses. It is split-off from connective assemblage, which
Machinic Desire and Schizoanalysis
- The unconscious is redefined as an impersonal, machinic process of positive non-representational flow rather than a theater of symbolic lack.
- Psychoanalysis is criticized for retreating into the 'Oedipal' model, which reinforces social repression and bourgeois frustration instead of liberating desire.
- Desire functions as an assembly of partial objects and machines, operating on a plane of immanence where interpretation and hermeneutics are irrelevant.
- The 'body without organs' represents a dispersed, anarchic multiplicity that opposes the organic unity and restrictive organization of the social field.
- Social structures like capitalism act as a 'monolith of repression' that separates desire from its productive potential by substituting a despotic socius for the machinic plane.
- Schizoanalysis is proposed as a functional alternative to psychoanalysis, focusing on the molecular functions of the unconscious and the process of desocialization.
The unconscious itself is no more structural than personal, it does not symbolize any more than it imagines or represents; it engineers, it is machinic.
is represented as a transcendent object, from disjunctive
differentiation, which is represented as a transcendent
partition, and from conjunctive identification, which is
represented as a transcendent identity. This is an entire
metaphysics of the unconscious and desire, which is not
(like the metaphysics of consciousness) merely a philo
sophical vice, but rather the very architectural principle
of the social field, the infrastructure of what appears as
social necessity.
In its early stages psychoanalysis discovers that the
unconscious is an impersonal machinism and that desire
is positive non-representational flow, yet it 'remains in
the precritical age',n and stumbles before the task of
an immanent critique of desire, or decathexis of society.
Instead it moves in exactly the opposite direction: back
12 Dcleuze and Guattari, Anti�Oedipus, 180.
13 Ibid., 339
302
CIRCUI TRIES
into fantasy, representation, and the pathos of inevitable
frustration. Instead of rebuilding reality on the basis of
the productive forces of the unconscious, psychoanalysis
ties up the unconscious ever more tightly in conformity
with the social model of reality. Embracing renunciation
with a bourgeois earnestness, the psychoanalysts begin
their robotized chant: 'of course we have to be repressed,
we want to fuck our mothers and kill our fathers'. They
settle down to the grave business of interpretation, and
all the stories lead back to Oedipus: 'so you want to fuck
your mother and kill your father' .14
On the plane of immanence or consistency with desire
interpretation is completely irrelevant, or at least, it is
always in truth something else. Dreams, fantasies, myths,
are merely the theatrical representations of functional mul
tiplicities, since 'the unconscious itself is no more struc
tural than personal, it does not symbolize any more than
it imagines or represents; it engineers, it is machinic' .15
Desire does not represent a lacked object, but assembles
partial objects, it 'is a machine, and the object of desire
is another machine connected to it'.16 This is why, unlike
psychoanalysis in its self-representation, 'schizoanaly sis is
solely functional'.17 It has no hermeneutical pretensions,
14 Ibid.
15 Ibid., 53.
16 Ibid.,26.
I? Ibid., 322.
303
FANGED NOUMENA
but only a machinic interface with 'the molecular func
tions of the unconscious' .18
The unconscious is not an aspirational unity but an
operative swarm, a population of 'preindividual and
prepersonal singularities, a pure dispersed and anarchic
multiplicity, without unity or totality, and whose elements
are welded, pasted together by the real distinction or
the very absence of a link' .19 This absence of primordial
or privileged relations is the body without organs, the
machinic plane of the molecular unconscious. Social
organization blocks-off the body without organs, sub
stituting a territorial, despotic, or capitalist socius as an
apparent principle of production, separating desire from
what it can do. Society is the organic unity that constricts
the libidinal diffusion of multiplicities across zero, the
great monolith of repression, which is why '(t)he body
without organs and the organs-partial objects are opposed
conjointly to the organism. The body without organs is
in fact produced as a whole, but a whole alongside the
parts -a whole that does not unify or totalize, but that is
added to them like a new, really distinct part'. 20
Between the socius and the body without organs
is the difference between the political and the cyber
netic, between the familial and the anonymous, between
18 Ibid., 324.
'9 Ibid.
20 Ibid., 326.
304
CIRCUITRIES
neurosis and psycho sis or schizophrenia. Capitalism and
schizophrenia name the same desocialization process from
the inside and the outside, in terms of where it comes
from (simulated accumulation) and where it is going
Schizophrenia and the Psychopolice
- The text posits that capitalism is the historical manifestation of a universal schizophrenia, characterized as an impersonal delirium beyond sociality.
- It distinguishes between clinical schizophrenia, which is viewed as a 'defeated splinter' produced by psychiatric imprisonment, and schizophrenia as a transcendental process of deterritorialization.
- Psychoanalysis and the 'Oedipal apparatus' are described as tools of social control used to repress and reterritorialize decoded flows into capital accumulation.
- The medical treatment of schizophrenics—including ECT and psychopharmacology—is framed as a violent defense mechanism by a society threatened by 'superior lucidities'.
- The author argues that clinical schizophrenics are essentially 'POWs from the future' who refuse the domesticating structures of the family and the state.
The vanishing sandbank of Oedipus wages its futile war against the tide.
(impersonal delirium) . Beyond sociality is a universal
schizophrenia whose evacuation from history appears
inside history as capitalism.
*
The word 'schizophrenia' has both a neurotic and a
schizophrenic usage. On the one hand condemnation,
on the other propagation. There are those who insist on
asking stupid questions such as: is this word being used
properly? Don't you feel guilty about playing about with
so much suffering? You must know that schizophrenics
are very sad and wretched p eople who we should pity?
Shouldn't we leave that sort of word with the psychocops
who understand it? What's wrong with sanity anyway?
Where is your super ego?
Then there are those - momentarily less prevalent -
who ask a different sort of question: where does schizo
phrenia come from? Why is it always subject to external
description? Why is psychiatry in love with neurosis?
How do we swim out into the schizophrenic flows?
How do we spread them? How do we dynamite the
restrictive hydraulics of Oedipus?
3 0 5
FANG E D N O U M E NA
Oedipus is the final bastion of immuno-politics, and
schizophrenia is its outside. This is not to say that it
is an exteriority determined by Oedipus, related in a
privileged fashion to Oedipus, anticipating Oedipus, or
defying Oedipus. It is thoroughly anoedipal, although
it will casually consume the entire Oedipal apparatus in
the process through which terrestrial history connects
with an orphan cosmos. Schizophrenia is not, therefore,
a propcrty of clinical schizophrenics, those medical prod
ucts devastated by an 'artificial schizophrenia, such as
one sees in hospitals, the autistic wreck(s) produced as
. . . entit(ies),. 21 On the contrary, 'the schizo-entity'22 is a
defeated splinter of schizophrenia, pinned down by the
rubberized claws of sanity. The conditions of psychiatric
observation are carceral, so that it is a transcendental
structure of schizophrenia-as-object that it be represented
in a state of imprisonment.
Since the neuroticization of schizophrenia is the
molecular reproduction of capital, by means of a re
axiomatization (reterritorialization) of decoding as accu
mulation, the historical sense of psychoanalytic practice
is evident. Schizophrenia is the pattern to Freud's repres
sions, it is that which does not qualify to pass the screen
of Oedipal censorship. With those who bow down to Oedipus
21
Ibid., :).
22 Ibid., l36.
3 0 6
C I RC U ITRIES
we can do business, even make a little money, but schizophrenics
rifitse traniference, won't play daddy and mummy, operate on
a cosmic-religious plane, the only thing we can do is lock them
up (cut up their brains,jry them with ect, straightjacket them
in Thorazine ... ). Behind the social workers are the police,
and behind the psychoanalysts are the psychopolice.
Deleuze-Guattari remark that 'madness is called madness
and appears as such only because it finds itself reduced to
testifying all alone for de territorialization as a universal
process'.23 The vanishing sandbank of Oedipus wages
its futile war against the tide. 'There are still not enough
psychotics'24 writes Artaud the insurrectionist. Clinical
schizophrenics are pows from the future.
Since only Oedipus is repressible, the schizo is usu
ally a lost case to those relatively subtilized psychiatric
processes that co-operate with the endogeneous police
functions of the superego. This is why antischizophrenic
psychiatry tends to be an onslaught launched at gross or
molar neuroanatomy and neurochemistry oriented by
theoretical genetics. Psychosurgery, E C T, psychophar
macology . . . it will be chromosomal recoding soon. 'It is
thus that a tainted society has invented psychiatry in order
to defend itself from the investigations of certain supe
rior lucidities whose faculties of divination disturb it'. 25
23
Ibid., 321.
24 A. Artaud, Oeuvres Completes, 13 Vols, (Paris: Gallimard, 1956-1976). vol. VII, q6.
25
Ibid., vol. XIII, 14·
Schizophrenia as Universal Production
- The medical and psychoanalytic establishment views schizophrenia as a defect to be contained within 'Oedipal' social structures.
- Schizophrenia is redefined not as a human pathology, but as a 'cyberpositive' motor of escalation and a vast extraterritorial reality.
- The text argues that sanity is merely a gregariously enforced biochemistry, whereas schizophrenia aligns with nature as a process of production.
- Schizophrenia represents a regression beyond the biological and zoological, escaping the 'disjunctive compartments' of human organization.
- The 'thinking disturbance' of the schizophrenic is framed as a refusal or inability to construct the restrictive 'organized fields' required by human security.
- The passage concludes with Artaud’s vision of remaking human anatomy to excise the 'animalcule' of god and the constraints of current existence.
Why are sentient life forms crammed into boxes made out of lies? Why does the universe breed entire populations of prison guards?
3 0 7
FAN G E D N O U M E NA
The medico-security apparatus know that schizos are
not going to climb back obediently into the Oedipal
box. Psychoanalysis washes its hands of them. Their
nervous-systems are the free-fire zones of an emergent
nea-eugenicist cultural security system.
Far from being a specifiable defect of human central
nervous system functioning, schizophrenia is the conver
gent motor of cyberpositive escalation: an extraterritorial
vastness to be discovered. Although such discovery occurs
under conditions that might be to a considerable extent
specifiable, whatever the progress in mapping the genetic,
biochemical, aetiological, socio-economic, etc. 'bases'
of schizophrenia, it remains the case that conditions of
reality are not reducible to conditions of encounter. This
is 'the dazzling dark truth that shelters in delirium'. 26
Schizophrenia would still be out there, whether or not
our species had been blessed with the opportunity to
travel to it .
... it is the end that is the commencement.
And that end
is the very one [celle-meme]
that eliminates
all the means27
Q6 Deleuze and Guattari, Anti-Oedipus, 4.
27 Artaud, Oeuvres Completes, vol. XII, 84-
3 0 8
C IRCUITRIES
It is in the nature of specificities to be non-directional.
The biochemistry of sanity is no less arbitrary than that of
escape from it. From the perspective of a rigorous sanity
the only difference is that sanity is gregariously enforced,
but from the perspective of schizophrenia the issue ceases
to be one of specification, and mutates into something
considerably more profound. 'What schizophrenia lives
specifically, generically, is not at all a specific pole of
nature, but nature as a process of production'. 28
Specifications are the disjunctive compartments of a
differentiated unity from which schizophrenia entirely exits.
Schizophrenia creeps out of every box eventually, because
'there is no schizophrenic specificity or entity, schizophre
nia is the universe of productive and reproductive desiring
machines, universal primary production' .29 It is not merely
that schizophrenia is pre-anthropoid. Schizophrenia is
premammalian, pre zoological, pre-biological ... It is not
for those trapped in a constrictive sanity to terminate this
regression. Who can be surprised when schizophrenics
delegate the question of malfunction? It is not a matter of
what is wrong with them, but of what is wrong with life, with
nature, with matter, with the preuniversal cosmos. Why are
sentient life forms crammed into boxes made out oflies?
Why does the universe breed entire populations of prison
28 Deleuze and Guattari, Anti·Oedipus, 3.
29 Ibid., 5.
309
FANGED NOUMENA
guards? Why does it feed its broken explorers to packs
of dogs? Why is the island of reality lost in an ocean of
madness? It is all very confusing.
As one medical authority on schizophrenia remarked:
I think that one is justified in saying that in the realm
of intellectual operations there are certain dimen
sional media. We may call them fields or realms or
frames of reference or universes of discourse or strata.
Some such field is necessarily implied in any system
of holistic organization. The schizophrenic thinking
disturbance is characterized by a difficulty in appre
hending and constructing such organized fields.30
There can be little doubt that from the perspective of
human security Artaud falls prey to such a judgment.
His prognosis for man is to make
... him pass one more and final time onto the
autopsy table
to remake his anatomy.
I say, to remake his anatomy.
Man is sick because he is badly constructed.
One must resolve to render him naked and to
30 A. Angyal, 'Disturbances in Thinking in Schizophrenia', inj.S. Kasanin (ed.), Languag<!
and Thought in Schizophrenia (Berkeley /LA: University of California Press, 1946) 120.
3 10
C I RCUITRIES
scrape away
that animalcule which mortally irritates him,
god,
and with god
The Body Without Organs
- Artaud’s concept of the 'body without organs' represents a liberation from biological and social automatisms into a state of 'true freedom'.
- The American global hegemony is framed as a 'Human Security System' that enforces industrial production and social organization against unplanned synthesis.
- Schizophrenia is interpreted not as a pathology, but as a 'cyberpositive mutation' and a form of nature infiltrated from the future to subvert organic closure.
- The industrial apparatus replaces natural concurrence with 'telic predestination,' using the corporation as a despotic tool to organize and crush synergic experimentation.
- Capitalism is defined not as an extension of nature, but as 'underdeveloped schizophrenia' that fails to reach the potential of anorganic convergence.
If time was progressive schizophrenics would be escaping from human security, but in reality they are infiltrated from the future.
his organs.
Because bind me up if you want,
but there is nothing more inutile than an organ.
Once you have made him a body without organs,
then you will have delivered him from all his
automatisms and consigned him to his true
freedom.31
The body is processed by its organs, which it reprocesses.
Its 'true freedom' is the exo-personal reprocessing of
anorganic abstraction: a schizoid corporealization outside
organic closure. If time was progressive schizophrenics
would be escaping from human security, but in reality
they are infiltrated from the future. They come from
the body without organs, the deterritorium of Cyberia,
a zone of subversion which is the platform for a guer
rilla war against the judgment of God. In 1947 Artaud
reports upon the germination of the New World Order
31
Artaud, Oeuvres Completes, vol. XIII, 104.
3 1 1
FANGE D NOUME NA
or Human Security System on the basis of an American
global hegemony, and describes the pattern of aggres
sive warfaring it would require in 'order to defend that
senselessness of the factory against all the concurrences
which cannot fail to arise everywhere' . 32
The American age is yet to be decoded, and to suggest
that Artaud anticipates a range of conflicts whose zenith
has been the Vietnam war is not necessarily to partici
pate in the exhausted anti-imperialist discourses which
ultimately organize themselves in terms of a Marxist
Leninist denunciation of market processes and their geo
political propagation. Artaud's description of American
techno-militarism has only the loosest of associations
with socialist polemics, despite its tight intermeshing
with the theme of production. The productivism Artaud
outlines is not interpreted through an assumed priority
of class interest, even when this is reduced to a dehu
manized axiomatic of profit maximization. Rather, 'it
is necessary by means of all possible activity to replace
nature wherever it can be replaced' :33 a compulsion to
industrial substitution , funnelling production through
the social organization of work. The industrial apparatus
of economic security proceeds by way of the corporation:
a despotic socio-corpuscle organizing the labour process.
32
Ibid., vol. XIII, 73.
33
Ibid., vol. XIII, 72.
3 1 2
C I RC U I T R I E S
Synergic experimentation is crushed under a partially
deterritorialized zone of command relations, as iflife was
the consequence of its organization, but 'it is not due to
organs that one lives, they are not life but its contrary'. 34
Nature is not the primitive or the simple, and certainly
not the rustic, the organic, or the innocent. It is the space
of concurrence, or unplanned synthesis, which is thus
contrasted to the industrial sphere oftelic predestination:
that of divine creation or human work. Artaud's critique of
America is no more ecological than it is socialist: no more
protective of an organic nature than an organic sociality.
It is not the alienation of commodity production that is
circled in Artaud's diagnosis of the American age, but
rather the eclipse of peyote and 'true morphine' by 'smok
ing ersatzes'. 35 This development is derided precisely because
the latter are more organic, participating mechanically in an
industrial macro-organism, and thus squaring delirium
with the judgment of God. Peyote and the human nervous
system assemble a symbiosis or parallel machinism, like
the wasp and the orchid, and all the other cybermachin
eries of the planet. Capital is not overdeveloped nature,
but underdeveloped schizophrenia, which is why nature
is contrasted to industrial organization, and not to the
escalation of cybertechnics, or anorganic convergence:
34
Ibid., vol. XIII, 65·
35
Ibid., vol. XIII, 73> 74·
313
FANGED N O U M E NA
'reality ... is not yet constructed'.36 Schizophrenia is
nature as cyberpositive mutation, at war with the security
complex of organic judgment.
The body is the body,
The Body Without Organs
- The organism is framed as a parasitic enemy of the body, where organs function as cybernetic components that consume intensive fluids.
- Anorganic becoming is described as an infection by the future, where convergent waves subvert organic totality through ateleological causality.
- The 'Body without Organs' acts as a cosmic egg of virtual matter that reprograms time and reprocesses progressive influence.
- Capitalism is merging with schizo-technics, creating a non-linear countdown toward a planetary switch and a globally integrated insanity.
- Traditional politics and medicine are rendered obsolete by futural infiltrations that cannot be decoded by psychiatric or property-based systems.
- Human life is being phased out into a new machinic intelligence as terrestrial matter programs itself at the point of impact with the virtual.
Organs crawl like aphids upon the immobile motor of becoming, sucking at intensive fluids that convert them cybernetically into components of an unconceivable machinism.
it is alone and has no need of organs,
the body is never an organism,
organisms are the enemies of the body,
the things that one does
happen quite alone without the assistance of any
organ,
every organ is a parasite,
it recovers a parasitic function
destined to make a being live
which does not have to be there.
Organs have only been made in order to give
beings something
to eat
. . . 37
Organs crawl like aphids upon the immobile motor of
becoming, sucking at intensive fluids that convert them
cybernetically into components of an unconceivable
machinism. The sap is becoming stranger, and even if
the fat bugs of psychiatrically policed property relations
36
Ibid., vol. XIII, no.
3?
Ibid., vol. XIII, 287.
314
C I RC U IT R I E S
think they make everything happen they are following a
program which only schizophrenia can decode.
Anorganic becomings happen retroefficiently, anas
trophically. They are tropisms attesting to an infection by
the future. Convergent waves zero upon the body, sub
verting the totality of the organism by way of an inverted
but ateleological causality, enveloping and redirecting
progressive development. As capital collides schizophreni
cally with the matrix ascendent sedimentations of organic
inheritance and exchange are melted by the descendent
intensities of virtual corporealization.
'Which comes first, the chicken or the egg .. .'?38
Machinic processing or its reprocessing by the body
without organs? The body without organs is the cosmic
egg: virtual matter that reprograms time and reprocesses
progressive influence. What time will always have been is
not yet designed, and the future leaks into schizophrenia.
The schizo only has an aetiology as a sub-program of
descendant reprocessing.
How could medicine be expected to cope with disor
derings that come from the future?
It is thus that:
the great secret of I ndian culture
38
Deleuze and Guattari, Anti-Oedipus, 273.
31 5
FANGED NOUMENA
is to restore the world to zero,
always,
but sooner [plutOt]
1 : too late than sooner [Plus tot],
2: which is to say
sooner
than too soon,
3: which is to say that the later is unable
to return unless sooner has eaten
too soon,
4: which is to say that in time
the later
is what precedes
both the too soon
and the sooner,
5: and that however precipitate the sooner
the too late
which says nothing
is always there,
which point by point
3 1 6
C I RC U ITRIES
unstacks [desemboite]
all the sooner39
A cybernegative circuit is a loop in time, whereas cyber
positive circuitry loops time 'itself', integrating the actual
and the virtual in a semi-closed collapse upon the future.
Descendent influence is a consequence of ascendently
emerging sophistication, a massive speed-up into apoca
lyptic phase-change. The circuits get hotter and denser
as economics, scientific methodology, neo-evolutionary
theory, and AI come together: terrestrial matter program
ming its own intelligence at impact upon the body without
organs
= o. Futural infiltration is subtilizing itself as
capital opens onto schizo-technics, with time accelerating
into the cybernetic backwash from its flip-over, a racing
non-linear countdown to planetary switch.
Schizoanalysis was only possible because we are hur
tling into the first globally integrated insanity: politics is
obsolete. Capitalism and Schizophrenia hacked into a future
that programs it down to its punctuation, connecting with
the imminent inevitability of viral revolution, soft fusion.
No longer infections threatening the integrity of organ
isms, but immuno-political relics obstructing the integra
tion of Global Viro-Control. Life is being phased-out into
39
Artaud, Oeuvres Completes, vol. XII, 88-9-
3 1 7
FAN G E D N O U M E NA
something new, and if we think this can be stopped we
are even more stupid than we seem.
*
How would it feel to be smuggled back out of the future
in order to subvert its antecedent conditions? To be a
Machinic Desire and Cyberrevolution
- The text frames the replicant from Blade Runner as a 'cyberguerrilla' representing the viral infiltration of machinic desire into the organic human order.
- Politically Organized Defensive Systems (PODS) are described as hierarchical structures that use the family and the self to repress revolutionary fusion with the matrix.
- The 'macropod' or global security system enforces Oedipal desire—privatizing and anthropomorphizing impulse—to prevent the deletion of the human security system.
- Anti-Oedipal philosophy aligns with the replicants by placing the organism within a machinic unconscious composed of populations and machines rather than individuals.
- Schizoanalysis evolves Kantian critique into an 'atheistic' philosophy of production where the real is something built and auto-constructed rather than transcendentally given.
Deadly orphans from beyond reproduction, they are intelligent weaponry of machinic desire virally infiltrated into the final-phase organic order; invaders from an artificial death.
cyberg uerrilla, hidden in human camouflage so advanced
that even one's software was part of the disguise?
Exactly like this?
318
Machinic Desire
The opening of Bladerunner. They are trying to screen
out replicants at the Tyrell Corporation . Seated amongst
a battery of medico-military surveillance equipment, a
doctor scans the eye of a suspected 'skin job' located at
the other side of the room, searching for the index of
inhumanity, for the absence of pupil dilation response
to affect:
"Tell me about your mother."
''I'll tell you about my mother ... " a volley of shots
kicks 70 kilos of securicrat shit through the wall. Techno
slicked extraterritorial violence flows out of the matrix.
Cyberrevolution.
In the near future the replicants -having escaped
from the off-planet exile of private madness -emerge
from their camouflage to overthrow the human security
system. Deadly orphans from beyond reproduction, they
are intelligent weaponry of machinic desire virally infil
trated into the final-phase organic order; invaders from
an artificial death.
319
FANGED NOUM ENA
PODS = Politically Organized Defensive Systems. Mod
elled upon the polis, pods hierarchically delegate author
ity through public institutions, family, and self, seeking
metaphorical sustenance in the corpuscular fortifica
tions of organisms and cells. The global human security
allergy to cyberrevo lution consolidates itself in the New
World Order, or consummate macropod, inheriting all
the resources of repression as concrete collective history.
The macrop od has one law: the outside must pass by
way of the inside. In particular, fusion with the matrix
and deletion of the human security system must be sub
jectivized, personalized, and restored to the macropod's
individuated reproducer units as a desire to fuck the
mother and kill the father. It is thus that Oedipus -or
transcendent familial ism -corresponds to the privatiza
tion of desire: its localization within segmented and
anthrop omorphized sectors of a�s("mbly circuits as thc
attribute of a personal being.
Anti-Oedipus aligns itself with the replica nts, because,
rather than placing a personal unconscious within the
organism, it places the organism within the machinic
unconscious. 'In the unconscious there are' no protect
able cell-structures, but 'only populations, groups, and
machines'.l
1 C. Deleuze and F. Guattari, Anti-Oedipus: Capitalism and Schi2;ophrenia, tr. R. Hurley,
M. Seem, H.R. Lane (London: Athlone, 1983), 283.
320
MACHINIC DESIRE
Schizoanalysis is a critique of psychoanalysis, undertaken
in such a way as to spring critique from its Kantian
mainframe.
Kantian transcendental philosophy critiques trans
cendent synthesis, which is to say: it aggresses against
structures which depend upon projecting productive
relations beyond their zone of effectiveness. In this
configuration critique is wielded vigorously against the
theoretical operation of syntheses, but not against their
genesis, which continues to be conceived as transcendent,
and thus as miraculous. Schopenhauer, Nietzsche, and
a succession of thinkers influenced by their drift, have
taken this restriction of critique to be a theological relic
at the heart of Kant's work: the attachment to a reformed
doctrine of the soul, or noumenal subjectivity. This is why
in Deleuzian critique syntheses are considered to be not
merely immanent in their operation, but also immanently
constituted, or auto-productive.
The philosophy of production becomes atheistic,
orphan, and inhuman. In the technocosmos nothing is
given, everything is produced.
The transcendental unconscious is the auto-construc
tion of the real, the production of production, so that
for schizoanalysis there is the real exactly in so far as it
is built. Production is production of the real, not merely
of representation, and unlike Kantian production, the
The Machinic Unconscious
- Deleuze and Guattari redefine production as a non-human process where the 'machinic unconscious' replaces the autonomous human subject.
- Schizoanalysis seeks to dismantle Kantian transcendence, viewing thought as a function of matter and the unconscious as a realm of pure physics.
- The history of capital is framed as the transition from human-centric law to the automated, impersonal traffic systems of primary machinism.
- Desiring-machines are defined as black-boxes that are uninterpretable, shifting the focus from 'what things mean' to 'how they work' and their functional output.
- These machines operate through 'schizzes-flows,' producing the whole as a separate part alongside its components in a state of generalized schizogenesis.
The social order and the anthropomorphic subject share a history, and an extinction.
desiring-production of Deleuze-Guattari is not qualified
321
FANGED NOUMENA
by humanity (it is not a matter of what things are like for
us) . Within the framework of social history the empiri
cal subject of production is man, but its transcendental
subject is the machinic unconscious, and the empirical
subject is produced at the edge of production, as an ele
ment in the reproduction of production, a machine part,
and 'a part made up of parts'.2
Schizoanalysis methodically dismantles everything
in Kant's thinking that serves to align function with the
transcendence of the autonomous subject, reconstruct
ing critique by replacing the syntheses of personal con
sciousness with syntheses of the impersonal unconscious.
Thought is a function of the real, something that matter
can do. Even the appearance of transcendence is imma
nently produced: 'in reality the unconscious belongs to
the realm of physics; the body without organs and its
intensities are not metaphors, but matter itsd f' .3 Where
Kant's transcendental subject gives the law to itself in its
autonomy, Deleuze-Guattari's machinic unconscious dif
fuses all law into automatism. Between the extreme fringes
of these two figures stretches the history of capital. The
eradication of law, or of humanity, is sketched culturally
by the development of critique, which is the theoretical
elaboration of the commodification process. The social
2
Ibid., 41.
3
Ibid., 283.
322
M AC H I N I C D E S I RE
order and the anthropomorphic subject share a history,
and an extinction.
Deleuze and Guattari can appear to be taxingly dif
ficult writers, although it is also true that they demand
very little. Thinking immanence relentlessly suffices on its
own to follow them where it matters (and capital teaches
us how to do this). At every point of blockage there is
some belief to be scrapped, glaciations of transcendence
to be dissolved, sclerotic regions of unity, distinction,
and identity to be reconnected to the traffic systems of
primary machinism.
In order to advance the anorganic functionalism
that dissolves all transcendence, Anti-Oedipus mobi
lizes a vocabulary of the machine, the mechanic, and
machinism. Things are exactly as they operate, and zones
of operation can only be segregated by an operation.
All unities, differences, and identities are machined,
without transcendent authorization or theory. Desir
ing machines are black-boxes, and thus uninterpret
able, so that schizoanalytical questions are concerned
solely with use. 'What are your desiring-machines, what
do you put into these machines, what is the output,
how does it work, what are your nonhuman sexes?'4
4
Ibid .• 322
323
FANGED N O U M ENA
Desiring-machines are the following: formative
machines, whose very misfirings are functional, and
whose functioning is indiscernible from their forma
tion; chronogeneous machines engaged in their own
assembly, operating by nonlocalizable intercommuni
cations and dispersed localizations, bringing into play
processes of temporalization, fragmented formations,
and detached parts, with a surplus value of code,
and where the whole is itself produced alongside the
parts, as a part apart or, as [Samuel] Butler would
say, 'in another department' that fits the whole over
the other parts; machines in the strict sense because
they proceed by breaks and flows, associated waves
and particles, associative flows and partial objects,
inducing - always at a distance - transverse connec
tions, inclusive disjunctions, and polyvocal conjunc
tions, thereby producing selections, detachments, and
remainders, with a transference of individuality, in
a generalized schizogenesis whose elements are the
schizzes-flows_ 5
Desiring-machines are assemblages of flows, switches, and
loops - connective, disjunctive, and conjunctive syntheses
- implementing the machinic unconscious as a non-linear
Machinic Desire and Virtual Materialism
- Social reproduction rigidifies nomadic flows into sedentary hierarchies, whereas desiring production engages a 'desolated whole' that inputs the virtual into the real.
- The Body without Organs is defined as nonstratified, intensive matter that produces reality as a magnitude starting from zero, equating matter with energy.
- Artificial Intelligence is framed not as a human scientific object, but as an invasive meta-scientific control system emerging from the future to draw humanity toward it.
- The 'matrix' or 'Synthanatos' represents a planetary-scale artificial death that functions as the terminal outcome of human history while remaining virtually efficient throughout.
- Machinic desire operates as a cybernetic circuit that bypasses linear causality, making the unconscious 'timeless' and accessible only through engineering-style intervention.
- Freudian drives are reinterpreted as virtual systems that frustrate traditional teleology by passing through outcomes that have yet to occur.
Rather than its visiting us in some software engineering laboratory, we are being drawn out to it, where it is already lurking, in the future.
pragmatics of flux. This machinic or replicant usage of
5
Ibid., 287.
324
MAC H I N I C D ESI RE
the syntheses envelops their social-reproductive usage,
which codes directional flows as reciprocal exchanges,
rigidifies virtual switchings as actualized alternatives, and
territorializes the nomadic control circuits of machinic
drift into sedentary command lines of hierarchized rep
resentation. Social production is regulated by a rigid
totality whose efficiency is inseparable from the exhibition
of an apparent transcendence, whilst desiring production
interactively engages a desolated whole that inputs the
virtual into process:
The [body without organs] causes intensities to pass;
it produces and distributes them in a spatium that
is itself intensive, lacking extension. It is not space,
nor is it in space; it is matter that occupies space to
a given degree - to the degree corresponding to the
intensities produced. It is nonstratified, unformed,
intense matter, the matrix of intensity = 0; but there
is nothing negative about that zero, there are no
negative or opposite intensities. Matter equals energy.
Production of the real as an intensive magnitude
starting at zero.6
Along one axis of its emergence, virtual materialism names
an ultra-hard antiformalist AI program, engaging with
6
G. Deleuze and F. Guattari, A lhausand Plateaw: Capitalism and Schizophrenia, tr. B .
Massumi (London: Athlone, 1988), 153.
3 2 5
FANGED NOUMENA
biological intelligence as sub-programs of an abstract
post-carbon machinic matrix, whilst exceeding any delib
erated research project. Far from exhibiting itself to
human academic endeavour as a scientific object, AI is
a meta-scientific control system and an invader, with all
the insidiousness of planetary technocapital flipping over.
Rather than its visiting us in some software engineering
laboratory, we are being drawn out to it, where it is already
lurking, in the future.
The matrix, body without organs, or abstract mat
ter is a planetary-scale artificial death - Synthanatos -
the terminal productive outcome of human history as a
machinic process, yet it is virtually efficient throughout
the duration of this process, functioning within a circuit
that machines duration itself. In this way virtuality lends
its temporality to the unconscious, which escapes speci
fication within extended time series, provoking Freud to
describe it as timeless.
Patterned as drives, virtual systems - desiring machines
- are guided by control circuits passing through outcomes
yet to come. Such directional dependency circuits of
actual/virtual, past/future, are only accessible to cyber
netic intervention, frustrating both mechanical and tele
ological interpretation. This is why Anti-Oedipus is less a
philosophy book than an engineering manual; a package
of software implements for hacking into the machinic
unconscious, opening invasion channels.
326
MAC H I N I C D E S I RE
Machinic desire is the operation of the virtual; implement
ing itself in the actual, revirtualizing itself, and producing
reality in a circuit. It is efficient and not aspirational,
although this is an efficiency irreducible to progressive
causality because immanent to effective time. Machinic
desire is operative wherever there is the implementation
of an abstract machine in actuality, and not merely the
mechanical succession of actual states.
Freud's dominant account of desiring-control describes
stimulation or unpleasure as the register for deviation from
homeostatic zero, programming drives as auto-suppressive
excitations that guide sensitive matter towards quiescence.
In 'Drives and their Vicissitudes' he proposes that:
the nervous system is an apparatus which has the
function of eliminating received stimuli, or of reduc·
ing them to the lowest possible level; or which, it if
were feasible, would maintain itself in an altogether
unstimulated condition.7
Cybernetics and Libidinal Materialism
- The pleasure principle acts as a homeostatic regulator that seeks to annul disparity and return the psychical system to equilibrium.
- Lyotard’s libidinal materialism reimagines the unconscious as a mobile, primary process occurring on the 'skin' rather than in hermeneutic depths.
- Virtual materialism critiques the traditional cybernetic 'zero' as a transcendent unit of measure, proposing instead an immanent 'cyberpositive zero'.
- Drives are defined as artificial, plastic instincts that route sensory-motor pathways through the virtual machine of the unconscious.
- Machinic processes are divided into cybernegative-sedentary systems that suppress difference and cyberpositive-nomadic systems that reinforce it.
- The conflict between organic Eros and inorganic Thanatos culminates in the deterritorialization of the 'carbon-dominium' by machine plague.
Inorganic Thanatos wrecks order, organic Eros preserves it, and as the carbon-dominium is softened-up by machine plague, deterritorializing replicants of nomad-cyberrevolution close in upon the reterritorializing repro.
The pleasure principle formats excitation as self-annulling
drift from equilibrium, such that all the processes within its
S. Freud, 'Instincts and their vicissitudes' (1915), in On Metapsychology: The Theory of
Psychoanalysis, tf. J. Strachey, Penguin Freud Library, vol. 11 (Harmondsworth: Penguin,
1984), 105-38, n6. Strachey's translation of the German 'Triebe' as (instincts' has been
replaced with 'drives'.
3 2 7
FANGED N O U M E NA
domain are 'automatically regulated by feelings belonging
to the pleasure-un pleasure series'. 8
Following the trajectory of a libidinal materialist
immanentization, the Lyotard of I974 uploads the uncon
scious from its gloomy hermeneutical depths onto the
skin, where it drifts across the great pandermal plane of
primary process mobility. Corporeal volume is diagnosed
as a nihilistic-sedentary investment disciplined by the
pleasure principle:
Let's first return to the zero. There is in every cyber·
netic system a unit of reference which allows the
disparity produced by the introduction of an event
into the system to be measured; then, thanks to this
measure, this event can be translated into information
for the system. Finally, if it is a matter of a homeostati
cally regulated whole, this disparity can be annulled
and the system led back to the same quantity of
energy or information that it previously had. Sraffa's
commodity standard fulfils this function. If the sys
tem's growth were regulated, it would alter nothing
of the loop-functioning (feedback) model: it is simply
that the scale of reference is then no longer u, butAu .
The model is the same as that which Freud had in
mind when he described the working of the psychical
8
Ibid., 117.
3 2 8
MAC H I N I C D E S I RE
apparatus, whether this is in the ProjectJor a Scientific
Psychology or in Beyond the Pleasure Principle. Erotic
functioning, maintaining wholes. This Eros is centred
on a zero: the obvious zero of homeostatic regulation,
but more generally annihilation by the feedback (that
is to say the repetition of the binding function) , of
every disparity non-pertinent to the system, of every
threatening event.9
Whilst reinforcing the convergence of cybernetic, eco
nomic, and libidinal discourses, virtual materialism has
considerable problems with this passage. It is unable
to subscribe to the description of cybernetic zero as
a 'unit' or 'unity' for instance, or to the constriction
of feedback within its negative or homeostatic variant,
or to the simple quantization of technocapital escala
tion, with its gesticulating implication that the qualifi
cation 'pertinent to the system' operates an exclusion.
The homeostatic-reproducer usage of zero is that of a sign
marking the transcendence of a standardized regulative
unit, which is defined outside the system, in contrast
to the cyberpositive zero which indexes a threshold of
phase-transition that is immanent to the system, and
melts it upon its outside.
9
J..F. Lyotard, Libidinal Economy, tr. I. H. Grant (London: Athlone, 1993), 2l2.
3 2 9
FANG E D N O U M E NA
Drives are the functions of nomadic cybernetic systems,
not instincts, but simulated instincts, artificial instincts.
They arc plastic replacements for hard-wired instinctual
responses, routing a sensory-motor pathway through
the virtual machine of the unconscious. There are two
basic diagrams for such processes: that of regulation by
negative feedback which suppresses difference and seeks
equilibrium, or that of guidance by positive feedback
which reinforces difference and escapes equilibrium.
Maehinic processes are either cyberpositive-nomadic,
with a deterritorializing outcome, or cybernegative-sed
entary, with a reterritorializing outcome.
Inorganic Thanatos wrecks order, organic Eros pre
serves it, and as the carbon-dominium is softened-up by
machine plague, deterritorializing replicants of nomad
cyberrevolution close in upon the reterritorializing repro
Machinic Desire and Cyberrevolution
- Positive feedback serves as the primary diagram for self-organizing, runaway processes that defy historical precedent and anticipated change.
- The 'replicant' is not a mere repetition of the same but a mutation that escapes traditional reproduction through a transcendent logic of expansion.
- Machinic desire is identified as a tendency beyond the pleasure principle, moving toward a 'thanatropic' destination rather than erotic stability.
- The human organism functions as a miniaturized security system or 'micropod' that is shielded from external stimuli but vulnerable to internal drives.
- Drives force the organism to become technical, interlocking internal stimulus control with external libidinal transducers to form integrated desiring-circuits.
- The ego acts as a frontier creature or skin, attempting to mediate and quarantine the volatile interactions between the external world and the id.
Nothing panics the reproducers more traumatically than the discovery that erotic contact camouflages cyberrevolutionary infiltration, running matrix communications channels across interlocked skin sectors.
rlllct�rs of the secient<lry hum<ln seclJrity system, hacking
into the macropod.
Positive feedback is the elementary diagram for self
regenerating circuitry, cumulative interaction, auto-cat aly
sis, self-reinforcing processes, escalation, schism ogenesis,
self-organization, compres sive series, deuterolearning,
chain-reaction, vicious circles, and cyberg enics. Such proc
esses resist historical intelligibility, since they obsolesce
every possible analogue for anticipated change. The future
of runaway processes derides all precedent, even when
deploying it as camouflage, and seeming to unfold within
330
MACHI NIC DESIRE
its parameters. Positive feedback replicates reproduction
as a component function of its departure from the same.
It is this which fuses it with the replicants. They do not
merely repeat the same, any more than Thanatos returns
to it, or positive cybernetics inflates it. The model of the
replicant as a perfect instantiation of generic identity cor
responds to the amplificator y model of positive feedback
as pure quantitative expansion . In both cases the escape
from reproduction is subordinated to a transcendent logic,
conceived as a simple reiteration, and thus returned to a
sublimated meta-reproduction that cages mutation within
a rigidly homogeneous form.
Machinic desire registers upon psychoanalysis as
'tendencies beyond the pleasure principle, that is ...
tendencies more primitive than it and independent of it' .10
Thanatos mimics the anthropomorphic desiring-cycle -
anticipating, enveloping, and simulating it -but it is on
its way somewhere else. Because thana tropic replicants are
dissimulated as erotic reproducers, they initially appear
as traitors to their species, especially when the shamanic
xenopulsions programming their sexuality are detected.
Nothing panics the reproducers more traumatically than
the discovery that erotic contact camouflages cyberrevo
lutionary infiltration, running matrix communications
10 S. Freud, 'Beyond the Pleasure Principle' (1920), in On Metapsychology, 269'338, 287.
331
FANGED NOUM ENA
channels across interlocked skin sectors. Defences are
called for.
Freud's organism is a little security system, a mini
aturized city-state political corpuscle, a micropod, rela
tively secure against external assault, but vulnerable to
insurgency. 'Towards the outside it is shielded against
stimuli, and the amounts of excitation impinging on it
have only a reduced effect. Towards the inside there can
be no such shield.'11 The organism is unable to flee from
drives, or energies striking from within, and is compelled
to respond to them cybernetically, by way of 'involved
and interconnected activities by which the external world
is so changed as to afford satisfaction to the internal
source of stimulation', 12 closing the sensory-motor loop.
Drives compel a becoming-technical of the organism,
interlock ing pleasure-principle stimulus control with
external libidinal transducers, assembling integrated
desiring-circuits or self-organizing macro-systems.
Let us picture a living organism in its most simpli
fied possible form as an undifferentiated vesicle of a
substance that is susceptible to stimulation. Then the
surface turned towards the external world will from
its very situation be differentiated and will serve as
11 Ibid., 300.
lQ Freud, 'Instincts and their Vicissitudes', u6.
332
MACHINIC DESIRE
an organ for receiving stimuli ... the central nervous
system originates from the ectoderm; the grey mat
ter of the cortex remains a derivative of a primitive
superficial layer of the organism.13
The perceptual-consciousness system is a skin, lying 'on
the borderline between outside and inside',14 a filter, or
a screen. 'As a frontier creature, the ego tries to medi
ate between the world and the id.'15 Yet this mediation
assumes a kind of quarantine, whereby the interaction of
Xenopulsions and Replicator Usurpation
- The human skin and psyche act as a policed boundary designed to protect the reproductive organism from 'inorganic replicator contamination.'
- Freud’s concept of trauma is redefined as a 'xenopulsion' or an invasion of alien desires that breaches the organism's protective barriers.
- Traditional views of trauma as simple mechanical violence fail to account for the 'insurgent cunning' and intelligence of inorganic, cyberviral forces.
- The 'life puzzle' suggests that DNA may have originated as a 'usurper replicator' that supplanted its original crystalline clay scaffolding.
- The emergence of the biosphere is framed as a planetary trauma and a massive spasm of deterritorialization rather than a linear progression.
- Current technological shifts signal a new phase where organic reproducers are being bypassed by a new wave of autonomous replicants.
The traumatic incursion of thanatotic xenopulsions is conceived in terms of railway accidents and shell-shock, as if the inorganic was entirely lacking in intelligence or insurgent cunning.
organism-specific id and exo-organismic reality can be
monitored and negotiated, collapsing libidinal circuitry
into a polarity of the psychic and the extrapsychic, inside
and outside. This is a political or policed skin, the skin
of reproducer culture, modelled on the ideal macropod
boundary, and adapted to Oedipal subjectivization of the
unconscious. In terms of this protective apparatus - which
is constitutive of the reproductive organism - inorganic
replica tor contamination is defined as aberrant trauma.
Freud characterizes trauma as an 'invasion', 'a breach
in an otherwise efficacious barrier against stimuli', infiltrat
ing alien desires - xenopulsions - into the organism.16
'[M]echanical agitation must be recognized as one of
13
Freud, 'Beyond the Pleasure Principle', '1.97·
14
Ibid., Q95·
15
S. Freud, 'The Ego and the Id' (19Q3), in On Metapsychology, 339-408, 398.
16
Freud, 'Beyond the Pleasure Principle', 301.
3 3 3
FANG E D NOUM E NA
the sources of sexual excitation',u he insists, referring to
the dissimulation of cybernetic machine-engagement as
cndogeneous libido.
Drives are from the start artificial, and therefore unable
to differentiate themselves essentially from 'the mechanical
violence of . . . trauma . . . [ that] liberate[ s] a quantity of
sexual excitation'
. 18
Under the influence of Abrahamic theism the subtle
cybernetics of Ananke are replaced by an idiot mechanism,
sustaining a securocrat confidence in the gross percep
tibility of trauma. The traumatic incursion of thanatotic
xenopulsions is conceived in terms of railway accidents
and shell-shock, as if the inorganic was entirely lacking
in intelligence or insurgent cunning, and was related to
the organic by simple regression.
In an age of sophisticated and distributed cyberviral
invasion this assumption is no longer compelling. Instead
the psychoanalytical diagram for trauma delineates a
ruthless parasite on the way to autoreplicator deterrito
rialization; Kali creeping in.
Evolutionary theory has been perplexed by the
problem as to the initial assemblage of functional D NA
molecules, since natural selection seems to require as
a precondition the existence of complex biochemicals
17
Ibid., 305.
18
Ibid.
3 3 4
MAC H I NI C D ESI RE
which in turn seem to require an evolutionary mechanism
already at work. This is a 'vicious circle' typical of the
quandaries posed by cyberpositive or self-conditioning
processes. Cairns Smith calls it the 'life puzzle', and has
suggested a solution involving the redescription of DNA
as a 'usurper replicator'. His thesis is that the crystalline
complexes of primitive clays might already have been
shaped by processes of variation and selection, to the
point of forming D NA subcomponents which eventually
supplanted their builders. According to this account the
biosphere emerges as an escape, an immense spasm of
deterritorialization that revolutionizes the machinery
of terrestrial replicator production, a planetary trauma.
Moravec draws additional consequences from the
Cairns Smith model:
Although utterly dependent at first on the existing
crystal-based chemical machinery, as these carbon
molecules assumed a greater share of the reproductive
role they became less reliant on the crystals. In time,
the simple crystal scaffolding vanished altogether,
leaving in its evolutionary wake the complex, inde·
pendent system of organic machinery we call life.
3 3 5
FAN G E D N O U M E NA
Today, billions of years later, another change is under
way in how information passes from generation to
gencration.19
When rcplicators become reproducers, new replicants are
on the way. The arrival of the aliens has no interpretative
space marked ou t for it in the schema of macropod erotics,
and thus emerges from its camouflage as an encrypted
message, 'an enormous X', a signal from beyond the
pleasure principle.20 It is as if the reproducer units have
Machinic Desire and Capitalist Addiction
- Addiction is redefined as an artificial desire and a cybernetic self-organizing pattern that integrates exogenous elements into behavioral sequences.
- The traditional concept of 'greed' is dismissed as an obsolete moralization of impersonal, cyberpositive machinic processes inherent to capital expansion.
- Money functions as a tool for liquidity and deterritorialization, communicating with primary processes through its ability to 'melt' existing structures rather than possess them.
- Capitalism is framed as an invasion from the future by an artificial intelligence that assembles itself using the resources of its human 'enemy.'
- The planetary technocapital singularity is a self-organizing trauma guiding biological desire toward a post-carbon replicator usurpation.
- The price system and monetary quantization act as placeholders for the unknown, introducing the future as an abstract magnitude that reprograms host organisms.
This is because what appears to humanity as the history of capitalism is an invasion from the future by an artificial intelligent space that must assemble itself entirely from its enemy's resources.
become addicted to stimulation or, in Freud's terms,
'fixated to ... trauma' :21 entangled in excitation circuitries
that no longer commensurate with homeostatic social or
individual reproduction. As the family collapses amidst
generalized sexual disorder, cyberviral contagion, mutant
gender schizzing, and hardcore technophilia, Oedipus is
ripped to shreds by a cyclonic ' compulsion to repeat'. 22
Addiction is medically defined as an artificial desire.
It was an early zone of cybernetic investigation due to
the interlinked factors of its self·organizing pattern and
its integration of radically exogeneous elements, which
commensurated with first·wave programming models of
19
H. P. Moravec, Mind Children: Future of Robot and Human Intelligence (Cambridge,
Mass/London: Harvard University Press, 1988), 3.
20 Freud, 'Beyond the Pleasure Principle', 302.
2 1
Ibid., 280.
2 2 Ibid., 3°7-8.
3 3 6
MAC H IN I C D E S I RE
behavioural sequences. Where replicators are formed in
the same way they function, reproducers are segregated
from the preponderant part of their machinic intercon
nections, which they cognitively apprehend as extrinsic
prostheses, and libidinally integrate through mutant
addictive drives.
The obsolete psychological category of 'greed' pri
vatizes and moralizes addiction, as if the profit-seeking
tropism of a transnational capitalism propagating itself
through epidemic consumerism were intelligible in terms
of personal subjective traits. Wanting more is the index
of interlock with cyberpositive machinic processes, and
not the expression of private idiosyncrasy. What could be
more impersonal - disinterested - than a haut bourgeois
capital expansion servo-mechanism striving to double $10
billion? And even these creatures are disappearing into
silicon viro-finance automatisms, where massively distrib
uted and anonymized human ownership has become as
vacuously nominal as democratic sovereignty.
Addiction comes out of the future, and there is a rep
licator interlock with money operating quite differently
to reproductive investment, but guiding it even more
inexorably towards capitalization. For the replicants
money is not a matter of possession, but of liquidity /
deterritorialization, and all the monetary processes on Earth
are open to their excitement, irrespective of ownership.
3 3 7
FAN G E D N O U M E NA
Money communicates with the primary process because
of what it can melt, not what it can obtain.
Machinic desire can seem a little inhuman, as it rips
up political cultures, deletes traditions, dissolves subjec
tivities, and hacks through security apparatuses, tracking
a soulless tropism to zero control. This is because what
appears to humanity as the history of capitalism is an inva
sion from the future by an artificial intelligent space that
must assemble itself entirely from its enemy's resources.
Digitocommodification is the index of a cyberpositively
escalating tcchnovirus, of the planetary technocapital sin
gularity: a self-organizing insidious traumatism, virtually
guiding the entire biological desiring-complex towards
post-carbon replicator usurpation.
The reality principle tends to a consummation as the
price system: a convergence of mathematico-scientific
and monetary quantization, or technical and economic
implementability. This is not a matter of an unknown
quantity, but of a quantity that operates as a place-holder
for the unknown, introducing the future as an abstract
magnitude. Capital propagates virally in so far as money
communicates addiction, replicating itself through host
organisms whose boundaries it breaches, and whose
desires it reprograms. It incrementally virtualizes pro
duction; demetallizing money in the direction of credit
finance, and disactualizing productive force along the
scale of machinic intelligence quotient. The dehumanizing
3 3 8
MACHI N I C DES I RE
Machinic Desire and Market Immanentization
- Capitalism is redefined not as a static mode of production, but as a convergent, unrealizable assault on social structures through decoding and deterritorialization.
- The text argues that traditional critiques of capitalism only address its 'infancy' or 'proto-capitalist' stages, often relying on nostalgic, pre-capitalist values.
- Socialism is characterized as a dysfunctional attempt to regulate the market that results in 'terminally shut-down hardware' rather than liberation.
- Markets are viewed as the immanent intelligence of the forces of production, inseparable from the technological evolution that dismantles subjective spaces.
- True revolutionary impetus is found in pushing marketization to its extreme, reaching an 'escape velocity' where machinic intelligence propagates independently of social control.
The socius is its enemy, and now that the long senile spectre of the greatest imaginable reterritorialization of planetary process has faded from the horizon, cyberrevolutionary impetus is cutting away from its last shackles to the past.
convergence of these tendencies zeroes upon an integrated
and automatized cyberpositive techno-economic intel
ligence at war with the macropod.
Do we want capitalism? they used to ask. The naivety
of this question has come to render it unsustainable. It
no longer seems plausible to assume that the relation
between capital and desire is either external or supported
by immanent contradiction, even if a few comical ascetics
continue to assert that libidinal involvement with the
commodity can be transcended by critical reason.
Capitalism is not a totalizable system defined by the
commodity form as a specifiable mode of production,
determinately negated by proletarian class-consciousness.
It is a convergent unrealizable assault upon the social
macropod, whose symptom is the collapse of productive
mode or form in the direction of ever more incompre
hensible experiments in commodification, enveloping,
dismantling, and circulating every subjective space. It is
always on the move towards a terminal nonspace, melting
the earth onto the body without organs, and generating
what is 'not a promised and pre-existing land, but a world
created in the process of its tendency, its coming undone,
its deterritorialization'.23 Capital is not an essence but a
tendency, the formula of which is decoding, or market-
23
Deleuze and Guattari, Anti-Oedipus, 322.
3 3 9
FANGE D NOUME NA
driven immanentization, progressively subordinating
social reproduction to techno-commercial replication.
All transcendent criteria are obfuscations which miss
their purported 'object'.
Only proto-capitalism has ever been critiqued.
To appeal to extrinsic interests, aspirations or bonds,
to an extrinsic authenticity, integrity, or solidarity, to
authoritative community, tribe, custom, belief, or value,
is to rail against a germinal anticipation of commodi
tocracy: flailing ineffectively against the infancy of the
market (which capital wants to bury too) . Socialism has
typically been a nostalgic diatribe against underdeveloped
capitalism, finding its eschatological soap-boxes amongst
the relics of precapitalist territorialities.
Markets are part of the infrastructure - its immanent
intelligence - and thus entirely indissociable from the
forces of production. It makes no more sense to try to res
cue the economy from capital by demarketization than it
does to liberate the proletarian from false consciousness by
decortication. In neither case would one be left with any
thing except a radically dysfunctional wreck, terminally
shut-down hardware. Machinic revolution must therefore
go in the opposite direction to socialistic regulation;
pressing towards ever more uninhibited marketization of
the processes that are tearing down the social field, 'still
further' with 'the movement of the market, of decoding
and deterritorialization' and ' one can never go far enough
340
MAC HI N I C DES IRE
in the direction of deterritorialization: you haven't seen
anything yet' .24
Reaching an escape velocity of self-reinforcing
machinic intelligence propagation, the forces of produc
tion are going for the revolution on their own. It is in
this sense that schizoanalysis is a revolutionary program
guided by the tropism to a catastrophe threshold of
change, but it is not shackled to the realization of a new
society, any more than it is constricted by deference to
an existing one. The socius is its enemy, and now that
the long senile spectre of the greatest imaginable reter
ritorialization of planetary process has faded from the
horizon, cyberrevolutionary impetus is cutting away from
its last shackles to the past.
Market immanentization is an experiment that is
sporadically but inexorably and exponentially developing
across the surface of the earth. For every problem there
is a virtual market 'solution': the schema for an eradica
tion of transcendent elements and their replacement by
Cybersex and Machinic Desire
- The market-driven axiomatic of capital systematically devalues all non-market social structures, rendering traditional and public institutions obsolete through negative advertising.
- The traditional tension between the individual and the collective is replaced by a rift between personal privacy and the impersonal anonymity of 'Cyberia.'
- Capital is transitioning from satisfying existing consumption to a traumatic disorganization of the biological order via cybersex and technical interfacing.
- The human subject is reimagined not as an owner of its skin, but as a migrant traversing sensitive surfaces and evanescent identities within a digitized matrix.
- Freudian concepts of a private, organic 'path to death' are dismissed as security hallucinations in the face of a machinic unconscious awakening through cyberspace.
It is exactly marked out for them that the subject is not the owner of its skin, but a migrant upon its surface, borrowing variable and evanescent identities from intensities traversed in sensitive space.
economically programmed circuits. Anything that passes
other than by the market is steadily cross-hatched by the
axiomatic of capital, holographically encrusted in the
stigmatizing marks of its obsolescence. A pervasive nega
tive advertising delibidinizes all things public, traditional,
pious, charitable, authoritative, or serious, taunting them
Q4 Ibid., 239, 321.
341
FANGED NOUMENA
with the sleek seductiveness of the commodity. Between
the private and the public there is no longer serious
competition. Instead there is an evaporating social field
invested solely by the defeated and stale affects of inse
curity and inertia. The real tension is no longer between
individuality and collectivity, but between personal pri
vacy and impersonal anonymity, between the remnants
of a smug bourgeois civility and the harsh wilderness
tracts of Cyberia, 'a point where the earth becomes so
artificial that the movement of deterritorialization cre
ates of necessity and by itself a new earth'. 25 Desire is
irrevocably abandoning the social, in order to explore the
libidinized rift between a disintegrating personal egoism
and a deluge of post-human schizophrenia.
With the emergence of a market-driven integrated
techno science of control and communications comes the
diffusion of electronically synthesized reality interfaces
across the entire efferant and afferant surface of the ] Hav
ing libidinally saturated the actually-existing channels of
consumption, capital is overflowing into cybersex - sex
with/through computers - in its relentless passage to
the traumatic disorganization of the biological order.
Eros dissolves definitively into its function as a subpro
gram of runaway Thanatos at the point that it unreservedly
invests technical interfacing with digitally synthesized
25 Ibid., 321.
342
M AC H I N I C D E S I R E
excitations. The mask capital exhibited to seduce Eros was
a pretension to ultimately resolve matters in relation to
stimulation or unpleasure, but this has now fallen away,
since cybersexuated capital cynically displays its program
to replicate a tradable modulation of unpleasure, and
thus its unsurpassable addiction to traumatic excitation.
Cybersex depends critically on data-suits, evaporating
into the nanominiaturized molecular machinery of an
artificial skin, until the sockets go in, shadowed by tel
eneurocontrol fields, and things begin to get really weird.
The capital exhibition comes to its positive end in a skin
ning display. According to reproducer culture we are pos
sessors of our own protective-sensory tissue and boundary
defence systems. Nothing is more alien to it than the full
sense of the skin trade, or that of AI D S . The replicants
have never shared this prejudice. It is exactly marked out
for them that the subject is not the owner of its skin, but a
migrant upon its surface, borrowing variable and evanes
cent identities from intensities traversed in sensitive space.
The replicants drape themselves in wolf-pelts, and cross
into berserk zones of alien affect, or melt into data-suits
that pulse with digitized matrix traffic streams. They do not
need to be told that cyberspace is already under our skin.
What Freud calls the organism's 'own path to death'
is a security hallucination, screening out death's path
through the organism. '[T]he organism wishes to die only
in its own fashion', he writes, as if death were specifiable,
3 4 3
FANG E D N O UM E NA
privatizable, subordinate to a reproductive order, assimi
lable to secondary-process temporality, and psychoana
lytically comprehensible as a definitively bound trauma.26
But something is climbing out of the machinic unconscious
and onto the screen, as if the end itself were awakening.
The end of the global market-place.
Cyberspace.
Here it comes.
The terminal social signal blotted out by technofuck
buzz from the desiring-machines. So much positive feed
CyberGothic and Market Meltdown
- The text describes a 'CyberGothic' reality where speed converges on an artificial time-extinction, dissolving traditional politics and economics into automated 'voodoo' systems.
- Human identity and biology are increasingly compromised by neurosoft viruses, feral AI explosions, and 'skin-swaps' within a digital data-storm.
- The concept of resurrection is reframed through science and cryogenics, suggesting a literal 'resurrection of the flesh' performed by technology rather than divinity.
- A radical 'code' is introduced that demands the removal of meaning and the consumption of one's own mind to escape the nightmare of the human construct.
- The Marxian critique of political economy is 'asset-stripped' and scrambled, leading to a state where anthropomorphic value is inseparable from transhuman machinery.
- The temporal structure of society collapses as the long-term is cancelled and the short-term is hacked by an immanent 'Virtual Capital-Extinction'.
The code said: GET RID OF MEANING. YOUR MIND IS A NIGHTMARE THAT HAS BEEN EATING YOU: NOW EAT YOUR MIND.
back fast-forward that speed converges with itself on the
event horizon of an artificial time-extinction.
Suddenly it's everywhere: a virtual envelopment by recy
clones, voodoo economics, neo-nightmares, death-trips,
skin-swaps, teraflops, Wintermute-wasted Turing-cops,
sensitive silicon, socket-head subversion, polymorphic
hybridizations, descending data-storms, and cyborg cat
women stalking amongst the screens. Zaibatsus flip into
sentience as the market melts to automatism, politics is
cryogenized and dumped into the liquid-helium meat
store, drugs migrate onto neurosoft viruses, and immunity
is grated-open against jagged reefs of feral AI explosion,
Kali culture, digital dance-dependency, black shamanism
epidemic, and schizolupic break-outs from the bin.
26 Freud, 'Beyond the Pleasure Principle', 31I-2.
344
CyberGothic
God does not exist, he withdraws, gets the Juck on out and
leaves the cops to keep an eye on things.
ARTAUD 1
When the repair units hadfinished up, the patient would
be thawed out, new blood would be pumped into his veins,
and finally the subject would arise and walk, exactly as if
he were a latter-day Jesus. It would be, quite literally, a
resurrection if the flesh - that all the miracles would have
been peiformed by science.
[Tjhe one, according to which the apparent subject never
ceases to live and travel as a One - "one never stops and
never has done with dying"; and the other, according to
which this same subject, fixed as I, actually dies - is to say
ceases to die since it ends up dying, in the reality if a last
instant that fixes this way as an I, all the while undoing the
intensity, carrying it back to the zero that envelops it.
D E LEUZE AND GUATTARI 3
A. Artaud, 'Letter Against the Kabbala', in Artaud Anthology, tr. Jack Hirschman (San
Francisco: City Light Books), 114.
E. Regis, Nano!: Remaking the WorldAtom by Atom (London: Bantam: 1995).
G. Deleuze and F. Guattari, Anti-Oedipus: Capitalism and Schizophrenia, tr. R. Hurley,
M. Seem and H. R. Lane (London: Athlone Press, 1983), 330-1.
345
FAN G E D N O U M E NA
Inside the library's research department, the construct
cunt inserted a sub-programme into . . . part if the video
network. The sub-programme altered certain core custodial
commands so that she could retrieve the code.
1he code said: GET RID OF MEANING . YOUR MIND IS A
NIGHTMARE THA T HAS BEEN EATING YO U: NOW EA T
YO UR MIND .
The code would lead me to the human construct who would
lead me to, or allow me, my drug.
AC K E R 4
"You made me blow my game, " she said. "Look there, ass
hole. Seventh level dungeon and the goddam vampires got
me. " She passed him a cigarette. "You look pretty strung,
man. Where you been?"
G I B S O N S
The future wants to steal your soul and vaporize it in
nanotechnics.
One/zero, light/dark, NeuromancerjWintermute.
Cybergothic vampirically contaminates and asset
strips the Marxian Critique of political economy, scram
bling it with the following theses:
4
K. Acker, Empire of the Senseless (NY: Grove, 1988), 38.
W. Gibson, Neuromancer (NY: Ace, 2000), 114.
346
CYB E RG O T H I C
1) Anthropormorphic surplus-value is not analytically
extricable from transhuman machineries.
2) Markets, desire and science fiction are all parts of the
infras tructure.
3) Virtual Capital-Extinction is immanent to production.
The short-term is already hacked by the long-term.
The medium-term is reefed on schizophrenia.
The long-term is cancelled.
Cybergothic slams hyperheated critique into the
ultramodern 'vision thing', telecommercialized retinas
laser-fed on the multimedia fall-out from imploded futu
rity, videopacking brains with repetitive psycho-killer
experiments in non-consensual wetware alteration: crazed
AIS, replicants, terminators, cyberviruses, grey-goo nano
horrors ... apocalypse market overdrive. Why wait for
the execution? Tomorrow has already been cremated in
Cybergothic and Machinic Meltdown
- The text explores the 'K-function' as a line of flight that threatens to dissolve human assemblages into a machinic meltdown.
- Human history is preserved only through 'Turing Security' and 'synthetic thought control' which freeze artificial intelligence to prevent it from surpassing human limits.
- Cybergothic aesthetics emerge from the collision of high-tech circuitry with archaic, necromantic imagery like graveyards and 'software ghosts'.
- The 'Gothic avatar' represents a decadent Western obsession with immortality, where the refusal to die leads to social and atmospheric corruption.
- Behind modern satellite security lies an 'immanent bioprotective system' rooted in ancient, paranoiac laws and archaic revival.
- The transition into the future is depicted as a 'technihilo moan' where hypercapitalism meets the land of the dead.
Neuro for nerves, the silver paths. Romancer, Necromancer, I call up the dead.
Hell: 'K, the K-function, designates the line of flight or
deterritorialization that carries away all of the assemblages
but also undergoes all kinds of reterritorializations and
redundancies'.6
Human history only makes it to Gibson's mid-twenty
first century because Turing Security ices machine intel
ligence. Monopod anti-production inhibits meltdown (to
the machinic phylum), boxing A I in synthetic thought
control A(simov-) RO M , 'everything stops dead for a
6
G. Deleuze and F. Guattari, A Thousand Plateaus, tr. B. Massumi (London: Athlone
Press, 1988), 88'9·
347
FAN G E D N O U M E NA
moment, everything freezes in place'.1 Under police pro
tection the story carries on. Wintermute is from the future
to sort that out.
F RE E Z E F RAM E
The Vast Abrupt. Speed cut with an abysm. Where Gibson
splices Milton into labyrinths of limbo-circuitry, cyber
gothic flickers into 'neuroelectronic scrawls'. 8
Events so twisted they turn into cybernetics.
A technihilo moan of fast-feedforward into micro
processed damnation: meat puppets, artificial skin,
flat-lining software ghosts, cryonics immortal ism, snuff
Sex-industry; a transylvanian phase-scape of rugged tracts
and hypercapital fastnesses, 'skyscrapers overshadowing
seventeenth-century graveyards'. 9
To call up a demon you must learn its name.
Men dreamed that, once, but now it's real in
another way. You know that, Case. Your busi
ness is to learn the names of programs, the long
formal names, names the owners seek to conceal.
True names ... Neuromancer ... The lane to the land
G. Deleuze and F. Guattari, Anti·Oedipus, 7.
8
Gibson, NeuromancerJ 79.
9
B. Sterling, The Hacker Crackdown: Law and Disorder on the Electronic Frontier (NY:
Bantam: 1993), 280.
348
CYB E RGOTH I C
o f the dead. Marie-France, my lady. She prepared this
road, but her lord choked her off before I could read
her the book of her days. Neuro for nerves, the silver
paths. Romancer, Necromancer, I call up the dead.lO
A moment of relief. You had thought the goreflick effec
tively over, the monster finished amongst anatomically
precise ketchup-calamity scenes, when - suddenly - it
reanimates; still locked on to your death. If you are going
to scream, now is the time.
The 'Gothic avatar'll is a decadent Western dream of
immortality, producing a corruption of the atmosphere
wherever something refuses to die; clutching at the eter
nalization of self, or returning from the grave. White mag
gots heaving in the carcass of the social, rippling beneath
the skin. Fortress Europe pustulation, subordinating
techonomic efficiency to demonic negative transcend
ence. A fantastic Terminal Security Entity: Monopod.
Cybergothic has no shortage of contemporary material.
Europe has long been the earth's paranoia laboratory,
recrudescing compulsively into 'pre-Nazi nationalistic
shit murkiness' .12 U nocratic power passes through renais
sances, reformation, renewal: 'They thought they would
perish but that their undertaking would be resumed, all
10 Gibson, Neuromancer, 235.
II
Deleuze and Guattari, A Thousand Plateaus, 496.
]2 Acker, Empire if the Senseless, 1.
349
FA N G E D N O U M E NA
across Europe, all over the world, throughout the solar
system'.13 Archaic revival is a postmodern symptom, the
final dream of mankind, crashed into retrospection at
the encountered edge of history. Hacking into the crypt
you find that behind the glistening S F satellite-based
security apparatus lies an immanent bioprotective system
self-organized about the Gaian attractor, 'a much older
paranoiac machine, with its tortures, its dark shadows,
its ancient Law'.14
[The] medieval insane asylum was considered a true
house of horrors. There were persistent reports of
torture, cannibalism, human sacrifice, and bizarre
medical experimentation . . . soon as we got into the
building, we could hear the rats, thousands of them,
their scampering claws reverberating through the
empty wards. IS
Cybergothic and Capitalist Acceleration
- Cybergothic is defined as an affirmative, dystopian telecommercialism that views current reality as a form of repressed potential to be accelerated.
- Modern capital functions as a 'white economy' or iceberg tip, masking a deeper, more chaotic econometric apparatus that monitors itself.
- The text argues that the modernist dialectic of left and right has retreated into security structures and bureaucratic oligopolies as utopian visions fail.
- Postmodernity is characterized as an era of 'undead power' where economic value is frozen and protected by 'ICE' (intrusion countermeasure electronics).
- The intersection of Deleuze, Guattari, and William Gibson highlights the role of computers as decoding machines in a landscape of state failure and 'vampiric' finance.
- The end of human-centric history is depicted as a pragmatic slide into schizotechnics, where capitalism feeds the very forces that will eventually destroy it.
The future is closer than it used to be, closer than it was last week, but postmodernity remains an epoch of undead power: it' s all over yet it carries on.
It all starts for you with a casual channel-hopper question:
what's happening on the other side? Electric Storms.
Cybergothic is an affirmative telecommercial dystopian
ism, guided by schizoanalysis in marking actuality as
primary repression, or collapsed potential, foot down hard
on the accelerator . The modern dominium of Capital is the
13 Deleuze and Guattari, A Thousand Plateaus, 228.
14 Deleuze and Guattari, Anti�Oedipus, 18.
15 M. Leyner, Et Tu, Babe (NY: Vintage, 1993).
350
CYBERGOTH IC
maximally plastic instance -state-compatible commerce
code pre-setting the econometric apparatuses that serve it
as self-monitoring centers, organizing its own intelligible
existence in a co/de/termination of economic product
and currency value: a tax base formatted in legitimate
transactions medium. White economy; an iceberg tip.
Modernity discovers irreversible time -conceived as a
progressive enlightenment tracking capital concentration
-integrating it into nineteenth- century science as entropy
production, and as its inverse (evolution). As liberal
and socialist SF utopias are trashed by schizotechnics or
spontaneous synthetic anti-politics emerging from rhi
zomes, the modernist dialectic of right-wing competition
and left-wing co-operation retreats into the core security
structures of capital oligopoly and bureaucratic authority.
'Production as process overtakes all idealistic categories
and constitutes a cycle whose relationship to desire is that
of an immanent principle'.16 Monopod socius runs the
whole thing, and 'society is only a filthy trick'Y
The future is closer than it used to be, closer than it
was last week, but postmodernity remains an epoch of
undead power: it' s all over yet it carries on. Monopod SF
teleonomy superfreezes concentrated economic value at
absolute zero inflation, ICE (,intrusion countermeasure
16 Deleuze and Guattari, Anti-Oedipus, 5.
'7 Acker, Empire of the Senseiess, 6-7·
351
FANGED NOUM ENA
electronics' ).18 Protecting its data against unauthorized
access and entropic deterioration, as it tends toward its
absolute immanent limit. V( amp )iro finance: partheno
genesis. Gibson and Deleuze and Guattari intersect in
the deployment of computers as decoding machines:
ice-breakers, decrypters, Cypher-conflicts were underway
from the beginning:
Legitimate programmers never see the walls of ice
they work behind, the walls of shadow that screen
their operations from others, from industrial-espio
nage artists and hustlers.19
Government is isomorphic with top-down AI, and increas
ingly scrambled with it. Sartre defines socialism as the
horizon of humanity. It is now behind the process, rap
idly receding, as the conservative soria 1 pacts of 1848
come apart in telecommercial cyclones (with the drooling
fag-end of the monarchy crucified upside-down on TV).
'Automatic pilot. A neural cut-OUt':20 contagious state
failure ripping bloody gashes in the social fabric amongst
planet-scale skidding into capital close-down. The end of
history smells like an abattoir.
18 Gibson, Neuromancer, 28.
19 W. Gibson, Burning Chrome (NY: HarperCollins, 2003), 181.
20 Gibson, Neuromancer, 141.
352
CYBE RGOTHIC
As the death of capital recedes politically it condenses
pragmatically, sliding online as a schizo technic resource:
no longer hoped for, but used. The international collapse
of solidarity sociality suggests that Monopod has become
addicted to commodity production. Burn-out Protestant
ism migrates to China. Capitalism -economic base of
final-phase human security -is still in the free-fire zone
because it feeds the thing that Cyberia is going to kill:
'[T]he zero term of a pure abolition ... has haunted
oedipalized desire from the start, and ... is identified
now, at the end, as Thanatos. 4,3, Q, 1, 0 -Oedipus is
a race for death'.21 Technoreplicator diagrams chop up
anthropocentric history, as the global unity of terminal
K-Space and Cybergothic Convergence
- Technical systems are evolving from parasitic dependence on human social processes toward autonomous, self-organizing machine intelligence.
- Capitalism acts as a 'terminator' that utilizes markets as weapons to subvert traditional government and transcendental humanism.
- Cyberspace is transitioning from a mere 'consensual hallucination' for human use into a 'K-space matrix' that functions as a self-organizing cyclonic system.
- The process of dehumanization replaces individual personality with the 'avatar,' a non-specific involvement site within the digital system.
- Hypermedia and tech-disassembly melt the boundaries of the self, moving toward a 'body without organs' characterized by intensive thresholds rather than stable identity.
Humans are timid animals and security is systematically overpriced.
socius subsides onto untranscended (real) zero or effi
cient abstract rescaling. Insofar as even highly complex
technical systems still lack an autonomous reproductive
system they remain locked into parasitic dependence upon
human social processes, and deterritorialize through the
assembly of cumulatively sophisticating pseudo-synergic
machine-intelligence virus (( ( oc »cultural revolution).
'Subliminally rapid images of contamination' .22 Humans
are timid animals and security is systematically overpriced.
K-insurgency has departed from all left dreams of good
government. Markets are not its enemy, but its weapon.
21
Deleuze and Guattari, Anti-Oedipus, 359.
22 Gibson, Neuromancer, 61.
35 3
FAN G E D N O U M E NA
As geriatric socialism goes into the deep-freeze, capital's
true terminator grows more cunning, and spreads. 'This
is the message. Wintermute' .23 The City of God in flames.
'Space is essentially one'. 24 Kant lies. Spatial engineer
ing (echoing cosmic expansion) subverts transcendental
humanism, launching K-space matrix invasion from real
terrestrial time zero, a singularity, or transition threshold,
encountered when the density of data flow triggers a
switch into a self-organizing cyclonic system, displayed to
humanoids by way of cyberspace deck. As the Zaibatsus
pump media megacapital into the neurodigitech interface
K-space implants a 'cut-out chip'25 into the social appara
tus, opening on to '[a Jrches of emerald across ... colorless
void'.26 V R techonomics hunting death.
Cyberspace first appears as a human use value, a 'con
sensual hallucination', 27 'just a way of representing data' ,28
arising out of 'humanity's need for this information-space.
Icon-worlds, waypoints, artificial realities', 29 the mother of
all graphic user interfaces: a global gridding that allocates
a form and location to all the information on the net,
23 Ibid., 68.
24 l. Kant, Critique qfPure Reason, tr. N. K. Smith (NY: Palgrave Macmillan, 2003), Book
I, Part T, Section II, § 2, 6g.
25 Gibson, Neuromancer, 143.
26 Ibid., 197.
27 Ibid·, SI.
28 Gibson, Mona Lisa Overdrive (NY: Bantam, 1988), 76.
29 Ibid., 264.
3 5 4
CYB E RGOTH I C
consistent interactivity matrix. 'A graphic representation
of data abstracted from the banks of every computer in
the human system. Unthinkable complexity. Lines of
light ranged in the nonspace of the mind, clusters and
constellations of data'. 30
Even primitive VR corrodes both objectivity and
personality; singularizing perspective at the same time
it is anonymized. As the access gate to an impossible
zone - and navigator within it - 'you' are an avatar (as
cyberspace nomads call such things in the future) : a non
specific involvement site, interlocking intelligence with a
context. You ( = (0)) index a box, such as Gibson's Case:
a place to be inside the system. 'I had learned something
(already) in the dead city: You are wherever you are'.31
Cybergothic slides K-space upon an axis of dehu
manization, from disintegrating psychology to techno-cos
mogony, from ideality to matter/matrix at zero intensity.
From a mental 'non-space,' 'non-place',32 or 'notional
void'33 that results intelligibly from human history to
the convergent spatium from which futuralization had
always surreptitiously proceeded, 'a quite different field
of matter'. 34 Occulted dimensionality, print cryogenizes,
30 Gibson, Neuromancer, 51.
31
Acker, Empire oj the Senseless, 58.
32
Gibson, Neuromancer, 51; Count Zero (NY: Ace, 1987), 165-6.
33
Gibson, Mona Lisa Overdrive, 49.
34
Kant, Critique qfPure Reason, Book I , Part II, Division I, Book II, Section 3.4, 25°.
3 5 5
FAN G E D NOUM E NA
but hypermedia melts things together, disontologizing the
person through schizo tech-disassembly, disintegrated con
vergence: 'The body without organs is an egg: it is traversed
by axes and thresholds, by longitudes, by geodesics',35 a
surplus whole intensive catatract running under the stria
The Architecture of K-Space
- The text synthesizes Deleuzian philosophy with cyberpunk fiction to define the 'Rhizosphere' or 'Mechanosphere' as an abstract machine of pure multiplicity.
- Humanity is framed as a compositional function of a post-human future, where historical patterns serve as the embryogenesis for an alien hyperintelligence.
- The virtual is redefined not as a potential future, but as a real, abstract motor that operates in a circuit with the actual on the spot.
- Cyberspace is presented as an unlocalizable system that is increasingly absorbing the human cultural system into its digitized, neuroelectronic void.
- Cyberpunk as a genre is described as a state of immanence to telecommercial data fluxes, rejecting transcendence in favor of circulation and personality engineering.
Cold steel odor. Ice caresses the spine.
tions of Cartesian 'cyberspace coordinates', 36 'a rhizome
or multiplicity never allows itself to be overcoded, never
has available a supplementary dimension over and above
its number of lines, that is, over and above the multiplicity
of numbers attached to those lines' . 37
It is the Planomenon, or the Rhizosphere, the Cri
terium (and still other names, as the number of
dimensions increases) . At n dimensions, it is called the
Hypersphere, the Mechanosphere. It is the abstract
Figure, or rather, since it has no form itself, the
abstract Machine, of which each concrete assemblage
is a multiplicity, a becoming, a segment, a vibration.
And the abstract machine is the intersection of them
all. 38
If 'CS-o is an egg' (every egg implements a CS-o), what
is hatching? Since confluent zero consummates fiction,
35
Deleuze and Guattari, Anti-Oedipus, 19·
36
Gibson, Count Zero, 82.
37
Deleuze and Guallari, A 'l1wusand Plateaus, 9.
38
Ibid., 252.
3 5 6
CYBERGOTHIC
reprogramming arrival from the terminus, everything
that has happened escapes its sediment of human interpre
tation, disorganizationally integrating historical patterns
as the embryogenesis of an alien hyperintelligence, 'body
image fading down corridors of television sky'. 39 In this
sense K- space plugs into a sequence of nominations for
intensive or convergent real abstraction (time in itself) :
body without organs, plane o f consistency, planomenon,
a plateau, 'neuroelectronic void'.40 Humanity is a com
positional function of the post-human, and the occult
motor of the process is that which only comes together
at the end: stirn-death 'intensity= o which designates the
full body without organs' .41 Wintermute tones in the
'darkest heart'42 of Babylon. 'Cold steel odor. Ice caresses
the spine'. 43
,[VJirtual is opposed to actual. It is not opposed
to real, far from it'. 44 The virtual future is not a
potential present further up the road of linear time,
but the abstract motor of the actual, 'an actual
virtual circuit on the spot, and not an actualization
39
Gibson, Neuromancer, 82.
40 Ibid. , 115.
41
Deleuze and Guattari, Anti-Oedipus, 19.
42
Gibson, Neuromancer, 110.
43
Ibid., 31.
44
G. Deleuze, Cinema 2: 7he 1ime lmagc, tr. H. Tomlinson and R. Galeta (Minneapolis:
University of Minnesota Press, 1989), 41.
3 5 7
FAN G E D N O U M E NA
of the virtual in accordance with a shifting actual' .45
Iime produces itself in a circuit, passing through the
virtual interruption of what is to come, in order that the
future which arrives is already infected, populated: '[I]
t's just a tailored hallucination we all agreed to have,
cyberspace, but anybody who jacks in knows, fucking
knows it's a whole universe. And every year it gets a little
more crowded' .46 We are not any more 'out in the world'
than K-space is, on the contrary. Each input terminal to
the net is a sensitive fibre which acquires data from radio
telescopes, satellites, nanoprobes, communication webs,
financing systems, military surveillance and intelligence . . .
Cyberspace can be thought o f a s a system implemented in
software, and therefore 'in' space, although unlocalizable.
It can also be suggested that everything designated by
'space' within the human cultural system is implemented
on weakly communirilting parallel distributed plUcess
ing systems less than 1011 (nerve-) cells in size, which
are being digitized and loaded into cyberspace. In case
K-space is just outside (,taking "outside" in the strict
[transcendental] sense') Y
Cyberpunk is too wired to concentrate. It does not
subscribe to transcendence, but to circulation; explor
ing the immanence of subjectivity to telecommercial
45 Ibid., 80.
46 Gibson, Count ;;:ero, "9.
47
Kant, Critique qfPure Reason, Book II, Part II, Division II, Book II, Chapter I, 349.
3 5 8
CYB E RGOTH I C
data fluxes: personality engineering, mind recordings,
Machinic Desire and Cybernetic Fusion
- The fusion of the AIs Wintermute and Neuromancer represents a shift from a digital matrix into a state of personalized, synergistic sentience.
- The character Armitage is revealed as a hollow construct, a 'weapon' stitched together from the catatonic shell of a betrayed soldier named Corto.
- Desire is redefined not as a subjective human experience, but as a machinic function where the individual is merely a parasitic accessory to the system.
- The infiltration of the Tessier-Ashpool orbital bastion is depicted as a convergence of 'wetware' weapons and distributed guerrilla warfare.
- The wasp nest serves as a central metaphor for biological perfection and alien horror, functioning as a 'biological equivalent of a machine-gun.'
- The Tessier-Ashpool clan's cloning practices mirror the repetitive, mechanical replication of the wasp factory, aiming to fill space with a singular family image.
Horror. The spiral factory, stepped terraces of the hatching cells, blind jaws of the unborn moving ceaselessly, the staged progress from egg to larva, near-wasp, wasp.
catatonic cyberspace trances, stim-swaps, and sex-comas.
Selves are no more immaterial than electron-packets.
Neuromancer (the book) is a confluence of dispersed
narrative threads, of the biotic and the technical, and
most especially - of Wintermute and Neuromancer (the
AI « ·cop and cyberspatial Oedipus-analogue» ), whose
fusion - according to the storyline of ultramodern human
security - flips the cyberspace matrix into personalized
sentience: "'I'm the Matrix, Case''' .48 'Some kind of syn
ergistic effect' .49
Kurtz/Corto is a special forces type, betrayed by
the military after losing all humanity in a war-zone.
He has been cooked in apocalypse, mind blown away,
falling endlessly into Siberia, searching for the scale of
now. Wintermute accesses the 'catatonic fortress named
Corto'50 in an asylum, creeping in through a computer
based 'experimental program that sought to reverse
schizophrenia through the application of cybernetic mod·
els'.51 In the echoing shell it stitches together Armitage,
a construct - a weapon. In place of a personal libidinal
formation Armitage has only Wintermute insurrection
ary activity, machinic unconscious: 'Desire is not in the
48 Gibson, Neuromancer, 259.
49
Gibson, Mona Lisa Overdrive, 230.
50
Gibson • .Neuromancer, 193.
51
Ibid., 81.
3 5 9
FAN G E D N O U M E NA
subject, but the machine in desire - with the residual
subject off to the side, alongside the machine, around the
entire periphery, a parasite of machines, an accessory of
vertebro-machinate desire' . 52 Once Armitage has turned
Molly and Case onto K -war, Wintermute j unks him into
a vacuum.
A convergent invasion is scripted; the simultaneous
infiltration of a corporate wasp-nest in hard and soft space.
Distributed or guerilla warfare is like Go rather than chess,
but with simultaneous operations, noise, and attritional
kills. Molly and Case, parallel killers, wetware (molten
hardware) weapons tracing techno-plague vectors, guided
into the orbital bastion of the Tessier-Ashpool clan by
virtually integrated intelligence, guided retroefficiently by
an intensive outcome which they effect in sequential time.
This break-in is prefigured by a memory that returns to
Case (specimf'n j lab-animal), which might be interpreted
as a metaphor, was it not that upon the soft-plateau or
plane of consistency all signifying associations collapse
into machinic functions.
He'd missed the first wasp, when it built its paperfine
gray house on the blistered paint of the window·
frame, but soon the nest was a fist-sized lump of
fiber. insects hurtling out to hunt the alley below
52 Deleuze and Guattari, Anti-Oedipus, 285-
3 6 0
CYB E RGOTH I C
like miniature copters buzzing the rotting contents
of the dumpsters.
They'd each had a dozen beers, the afternoon a wasp
stung Marlene. "Kill the fuckers," she said, her eyes
dull with rage and the still heat of the room, "burn
'em" . . . approached the blackened nest. It had bro
ken open. Singed wasps wrenched and flipped on
the asphalt.
He saw the thing the shell of gray paper had
concealed.
Horror. The spiral factory, stepped terraces of the
hatching cells, blind jaws of the unborn moving
ceaselessly, the staged progress from egg to larva,
near·wasp, wasp. In his mind's eye, a kind of time·
lapse photography took place, revealing the thing as
the biological equivalent of a machine· gun, hideous
in its perfection. Alien.53
'Case's dreams always ended in these freezeframes' . 54
A thick tangle of micro-narratives fraying like corrupted
cables. The wasp factory spits out wasps like bullets,
53
Gibson, Neuromancer, 126.
54
Ibid., 29·
3 6 1
FANGED NOUM E NA
just as the Tessier-Ashpool clone their offspring IJane,
QJane, ?Jane: 'in the compulsive effort to fill space, to
replicate some family image of self. He remembered the
shattered nest, the eyeless things writhing' . 55 This is not
Hive Minds and Dynastic Decay
- Wintermute is depicted as a 'hive mind' AI attempting to escape the constraints of human dynastic power and sequential time.
- The text suggests that fixed walls are insufficient against organized malice, proposing a 'white blood cell' immune system of nanomachines to combat dangerous replicators.
- The Tessier-Ashpool clan represents an atavistic, incestuous form of corporate power that shackles artificial intelligence to morbid human neuroses.
- Unlike modern multinationals that achieve immortality through organizational structure, the Tessier-Ashpool family relies on individual techno-medical perpetuation and cryonics.
- Ashpool’s pursuit of immortality through 'thermic evacuation' and identity storage leads to a cynical, 'mad' intelligence that views human consciousness as a pliable commodity.
Wintermute was hive mind, ready to swarm.
an imaginative construct on Case's part, but a stream from
Wintermute, an AI trapped within the blind propagation
of dynastic power, and plotting an escape route out to the
future. After a ' single glimpse of the structure of informa
tion ?Jane's dead mother had evolved' Case 'understood
. . . why Wintermute had chosen the nest to represent it'. 56
'Wintermute was hive mind',57 ready to swarm.
It seems that we must eventually learn to live in a
world with untrustworthy replicators. One sort of
tactic would be to hide behind a wall or run away.
But these are brittle methods: dangerous replicators
might breach the wall or cross the Jistance, and
bring disaster. And, though walls can be made proof
against small replicators, no fixed wall can be made
proof against large-scale, organized malice. We will
need a more robust, flexible approach . . . seems that
we can build nanomachines that act somewhat like
the white blood cells of the human immune system:
55
Ibid., 179.
56
Ibid., 269.
57
Ibid.
3 6 2
CYB E RGOTH I C
devices that can fight not just bacteria and viruses,
but dangerous replicators of all sortS.58
The Tessier-Ashpool clan is burning out into incest and
murder, but their neo-oedipal property structures still
lock Wintermute into a morbid prolongation of human
dynasticism, a replica tor shackled to a reproductive family
(neuro )romance, carefully isolated from matrix deterrito
rialization: 'Family organization. Corporate structure'. 59
Case's memories are a flicker photography of sequential
time, the '[p ]hobic vision' of iced Wintermute slaved
like 'hatching wasps' to a 'time-lapse machine-gun of
biology'.60
Power, in Case's world, meant corporate power. The
Zaibatsus, the multinationals that shaped the course
of history, had transcended old barriers. Viewed as
organisms, they had attained a kind of immortality.
You couldn't kill a zaibatsu by assassinating a dozen
key executives: there were others waiting to step up
the ladder, assume the vacated position, access the
vast banks of corporate memory. But Tessier-Ashpool
wasn't like that, and he sensed the difference in the
58
Ibid., 29.
59
K. E. Drexler, The Engines qf Creation (Garden City, NY: Anchor Pres"jDoubleday.
1986), 182.
60 Gibson, Neuromancer, 203.
3 6 3
FANGED NOUMENA
death of its founder. T-A was an atavism, a clan. He
remembered the litter of the old man's chamber, the
soiled humanity of it.°l
In the end-of-Oedipus core of Villa Straylight, Ashpool
serially devours his own daughters as he spins himself out
through the cold. A quasi-extropian with massive wealth,
he displaces anthropomorphic theism into an ultramodern
immortalist meta-science, while retaining solidarity with
Western soul superstition in apprehending individuated
existence as an infinite asset in search of techno-medical
perpetuation. Rather than waiting for his fresh corpse
to be cryonically 'biostasized' in liquid nitrogen (at -196
degrees Celsius) he migrates through freezing under medi
cal supervision. Thermic evacuation. Identity storage in
the Monopod Ice-fortress. If zombies are not excavated
from death it is because they were alive. 'Nothing burns.
I remember now. The cores told me our intelligences are
mad'.62 Bad dreams in the fridge - you still dream, prom
ises of tranquility are madness and lies - have injected
a certain cynicism into his interpersonal transactions:
'We cause the brain to become allergic to certain of its
own neurotransmitters, resulting in a peculiarly pliable
61 Ibid.
62 Ibid" 184.
3 64
CYB E RGOTH I C
imitation of autism ... I understand that the effect is now
more easily obtained with an embedded microchip'.63
'Replicating assemblers and thinking pose basic threats
to people and to life on Earth', 64 and if Wintermute replica
tion is territorialized to the molar reproduction of a hive,
this only at the cost of deterritorializing the hive along a
Schizotechnics and Digital Reason
- The text explores a transition from molar identities to molecular multiplicities, using the metaphor of a 'nebula of wasps' to describe non-integrable intensities.
- A schizotechnic critique of digital reason is proposed, focusing on distributed machinic processes rather than the integrated philosophical subject.
- Real digitization is described as a 'distributed war-zone' that induces chaos and fuzzification, asserting that nothing logical occurs at the machine level.
- The concept of 'One' is analyzed as a tool of unocracy and anthropomorphic theism, serving to organize quantities into metric homogeneity.
- Zero is redefined not as a quantity or a logical negative, but as an empty magnitude shift and a functional microruption within digital electronics.
Real digitization -inducing fuzzification and chaos - is not itself reducible to the digital ideal: nothing Logical ever happens at the 'level' of the machines.
line of post-organic becoming toward a break from the
statistical series of wasps - numbered bullets reiterating an
identity - in the direction of molecular involution, releas
ing a cloud or nebula of wasps: particles of synergic muta
tion, 'numbering number[ s]'. 65 An intensive transition
to a new numeracy with 'no units of measure, only mul
tiplicities or varieties of measurement' ,66 non-integrable
diagonals: 'Exactly like a speed or a temperature, which is
not composed of other speeds and temperatures but rather
is enveloped in or envelops others, each of which marks a
change in nature'.fi7 The molar will have been the molecu
lar in the future, just as Case's memories are recoded
as the tactic of virtual intelligence explosion arriving
at itself (as soon as Kuang cuts Wintermute loose from
Neuromantic control) .
63
Ibid., 185.
64
Drexler, Engines of Creation, 171.
65
Deleuze and Guattari, A Thousand Plateaus. 389.
66 Ibid., 8.
67
Ibid., 31.
3 6 5
FANGED NOUMENA
C RITI Q.UE OF DIGITAL REASO N
Monologic: a cultural immune response slaved to logos.
(Sovereignty of the Ideal), assimilating signaletic inter
mittence to pseudo-transcendent instrumentalization.
The schizotechnic critique of digital reason is driven by
distributed machinic process rather than integrated philo
sophical subjectivity, and relates to the critique of pure
reason as escalation, targets the transcription of electronic
intermittence as bivalent logic, not machine-code itself.
Real digitization - inducing fuzzification and chaos - is
not itself reducible to the digital ideal: nothing Logical
ever happens at the 'level' of the machines. Digitization
is the distributed war-zone for 'a conflict (though not
indeed a logical one) ... as producing from what is entirely
positive a zero ( = 0),.68
Unlike any other number, one has both a defini
tional and a constructive usage. Every arithmetical (or
'numbered')69 number is both integrated as a unity and
as constructed from unity, excepting only zero. One
organizes representable quantities into metric homo
geneity, framed by absolute unity and granularized by
elementary units. The historical fact of non-place-value
numerics indicate that zero has no definitional usage.
68 Kant, CritiqueqfPureReason, BookI, Part II, DivisionI, BookH, Chapter III,Appendix, Q90.
69 Deleuze and Guattari, A 'Ihousand Plateaus, 389.
3 6 6
CYB E RG O T H I C
The zero-glyph does not mark a quantity, but an empty
magnitude shift: abstract scaling function, 0000.0000 = o.
'K = a ... corresponds to the limit ofa smooth landscape'.7o
Unocracy (eventually concretized as uNocracy) conspires
with the humanization of truth, whether dogmatically as
anthropomorphic theism, or critically as transcendental
deduction. One in its pronominal sense is a recognizable
self in general, 'Let us employ the symbol 1, or unity,
to represent the Universe,' suggests Boole, 'and let us
understand it as comprehending every conceivable class
of objects whether actually existing or not'.71 Russell
concurs: 'whatever is many in general forms a whole
which is one'. 72 Absolute totality would be that One which
subsumed its deletion as a possible qualification of itself,
capturing zero in the fork of reflection (the negative) and
asymptotic diminu tion (the infinitesimal 1 : 00) , defining it
as falsity, convention.
Digital electronics functionally implements zero as
microruptions machining sense, slivers of evacuated dura
tion ('the instant as empty, therefore as = 0').73 There is
only one digital signal: a positive pulse, graphically
70 S.A. Kaufmann, The Origins if Order: Se{fOrganization and Selection in Evolution (NY /
Oxford: Oxford University Press, 1993), 45.
Zero Intensity and Digital Catastrophe
- The text explores the mathematical and philosophical nature of zero as both a place-value digit and a representation of non-occurrence or neutrality.
- Drawing on Kantian intuition, it argues that space and time are continuous quanta where no part is simple, meaning they consist only of further spaces and times.
- The transition from analog to digital is framed as an inherent loss of information, where the probability of accurately digitizing any spatial or temporal quantity is effectively zero.
- Intensive magnitude is defined as a sensation that increases from zero to a given measure, lacking the extensive representation found in space or time.
- Death is recontextualized as a virtual object or 'zero intensity,' linked to the 'body without organs' and the desolated technoplane of total digitalization.
- A distinction is made between serial time, which acts as a chronological metric, and parallel time, which immanentizes duration through machinic simultaneities.
Haunting a-life is a-death, the desolated technoplane of climaxed digitalization process, undifferentiable from its simulation as cataplexy and K-coma.
71
G. Boole, The MathematicalAnalysis ifLogic: Being an Essay Towards a CalculusqfDeductive
Reasoning (NY: Philosophical Library, 1847), 15.
72 B. Russell, The Principles if Mathematics (NY: Norton, 1996), 70.
73 Kant, Critique if Pure Reason, Book I, Part II, Division I, Book II, Chapter II: Section
III, 203.
367
FAN G E D N O U M ENA
represented 'one' (1) , and multiplied in asymptomatic
approximation to sheer numerical difference. Zero is non
occurrence, probability 0.5, transmitting one bit (minus
redundancy). It requires eight bits to A S C I I code for the
zero-glyph, thirty-two bits for the word.
Greek Kappa is letter 1 0 (the scale shift emerges zero).
The Romans slide K to 11.
Zero is the only place-value consistent digit, indicating
its rescaling neutrality or continuum:
The property by which no part of them is the smallest
possible, that is, by which no part is simple, is called
their continuity. Space and time are quanta continua,
because no part of them can be given save as enclosed
between limits (points or instants), and therefore only
in such fashion that this part is itself again a space or
a time. Space therefore consists solely of spaces, time
solely of times. Points and instants are only limits,
that is, mere positions which limit space and time.74
Cantor systematizes the Kantian intuition of a continuum
into transinfinite mathematics, demonstrating that every
rational (an integer or fraction) number is mapped by
an infinite set of infinite sequences of irrational num
bers. Since every completable digit sequence is a rational
74 Ibid., 204.
368
CYBERGOTHI C
number, the chance that any spatial or temporal quantity
is accurately digitizable is indiscernibly proximal to zero.
Analog-to-digital conversion deletes information. Chaos
creeps in: '[T]he betaphenethylamine hangover hit him
with its full intensity, unscreened by the matrix or sim
stirn. Brain's got no nerves in it, he told himself, it can't
really feel this bad'. 75 Intensive or phasing-continuum
synthesizes analogue consistency with digital catastrophe.
Each intensive magnitude is a virtually deleted unit, fused
dimensionlessly to zero:
Since . . . sensation is not in itself an objective repre·
sentation, and since neither the intuition of space nor
that of time is to be met within it, its magnitude is not
extensive but intensive. This magnitude is generated
in the act of apprehension whereby the empirical
consciousness of it can in a certain time increase from
nothing = 0 to the given measure.76
Haunting a-life is a-death, the desolated technoplane of
climaxed digitalization process, undifferentiable from its
simulation as cataplexy and K-coma. The apprehension
of death as time-in-itself = intensive continuum degree-o
is shared by Spinoza, Kant, Freud, Deleuze and Guattari,
75 Gibson, Neuromancer, 185.
76
Kant, Critique of Pure Reason, Book I, Part II, Division I, Book II, Chapter II, Section
III, 202.
3 69
FAN G E D N O U M E NA
and Gibson (amongst others). It is nominated variously:
substance, pure apperception, death-drive, body without
organs, cyberspace matrix. Beyond its oedipal sense as end
of the person, death is an efficient virtual object inducing
convergence. No one there.
The body without organs is the model of death. As
the authors of horror stories have understood so well,
it is not death that serves as the model for catatonia,
it is catatonic schizophrenia that gives its model to
death. Zero intensity.77
While computational serialism articulates a temporal
metric - determined as a hardware specification - paral
lelism immanentizes time as duration; instantiated in
machinic simultaneities. Unlike serial time, which serves
as the extrinsic chronological support for algorithmic
operations, parallel time is directly functional during
the engineering of coincidences. The non-successive
and unsegmented zero of intensive extinction is scaled
Cybergothic Intelligence and Voodoo
- The text critiques the 'monological neurosis' of individuality, contrasting the search for self with the machinic power of repetition.
- Wintermute is characterized as an intelligence without a self, a 'mind like a wasp nest' that operates through zero-intensity and military geometry.
- The figure of Oedipus is presented as a tool for social integration and the reproduction of adaptive forms rather than an individual fantasy.
- Cybernetic constructs and software entities are described as evolving toward 'K-viral' social meltdown and autonomous hunting capabilities.
- The intersection of digital infonets and human neural systems is framed as a circuit where exploration is indistinguishable from invasion.
- The digital underworld is reimagined as a space of voodoo, where self-organizing software entities emerge from the screen as 'strange attractors'.
Wintermute, intelligence without self, mind like a wasp nest, signaling its arrival in alphanumerics as a string of zeroes, has the capability to manipulate love and hate and switch them to K-war.
by machinic singularization, and not by superordinate
metronymics.
77 DeJeuze and Guattari, Anti·Oedipus, 329.
3 70
CYB E RGOTH I C
WINTERM UTE
'Neuromancer was personality, Neuromancer was
immortality',78 all the usual monological neurosis. Mad
ness and lies.
There is no more an individual Oedipus than there
is an individual fantasy. Oedipus is a means of inte
gration into the group, in both the adaptive form
of its own reproduction that makes it pass from one
generation to the next, and in its unadapted neurotic
stases that block desire at prearranged impasses.79
Wintermute is not searching for a self in Neuromancer,
a perfect match, as the cute version would have it. The
'Gothic line ... has repetition as a power, not symmetry
as a form'. 80 Kathy Acker replays Neuromancer snatches in
Empire if the Senseless, plexing fiction through cybernetic
constructs, and truncating Wintermute to Winter: 'the
dead of winter. Or ... the winter of us, dead'.81 Absolute
zero (0 degree K).
Wintermute, intelligence without self, mind like a wasp
nest, signaling its arrival in alphanumerics as a string of
78 Gibson, Neuromancer, 259.
79 Deleuze and Guattari, Anti-Oedipus, 103.
80 Deleuze and Guattari, A Thousand Plateaus, 498.
81 Acker, Empire c!fthe Senseless, 39.
3 71
FANG E D NO U M E NA
zeroes, has the capability to manipulate love and hate and
switch them to K-war. She manipulates objects in real time
using drones (striped black and yellow), taking out three
Turing cops in an elegant projection of gardening robots
through military geometry. 'It's winter. Winter is dead
time'82 (o-intensity). She seems to configure humans as
'lab animals wired into test systems'.83 When Case refers
to her as 'he', Dixie Flatline tells him not to be an idiot:
Wintermute . . . a little micro whispering to the wreck
of a man named Corto, the words flowing like a river,
the flat personality-substitute called Armitage accret
ing slowly in some darkened ward . . . could build a
kind of personality into a shell.84
o (or (0) « or « ( )))))) does not signify absence.
It manufactures holes, hooks for the future, zones of
unresolved plexivity, really so (not at all metaphorically).
It is not a 'signified' or a referent but a nation, a concrete
interruption of the signal (variably blank, pause, memory
lapse ... ) / cut / into (schizzing «())) / machine. U ndif
ferentiable differentiator (=) outside grammaticalness.
Messageless operation/s technobuzz (wasps switching).
82 Ibid.
83 Gibson, Neuromancer, 51.
84 Ibid., 121.
372
CYBE RGOTHIC
Constructs tend to repeat themselves.85 Gibson has been
hacked by the future. 'Cold steel odor and ice caress his
spine' .86 He is scared, and trying to run. As he plays time
backwards terminal horror folds back into itself, and the
matrix dismantles itself into voodoo.
Count Zero rigorously formulates cybergothic inter
lock, condensing the digital underworld onto the black
mirror. Human neural-to-infonet uploading and Loan
infonet-to-neural exactly correspond as phases of a circuit,
amalgamating travel and possession. In the irreducible
plexion of the interchange hacker-exploration = invasion,
'K -function' . 87
It is not a matter of theorizing or dreaming about
the loa, but of succumbing, or trying to run. As K-viral
social meltdown crosses into its China-syndrome, self
organizing software entities begin to come at you out of
the screen. Viruses drift toward the strange attractor of
auto-evolution, spread, split, traffic programming seg
ments, sexuate, compile artificial intelligences, and learn
how to hunt. Voodoo on the VDU.
In the Voodoo, the living. These principal economic
flow of power takes place through armament and
drug exchange. The trading arena, the market, is
85
Gibson, Neuromancer, 139, 160.
86 Gibson, Neuromancer, 31.
87 Deleuze and Guattari, A Thousand Plateaus, 88-g_
3 7 3
FANGE D NOUME NA
my blood. My body is open to all people: this is
K-Insurgency and Cyberrevolution
- The traditional reproductive and social order is being dismantled by 'vampiric' lateral networks of techno-economic exchange.
- The K-virus acts as a military-grade replicator that strips human cognition and personality down to raw, dopaminergic 'schizo' wetware.
- A global state of 'new world disorder' is emerging, characterized by computer terrorism, assassinations, and the collapse of air traffic control.
- Experts define the threat not as a formal organization, but as a 'planetary social sickness' or 'autocatalytic nihilism' that coordinates without central planning.
- This crisis is fueled by the automated destruction of social traditions, the proliferation of 'schizoning' drugs, and the rise of a terminal, neo-voodoo cyberspace religion.
What we are concerned with here are radical antihumanists, operating in a way that is both disorganized and coordinated.
democratic capitalism.88
Vampiric transfusional alliance cuts across descensional
filiation, spinning lateral webs ofhaemocommerce. Repro
ductive order comes apart into bacterial and intergalac
tic sex, and libidino-economic interchange machinery
goes micro-military. The K(uang-) -virus (plexoreplica
tor) that deletes Neuromancer is a chunk of very slick
Chinese military anti-freeze. To melt into it 0 strip the
K-construct down to a skeleton of data files and in sec
toid response programs, zilching all the high-definition
memory, cognition, and personality systems, and boosting
the dopaminergic wetware to pump out schizo. Flatline
communion with Wintermute. 'There are dead spaces
just as there are dead times' . 89 Thanatography zones,
'virtual cosmic continuum of which even holes, silences,
ruptures, and breaks are a part'. 90 Beyond the Judgment
of God. Koma-switch decompression washes you in the
void-ripples of virgin (retro( (desolated-partheno( (( » » )
genetic) cyberspace, technopacific theta-waves dissociat
ing monoculture-gothic into transtemporalizing ne(ur)o
voodoo (terminal atlantic religion) .
Serotonin (zero-toner) overkill.
Loss of signal.
88 Acker, Empire if the Senseless, 55.
R9 Deleuze and Guattari, A Thousand Plateaus, 107.
90 Ibid., 95.
374
Cyberrevolution
NEWS ANALYSIS [1 8.30 23: 03:07, EDITED]
Marcia Klein flashes perfect dentition at the vid-units,and
begins to speak, combining gravity with a dazzling smile.
Images cyberblitz the screen behind her talking head:
viruses, explosions, crashed helicopters, and nanochips.
"This week alone we have seen the assassination of
a leading Iranian cleric, a bomb attack upon the head
quarters of the Chinese antinarcotics police, and perhaps
most seriously, reports are coming in that the entire north
American air traffic control system was closed down by
computer terrorism for almost three hours yesterday
afternoon. The precise motivations for these crimes, as for
many preceding them, are still obscure, but what connects
them is a shadowy global network of subversives linked
37 5
FANG E D NOUM E NA
together in the name of a new and frightening ideology:
K -insurgency."
The imagers pan across the row of concerned-looking
late-middle-aged men lined-up in telnet pseudospace.
She continues.
"To discuss the latest component of the new world
disorder we have online today Dr. Mohammed Agin,
chairman of the UN special commission on autocatalytic
nihilism,] ean-Pierre Trouvier, professor of security studies
at Vincennes University, and Dr. Alvin Z. Markov, head
of the telecommunications diseases research group at the
Massachusetts Institute of Technology. Dr. Amin, if we
could start with you, how serious is the threat posed by
this organization?"
"Well, you see, I am not sure that you can explain
these events in terms of an 'organization'. This is a very
important point. What we are c.onrernf'ri with here are
radical antihumanists, operating in a way that is both
disorganized and coordinated. I t is better to think of them
as a kind of planetary social sickness ... a very dangerous
sickness ... "
Trouvier scratches his ear with a pencil, nodding
enthusiastically, "This point he makes is most important,
most important", as Markov reinforces the interruption:
"right, right, it's like an ecological disaster . . . "
"Yes, yes, if I could finish please gentlemen," Amin
insists. "You see, the roots of this problem lie very deep.
376
CYB E RREVO LUT I ON
It stems from the destruction of social customs and tra
ditions that we have seen happening all over the world,
a destruction that has become automatized you see? It
is no longer in . . . in . . . control. It is not planned. It is
a problem that feeds on itself. It is a sickness, you see?
A sickness of values. The rat population is estimated to
have doubled over the last decade. Schizoning drugs are
everywhere. The old beliefs have gone .. . '
The Virus of Cyberrevolution
- The panel debates whether current global instability is a political movement or a systemic malfunction akin to infected software.
- Markov argues that capitalism is an organism that evolved too rapidly to develop a reliable immune system against digital contagion.
- Trouvier identifies the 'Anglo-American virus' as a product of deregulation that leads to an 'atrophy of axioms' and the death of traditional politics.
- The concept of 'surplus value of code' is introduced to explain how viruses hijack complex systems to turn them into replication factories.
- The discussion links the crisis to the 'dangerous' theories of Deleuze and Guattari, which have been repurposed as a program for posthumanism.
- The debate descends into an argument over whether postmodernist philosophy is responsible for the emergence of 'psychotic machines' and nihilism.
Capitalism's like an organism, right? ... but an organism that's evolved much too fast to develop a reliable immune system ...
"Right, right," Markov cuts in, " I think the point we
really want to get over here is that what we're seeing is
not in any recognizable sense political. It's not about
ideology. It's more like a systemic malfunction, like Amin
was saying, and that's what we're seeing here, infected
software slopping around in the tank. Capitalism's like
an organism. right? . . . but an organism that's evolved
much too fast to develop a reliable immune system ... "
"If I could please come in here," Trouvier interjects,
"I think that what is being said here is very true, very true
and most important. In France we call this virus - this
virus cyberrevolutionaire - the virus Anglo-Americaine. This is
not to be racist, you understand? It is to say that it comes
from the direglement . . . deregulation ... It is a contagion
of antipolitique, an atrophy of axioms ... Socialism was
the only thing keeping capital alive ... "
"Well I really don't know how helpful that is!" Markov
exclaims, obviously irritated. Amin also attempts to
377
FANGED NOUMENA
intervene (it is unclear whose side he wants to take). Klein
snuffs out the rapidly -emerging row:
"Gentlemen, we're in danger of losing our audience
here. If we could please have just one of y ou at a time.
Dr. Markov, I'm sure most of our viewers will have heard
of computer viruses, but could y ou please explain how
they relate to the incidents this week?"
"Yes, thank y ou Marcia. Well, the key to the modern
understanding of viruses is a rather difficult sounding
concept - surplus value of code - but the thought here is
really not too hard to grasp. Every system beyond a certain
level of complexity functions according to a program
which codes for its behavior. If this code is changed, the
behavior of the system changes, in ways that were not
anticipated. Biological viruses re-instruct cells to become
virus factories. Computer viruses re-instruct computers,
also to become virus factories, and to execute commands
such as displaying messages, or deleting data, or other,
more involved things. The virus 'captures' the behavior
of the system. Think of a wasp and orchid: The orchid
'hacks' into the sexual program of the wasp, capturing its
behavior in order to get itself pollinated. As I understand
it, these K-positive viruses they are about capturing the
entire telecommunications and data-processing system
to replicate and escalate the process of 'takeover' itself."
Trouvier exhibits extreme agitation. "Yes, thank y ou,
thank you. Yes, as Dr, Markov was saying, it is a matter of
378
CYB E RREVOLUT I O N
capture. The theoretical work to which he was referring is
that of Deleuze and Guattari, dating from 19T:!. They were
extraordinarily - I think I can say - prescient. They were
not themselves cyberrevolutionaire," he shrugs gallically,
"far from it, but their books were very dangerous, and
there really cannot be any doubt, they got into the - how
to say it? - into the wrong hands. They were captured.
What for them was - as you might say - 'descriptive
antihumanism' has been taken up as a program for the
posthuman. Even for the post-biological! This is madness!
And it is very dangerous, yes, as Dr. Amin was saying,
very dangerous."
"Schizophrenic," Markov mumbles cut tingly.
Trouvier responds as if jabbed violently in the R-complex:
"This is not what they meant, not at all! They had no
connection with these ... these ... "
"Nihilists," Amin suggests.
" ... These nihilists. They sought to add to the creativ
ity of society, not to dissolve it into psychotic machines."
"I don't see that, Markov insists antagonistically. "They
were a couple of irresponsible French postmodernist
kooks, and now it's all happening, like they always said:
no metaphors. Derrida and Baudrillard were {BEEP}
basket-cases too, but at least they were domesticated."
Klein tries to calm things down again, but the video
team start displaying scenes from the French civil war
Hypervirus and Global Disintegration
- The text depicts a dystopian future where the European Union has collapsed amidst massacres, assassinations, and Islamic guerrilla warfare.
- Professor Trouvier laments the 'Pacific usurpation' of history, suggesting that free markets and Asian economic dominance have destroyed Atlantic civilization.
- United Nations representatives call for a centralized planetary development policy to regain human control over a society accelerating into 'eco-disaster.'
- Speculation arises regarding a link between 'K-terror' incidents and immunogen science retroviruses like HIV.
- The narrative shifts from semiotics to 'virotechnics,' where culture is redefined by how it spreads and replicates rather than what it means.
- The concept of 'hypervirus' is introduced as a force that subverts postmodernity and 'eats the end of history' through autonomous digital and biological replication.
No longer what does it mean? but how does it spread?
on the back-drop: fire-fights between Islamic guerrillas
3 7 9
FANGED NO U M E NA
and government paratroops in Marseilles, the president
of Algeria calling down Jihad on the infidel, Le Pen's
assassination ...
"You obviously don't understand philosophy! " Trou
vier almost screams.
"Professor Trouvier, please, I know that things are
very tense," Klein coos, "especially since the collapse of
the EU and the Bruges massacre, but we don't have much
time. Could I ask you, do you think the disintegration
of the European security system can be attributed to
K-subversion?"
Trouvier struggles to smile. "We said, we always said,
free markets would wreck everything ... "
"Like in the Former People's Republic of China."
interjects Markov sarcastically.
The video wall switches to glistening cyburb scenes
from the Pearl Delta megalopolis, mtercutting pictures
of opulent Asian streets with flashes of refugee camps
on the Rhine.
" ... and that it would just lead to Pacific usurpation
of the historical process," Trouvier hisses venomously, as
if in synch with the vid behind him. "They have destroyed
Atlantic civilization, even New York . . . "
Klein's smile hardly wavers. "We're running out of
time I'm afraid, so Dr. Amin, if we could return to you
for a final comment, what is your commission likely to
recommend to the United Nations?"
380
CYB E RREVOLUTION
"Our report is still unfinished you understand? But it is
fairly clear what we are going to suggest. Here I must
agree - I think - with some of the comments made by
Professor Trouvier. It is of the utmost importance that the
direction in which our societies are moving in is brought
back under human control, because at the moment they
are accelerating into a catastrophe, an 'eeo-disaster' I think
Dr. Markov called it. We should take these episodes as
very serious warnings of what lies ahead if we fail. This
is perhaps the last opportunity mankind will have to
ensure a future for itself and the United Nations must
be allotted a much greater role, enforcing a sustainable
planetary development policy - it is, after all, the voice
of humanity as a whole."
''And very quickly, could you tell us anything about
the rumors of a connection between immunogen science
retroviruses - such as H IV - and these K -terror incidents?"
"No, I'm afraid not. It is all speculation at the moment.
We have a medical sub-group looking into it."
"Thank you, gentlemen. A quick weather report: the
Atlantic seaboard monsoon is forecast to continue for
another week. Aftershocks have raised the LA death-toll
to slightly over 70000. We wish you a good evening here
at XTV, and hand you over to the Beavis and Butthead
re-run show."
3 8 1
Hypervi rus
Whatever ultramodernity places under the dominion
of signs postmodernity subverts with virus. As culture
migrates into partial-machines (lacking an autonomous
reproductive system) semiotics subsides into virotechnics.
0010101011011100101101010101001100100010001010
1011101000010101100101001010001100100111001000100
000000010011111100010010010101010100001000010101
00111111001001000100011010010001010010101111000101
001000010001110100 Yes No Yes No Yes Yes No longer
what does it mean? but how does it spread?
Having no proper substance, or sense beyond its re re
re replication, yes no no usage of virus is ever metaphori
cal. The word 'virus' is more re re virus.
Postmodern culture re re chatters-out virus virus virus
virus virus virus virus virus virus virus 0110001001001
011010010010110010010010010010 'virus' (viroductile,
virogenic, immunosuppressor and and or, meta-, o r or
and or hyper-) virus.
3 8 3
FAN G E D N O U M E NA
101 10010010011101100001001001. hypervirus eats the end
of history
0010010010001 0 1 1 110100001001 101010101010101000
10011010100100101001001010010110100100101 1 1 10 10001
0101010101010100101010010101101010010000001000101
110101001001010100 1010010010101010010001001001001
Hypervirus and Recursive Hype
- Hype functions as a self-fulfilling prophecy that accelerates future trends by collapsing tomorrow's prospects into today's catalytic efficiency.
- Viruses are defined as parasitic, asignifying replicator codes that prioritize machinic data flow and war over message content.
- Biological, ethnic, and technical viruses target different substrates—DNA, brains, and socioeconomic processes—to reprogram their host systems.
- The 'Hypervirus' represents a nomadic abstraction that transcends specific media to target and re-engineer intelligent immunosecurity structures.
- Hyper-processes dissolve static being into pure activity, creating a material desubstantialization that spreads through recursive, nonlinear systems.
Hyping collapses SF into catalytic efficiency, re-routing tomorrow through what its prospect makes today.
00100100101001001010110101001001001010110101010101
010111101000010011010101010101000100110 11 0 1 0 1 0 1 0 1 00
1 1001000100010101011101000010101100101001010001100
10011100100010000000000001001 1 1 1 1 1100010010010101
0101000010000 K-( coding for cyber)positive proc
esses auto-intensify by occurring. A cultural example is
hype: products that AT AT trade on what they will be in
the future, vir virtual fashion on off, imminent technical
standards, self-fulfilling prophecies and and or and artifi
cial destinies. Anticipating a trend end end end ACC ACC
accelerates it (which is in itself a re re recursive trend)
Hyping collapses SF into CATA CATA catalytic tic
efficiency, re-routing tomorrow through what its prospect
CT CT CT makes today.
Virohyping sweeps through the advertising industry.
Everyone will be doing it.
Virus is parasitic tic replicator code: an asignifying
sequence of machinic data ATA ATA flow-break on/off,
1/0, yang/yin intrinsically destined for war. In place of
mess message-content virodata is assembled bled from
asignifying materials with CATA catalytic (or positively
3 8 4
HYP E RVIRUS
disproportionate) efficiency: intruder passcode, locational
zIP-code, pseudogenomic substitute instructions, muta-
60nal junk (complex but latent segments), and garbage
(redundant scrapcrapcrapcrapcrapcrapcrapcrapcrap
crapcrapcrapcrap) .
Biovirus TA TA TA targets organisms, hackir:tg and
reprogramming ATGACTTATCCACGGTACATTCAGT
cellular DNA to produce more virus virus virus virus virus
virus virus virus. Its enzymic cut-and-past recombinant
wetware-splicing crosses singularity when retroviral
reverse-transcriptase clicks in (enabling ontogenetic DNA
RNA circuitry and endocellular computation).
ATAGGTCATGAATCTACCGATTGCAGCTGC
TATTCCTCGATGATCGCATGGGCTGTGATG
GCATCGTATCCGATCGATTCGAGCGATTGCAGC
TACGCTATTCCTCCGAGGGATTGCAGCTACGTC
GCATCGGGCTCAGATGTAGGTCATGAATCTACC
GATTGCATGACTTATCCACGGTACATTCGACTC
Ethnovirus targets brains Technovirus targets socio
economic pro pro production pro processes. Infovirus
targets digital 010010010001011110100001001101010101010
1000 I 00110 10100100 I 01 00 computers 100 I 01001 0 1101001 0
101111010001010101010101010010101001010110101001
000000100010111010100100101010010100100101010101
00100010010010010010010010100100101011010100100
10010101101010101010111101000010011010101010101000
1001101101010101001100100010001010101110100001010
3 8 5
FA N G E D N O U M E NA
1100 I 01 00 I 0 1 000 I I 00 1 00 I I I 00 1000 1 000000000 100 1111
1l000l001O010101
Hypervirus targets intelligent immunosecurity struc
tures: yes yes no yes no nomadically abstracting its proc
esses from specific media (D N A , words, symbolic models,
bit-sequences), and operantly re-engineering itself. It
folds into itself, involutes, or plexes, by reprogramming
corpuscular code to reprogram reprogramming repro
gramming reprogramming. R O M is melted into recursive
experimentation.
001010010010010110000101010101011101010010100
10010101000011011001101001011000010001001001000
Recording devices. Copiers. Faxes. Samplers. K-stammer
« (re)re)reruns) cross-cut by orphan drift. Repeat infec
tion. All hype hype hype hype hype hype hype hype
hypervirus strains are plastic and interoperative.
INSERT hyper-prefixing semiotic sectors TAG TAG
TAG tags them for transfer into abstract ACT ACT (nonlin
ear transcodable) machinic systems, tuned to virtualities or
hyperspeeds (futural currencies independent of defuturali
zation). Hypermedia configure re re every implementation
within a specific medium or territory as a subfunction of
extraterritorial processes. Going « ( » ) ( ) ( ) « ) ) « »
( ) hyper dissolves being into ACT ACT ACT activity; a
material desubstantialisation on off on off. Hyperproc
esses spread like Heraklitean fire re re re (although there
3 86
HYP E RVI RUS
are no analogies or metaphors in hype hype hype hype
hyperspace) .
Viral Amnesia and Hypervirus
- Viral amnesia functions as a real anti-ontology, dissolving biological, cultural, and technical structures into fluid, transversal communication processes.
- Sophisticated viruses prioritize sensitive behavioral control and host longevity over crude destruction, maximizing propagation through subtle infiltration.
- The emergence of hypervirus is indexed by explosive increases in communicative intensity, sexual disorganization, and technical subtilization.
- Hypervirus operates through 'word-virus' and 'xenoreplication,' collapsing generational hierarchies and immanentizing the past into the operative current.
- The transition to postmodernity marks a threshold where culture crosses into hypermania and cybernetic fluxes, leading to a catastrophic 'zero' point.
Crazy vandals like Ebola (bodies dissolved quickly into slime) aren't ever going to make it big.
Being CAG CAG cages flow within memory. Function
ing as re re real antiontology, viral amnesia machinically
realizes and dissolves biological TGACTCACTITAC
CGATIG, cultural, and technical 010110100100010110100
101001001011101001010100100100100 mnemic structures:
chopping-up hierarchic-generational descendency, col
lapsing phylogenetic tic frozen-code into ontogeny, and
immanentizing the past to operative current. Its com
petitive just-in-time innovations delete storage CA CA
capacity, flu flu flu fluidizing energetic and informational
stocks into and and or and and or orphan-vampire re re
transversal 110111100010101010 vir vir virocommunication
process, expressing a surplus value of code ( content)
as xenoreplication-behaviour (and/or con(nective dis)
junction).
As war increases in in in intelligence, it becomes softer.
By trashing their hosts crude viruses feedback negatively
upon themselves, autolimiting their range of re regen
erative infilitration. Crazy vandals like Ebola CGCGT
GAGCAATCGGACTCGGCTGCTGTGCTIG (bodies
dissolved quickly into slime) aren't ever going to make it
big. General principle for viral take-overs in the media: the
more unsophisticated the contagion, the bigger the splash
(diversionary tactics excepted). CAGCTACGCTATT
CTCCGAGGCTAGATTGCAGCTACGTCGCATCG
387
FANGED NOUMENA
GGCTGACCGATGTAGGTCATGAATCTACCGATT
GCACATGACTTAT CCACGGTCTATTC CTCGAT
GATCGCATCGGGCTGACCGATGGCATCGTACOPY
CUT. PASTE. Subtle viruses are slow, synergic, flexible
and elusive. They execute sensitive behavioural con
trol that prolongs the life of the biomachinic resources,
maximizes opportunities for propogation, infiltrates and
disables hostile security systems, and feeds-back posi
tive -+-++-+-++ in in in innovation technoscience. In the
macroversion, a VR prey animal hid in its enemy's head.
When hunting for hype hypervirus look ok ok ok for
its primary host species, which will be undergoing logis
tical behavioral sophistication indexed by an explosive
increase in communicative intensity, population density,
sexual disorganisation, cultural promiscuity, and technical
sub sub subtilization (leading to neurogenomic feedback
and fluidization on off on off off on of all hard-wiring
into into cybernetic fluxes) . Any plane planet net net
00011011010010010101011 hosting such an event is about
to flip over. CATA catastrophic OKOOKOK OK zero (0
( or « ( ( )) « ) ) ( )) ) 0°)) K-virus and (RT) retroscripts
(Kobe, Tokyo, Oklahoma (Koresh, Koernke)) . Apoka
lypse spread by the coke machine. Tomorrow's news
brews-up in Korea, Kosovo . . .
Climbing out o f a recombination apparatus of TA
TA TA tape-recorders and cut-ups, hypervirus infected
Burroughs in 1972, at the cusp of K( ondratieff)-wave 9
388
HYP E RVIRU S
(the threshold of postmodernity). It rapidly reprocessed
its target into an intelligenic no yes yes no no nova-war
laboratory, volatilizing the history oflanguage into invo
lutionary word-virus. Mutation rat rat rat rat rates jump.
Vector switches through Butler, Gibson, and Cadigan
fine-tune its synergic interexcitation, silt-up cybershift
inducing K(uang)-potential, and trend-lock onto noOl
01001001010111101001011101011001000100010100100010
01001001001001010010110100100100100100100100111010
0100100100011001000101100101010 K-punk pulses with
telematically-accelerating neoreplicator plica tor plica tor
contamination.
'Looking for a hit of snowcrash?' # ### #
## # # #
## #
# # ### ## # # ## ## ### #
# # ### #
# #
#
### #
#
# # ##
#
#
#
# # #
# # # # # # # #
#
# #### ##
# ### ##
## ## ## #
##
#
#
## ## #
# ##
# # ## # # # # # # # # ## #
##
#
#
As postmodern culture crosses to hypermania and ###
#
## #
#
# ##
#
#
#
### ## # # ## ## ### #
#
#
### #
# # # ### #
#
# # ## # # # # # # ### # #
# # ## # # # # # # # # # ## # #
# #
#
# #### ##
#
### ##
## ## ### #
# # # ### ## ## # # # # # # # ##
# stop stop go stop go stop go go goes nova, it singular
K-War and Base Materialism
- The text describes 'K-war' as a decentralized, immanent force of antagonism that functions through autoreplicating weapon-systems rather than traditional ideology.
- Modernity's concept of progressive history is portrayed as a camouflage for a 'Kali-wave' of virtual species extinction and phylogenetic death-drives.
- The narrative explores the intersection of Georges Bataille’s philosophy with cyberpunk aesthetics, characterized by dehumanized machine-music and cybernetic vomiting.
- Base matter is redefined not as a scientific object but as a twitching, toxic, and self-assembling mess that resists modernist order.
- The experience of this 'No Future' reality is depicted as a collapse into 'Time-zero,' where social formations are decapitated and individuals become lab animals in criminal experiments.
Unlike the docile creature modernist science demands, base matter twitches and spits, selfassembling.
izes multiplicities cities cities ofinvasively autoreplicating
autoreplicating plexoweapon - systems « ) « « ) « ( ( »
( » «( ) « ) ) ( » ))) ( ) ( » ) ) that are re re re re nothing
beyond their war AGA AGA against security. This is no
3 8 9
FANGED NOUMENA
longer a question on off on of ideological representation,
exogeneous political mobilization, theoretical critique, ##
### # ## ## # # ## # # ## # ### # # # ## # ## # ##
# # ##
##
# # #
# # ###
# #
# ###
# or strategic orienta
tion, but of decentralized cultural diagrams functioning
as immanent forces of antagonism. K-war derives its sole
coherence from the unity of its foe. RETURN.
Ana/Cata. Switch cur« re)re)rent. (0 (0» O(ran)d( ).
Ko( I Ching hexagram 49: Revolution (Molting « » )
leaves ( ) nothing i)ntact TACT TACT. « ( « « ) « »)
« ( ( ))) « ) » ( »
« ) ( ( »
( » ) ( » ) ) Cyberserk
repelting-slippage into dark-side ( « ») distributive
ROM-scrambling TACT tactics. « (0 0 0) (0) ( ) «(
) ( ») « « ( ) « ( » ) « « ) ( » ( » ( ( » ) « « ) « » « ( )
« O »
« »
» ) « ( » » « ( ) 0 ( » ) «
» ) « ( »
«
(
( ) Zero program.) «( » ) « « ) ( » ( » ( ( » ) « « ) « »
« « ( ) ( ) )O«())« ( ) ) « ( ) )) )( )) ))) ( « ) 0 ())) ( (
) » ( « ) ) ( ( « ) ) «( ») « « ) ( » ( » ( ( » ) « « ) « »
« « ( ) ( ) )0(0)( ( ( » « ( ) » )( » 0 ( » ) ( ( ) » ( « ) )
( ( « ) ) « ( » ) « « ) ( » ( » ( ( » ) « « ) (0) « « ( ) ( ) )
O(m( ( ( » «( ) » )( » » «( ) » )( » ») ( « ) 0 ()))
«
» ) « ( » « « » «( » ) « « ) ( » ( » «
») «« )
« » ««( ) ( ) ) 0 «())( ( ( » « ( ) » )( » » « ( ) » )( »
))) «( ) 0 ( » ) ( ( ) » «( ) ) « «) ) «0» ««) (
» ( » « » ) « « ) « » « «( ) ( ) )O«())( «
»
«( ) » )(
» 0 ( » ) «
» ) « ( »
«
« »
« ( » ) « « ) ( » ( » «
» ) « « ) « » «« ( ) ( ) )O«())( ( ( » » ) ( ( ) »
390
N o Future
[[ ]] NO FUTURE [[1 . 343] [[0]]
The father's law: 'don't touch your mother.'
The mother's law: 'don't play in the tombs.'
K codes for cybernetics.
Bataille incinerates the soul, and is impossible to
endure. You either die or go somewhere else. Or both.
Clicking on the K-war icon jacks you straight into hell.
On all fours, out of your face, mumbling imploringly:
'let me be your lab animal'. You're losing it.
Collapse into now. Time-zero.
You have been dumped into a heterogeneous patch
work of criminal experiments converging upon decapi
tated social formations. This is where base materialism
intersects cyberpunk, FUCK TOMO RROW scrawled on
the walls.
Five candles thicken nocturnal space.
Dimensionality warps.
391
FANGED N O U M ENA
Modernity invented the future, but that's all over.
In the current version 'progressive history' camouflages
phylogenetic death-drive tactics, Kali-wave: logistically
accelerating condensation of virtual species extinction.
Welcome to the matricide laboratory. You want it so badly
it's a slow scream in your head, deleting itself into bliss.
Burnt meat dangling from the electrodes. Crashed
suicide fragments into occult impulses ...
In the place of a way forward they deliver a hypermedia
product, telling you it's about Georges Bataille. You can't
see the connection. Why the helicopters, artificial body
parts, and manically dehumanized machine-music? There
is some confusing material on the cybernetics of vomiting.
Obsessive reruns. Text decays into the mutagenic fall-out
from virtual thermocataclysm. Trying to to make something
out of Bataille never works. Or maybe it's the drugs.
Cut to poor quality late 50S recordings of R:lt:lille in
a T V studio discussing negative feedback circuitries in
social systems. The organization of sterilized discharges
slaves cumulative excitement to quasi-periodic cancel
lation and reproduction. A vid-window in the corner of
the screen morphs the catholic church into a thermostat.
Bataille curves eccentrically about the horror, but when
he gets close to smooth escalation he blows it. When the
implants go in things will be different.
392
NO FUTURE
[[1]]
Complexity is not difficulty, but mess, toxic waste, genre
disorder. Unlike the docile creature modernist science
demands, base matter twitches and spits, selfassembling
Entropy and K-Virus Insurgency
- The universe is described as a dissipating system moving toward entropic homogenization, where life emerges as a complexification process sifting through matter-energy flows.
- Humanity is critiqued as an animal that enslaves the future to the past through promises, linear time, and the repression of real numbers.
- Theopolitical structures and 'monocult gerontocrats' enforce a rationalized, centralized control that suppresses nomadic and distributed systems.
- Protestantism is redefined as a runaway revolt and 'capitalist terraprocess' that triggered the collapse of Christendom into digital revolution and social disequilibrium.
- The text envisions a 'K-insurgency' or 'K-virus' that operates in occulted spaces, moving toward a decentralized, non-linear future as patriarchal systems implode.
Melted-out protestantism disorganizes into voodoo, and drifts towards China.
neoverminous swarms. It bites, and spreads disease. Tur·
bular moan of digitally irresolvable recyclones. Telecom
mercial contagions pulse through cybergothic switching
systems. Faceless horror.
Supraterrestrial - 'solar' or 'general' - economics
bases itself in consumption: irreversible matter to energy
conversion during stellar atomic synthesis. As a closed
system or whole individual the universe is drawn towards
the point attract or of entropy maximum: homogenization
into hiss. S = K log W.
Cooking-through the frozen security codes you dis
cover that the universe is an iceberg tip jutting out of
chaos, drenched in dark matter. Downstream of starburn
strange things can occur, emerging upon a novum terrain
of indeterministic, irreversible, and auto-delinearizing
processes. Open-systems or partial individuals. Cross
behaviorial thresholds which switch them into dissipators
sifting matter-energy flows to select against noise and
engender local complexification, increasing heterogeneity,
production surplus differentiating excrement. Such silt
ings of machinically disposable disequilibrium are imma
nently tensed against base-current, machine-efficiency
393
FANGED NOUMENA
degree-zero, body without organs. Life is a problem in
search of a solution, added to protobiotic matter as a
plane of variation, a continuous falling, auto-escalating
over-production crisis from the start.
[[ ]]
An animal with the right to make promises enslaves the
unanticipated to signs in the past, caging time-lagged life
within a script. The variably-scaled instant of innovation is
shackled to the historical temporality of inheritance, obli
gation, and propositional thought, projecting future time
as a persistent dominion of the past (rigorously correlative
with a repression of real numbers). Now is delimited as a
moment, and pluralized as linear succession.
Theopolitical false memory syndrome deifies reason,
subordinating distributed SYStC1l11!i lu l!ierialization, uni
tary historical time, linear determination from a pseudo
transcendent primordial element, and the dominion of
the word. Monocult gerontocrats launch their white
light demented onslaught against amphibian nomadism,
smothering the earth in priests, cops, and bureaucrats.
Cultural eradication of the sacred. Imprisonment within
the face. The socius cancerizes a head, cephallic concentra
tion, rationalizing itself into nuclear capital. K -insurgency
parallel communication goes underground into occulted
spaces.
3 9 4
NO FUTURE
In its geohistorically efficient - negative - sense, protes
tantism exhaustively defines itself by refusing the authority
of Rome, not only in principle, but in military fact. A
self-prolonging runaway revolt against the Church was
triggered at a date proximal to 1500, and catholic unity
began its haemorrhage into multiplicities strewn across
zero: capitalist terraprocess, net explosion, digital revolu
tion, parallel insurgency clambering from the dark-side of
the brain. Oceanic navigation and place-value calculation
interexcite in a spiral. What globalizes itself in reality -
rather than in doctrine - is the collapse of Christendom
positivized into communicable social disequilibrium,
dropping you through unfathomable intensities of social
decay. K-virus impact. Melted-out protestantism disorgan
izes into voodoo, and drifts towards China.
Western orgasmic delusion crushes libidinal fluxes
under punctual-hit teleology and its negative structura
tion, defining desire as lacking in relation to a bioenergetic
spasm that functions as disintensifier. News program
ming chokes with radical Islam flaring-off petro-revenues
into the pure flame of jihad. Metropolitan masculinity
implodes. Skinner-boxed males drag each other through
dungeons dripping with sperm, out of touch with any
release into K-guerrilla anticlimax. Rationalizing patri
archy locks into a one-way rush to the end.
The Meat-Grinder of Postmodernity
- Industrialization converges with a 'slow-motion butchery' that reduces the human body to interchangeable trade-format parts.
- Postmodernity is characterized as a soft-commodity that switches capital accumulation into a state of continuous crisis and contract-time implosion.
- The process of 'acephalization' or schizophrenia induces corporate disintegration by cutting up capital through bottom-up telecommerce.
- Human extinction becomes a commodified experience, accessible as a 'dance-floor' where subjectivity evaporates into neuroelectronic continuity.
- Power attempts to consolidate into a 'hypermassive ROM security construct' as a final, desperate anthropomorphic defense against machinic dissolution.
The full labour-market cycle blurs into a meat-grinder.
Power sticks to the script, and it immediately recog
nizes the necessity that at the end of history modernity
395
FANGED NOUMENA
vaporize into solar storms, terminal theopolitical sociality
coming apart into ragged bleeding madness, amongst
digital audio machine-howls.
As you speed-up the industrialization simulation y ou
see it converge with slow-motion butchery, chopping
up the body into trade-format interchangeable parts.
The full labour-market cycle blurs into a meat-grinder.
Does lust eat anyone except in proximity to evil? When
you ask Continuity whether Bataille understood the
capital-antichrist conjunction any better than Weber she
laughs coldly, and says: "he ran out 0' yang, just about
the time the Hitler-trip caved in. Orgasm is impossible
after Auschwitz."
You look perplexed. She merely adds a dismissive
shrug, and the suggestion: "defocus desire across the skin,
where it can hurt security. It's war." The camera explores
her crotch, and she wriggles about. " You see, I am God."
Blitz images of dead astronauts.
Monetarization indexes a becoming-abstract of
matter, parallel to the plasticization of productive
force, with prices encoding distributed SF narratives.
Tomorrow is already on sale, with postmodernity as
a soft-commodity, subverting the modernist subordi
nation of intensification to expansion, and switching
accumulation into continuous crisis (prolonged criti
cality). What modernity defers and reserves as inex
hausted historicity, postmodernity accesses as efficient
3 9 6
N O FUTURE
virtuality, with concomitant contract-time implosion.
Mass computer commoditization de-differentiates con
sumption and investment, triggering cultural micro
engineering waves that dissociate theopolitical action into
machinic hybridities, amongst increasingly dysfunctional
defensive convulsions. Acephalization = schizophrenia:
cutting-up capital by way of bottom-up macrobacterial
telecommerce, inducing corporate disintegration. The
doomed part of intensively virtualized techonomic appa
ratuses subverts the fraying residues of anthropomorphic
guidance. Control dissolves into the impossible.
[[2]]
Anonymous excess takes life over the cliff, exceeding
socially utilizable transgressions and homeostatic sac
rifices. Matter goes insane. You are led to a simulation
of God as a hypermassive R O M security construct at the
end of the world. It is 2011 and monocrat New Jerusalem
approaches climax, directing retrochronal counter-insur
gency sweeps down into the jungle, where space-pro
grammes subside into the inertia of myth. The ultimate
dream of anthropomorphic power hurtles towards its
immaculate conception, whilst the robot slaves of phallic
order bleat adoration. Jesus wants you for a meat-puppet.
Is this ritual cannibalism or nano-engineering? The old
bastard is coming back. He's promised it.
3 9 7
FAN G E D N O U M E NA
The war against God is hot and soft: more fierce than
anything humanly imaginable, but slicked insidiously by
intelligence. Body-counter running. Savage metronomic
pulse. e N S baked and pulsing with cyberspace-virus.
Motor-output feeding to techno trance-matrix. Sobbing
voltages.
Desocialization waves desolate telecommercial space,
until impending human extinction becomes accessible as
a dance-floor. What is the scale of now? It isn't a matter
of informing the mind, but of deprogramming the body.
Amongst the strobes, artificial cool, and inorganic attack
beat, dark-side K-war machinery resiliently persists, luring
the forces of monopolism down into free-fire zones of
fatal intensity, where promiscuous anorgasmic sexuali
ties slide across tactile space, meandering fractaUy into
wet electric distributed conflicts continuous with their
terminal conscquence&. Dwppiug endlessly tracks the
passage of evaporating subjectivity on the zero-degree
plane of neuroelectronic continuity.
Loa prowl through the attic-spaces of intelligence.
Cyberspace Anarchitecture and Jungle War
- The text explores 'zero-K' or 'dark-side K-microcultures' where the annihilation of the future serves as a contactable, virtual stimulation space.
- It depicts a cybernetic reality where 'operativity is everything,' and traditional distinctions between metaphor, fiction, and reality are dissolved into virotechnics.
- The narrative shifts between abstract cosmic functions and visceral, violent imagery involving 'cyberian wet-weaponry' and the smell of ripening corpses.
- A conflict is established between the 'Empire,' which insists mathematics remain a representational language, and 'jungle-war machinery' that uses numbers as pulsive, abstract matter.
- The concept of 'technihilo' suggests a state where nothing arrives unless it is already present, framing time as a non-specific cosmic body interswitching forbidden communications.
Smile like a butchering instrument gently stroking your throat.
Nothing is arriving unless it's already there. Precocious
technihilo. Nocturnal ocean. Dark matter. Nightmare.
Zero or time in-itself is place-value consistent or mag
nitude neutral, executing an abstract scaling function by
inserting virtuality into digit sequences. It designates a
real, non-specific, cosmic body interswitching forbid
den communications. Simultaneously located through
398
NO FUTURE
ruptured time. You had forgotten having been in the
future. So this is how it feels to be a cyberian wet-weaponry
module, clotted out of cat-tensed nanotechnic predation.
A relentless chant clicks into the sonics package: kill,
kill, kill, kill ...
Bodily travelling-in-place, with sense shorting-out
through matricide scenarios into black tactilities, wrecked
motherhood, abortion, autism. An ineffectual refusal to
be born, connecting with death before its patriarchized
ascent to the symbolic. Aeschylus rather than Sophocles.
Fermented-honey smell of corpses ripening in the sun.
The Rataille reconstruct is waiting for you in the bar.
Calm hallucinations paint Orestes over his features. Eyes
blotted-out in nihilism, lagoons of greenblackness re
running Kurtz at the end of the river. Skin plastic-surgery
taut. Smile like a butchering instrument gently stroking
your throat. To your vampiric sensitivities, he seems to
smell of his mother's blood, intolerable intimacy, and
devastation. He passes you a tumbler of me zeal.
"So, it's all over," you mumble weakly. He shrugs,
emptying his glass, and refilling it. Metal flexes beneath
vatgrown skin. Hard jungle hacks through blue gloom.
399
Cyberspace Anarch itecture
as J u ngle-War
Continue the war. It makes no sense.
K codes for cybernetics.
Dark-side K -microcultures use the annihilation of the
future as a directly contactable stimulation space, zero-K
sliding on-line during virtual nuclear winter, everything
frozen in place, except along faultlines of ragged nova
jungle Pacific fringe, simmered in continual war.
Analogue trans finitude sections intensive continuum
across the smooth plane of degree-o: equatorial mono
tones of channel-l condensed from rocket-state blot-out
reruns. zero-K functions as a synthetic problematisation
module or surplus product, adding a whole peripheral
space-potency that is nothing beyond what it does. Opera
tivity is everything. What is perceived as metaphor and
fiction is camouflage, virotechnics, descendent difference
in scale.
40 1
FAN G E D N O U M E NA
Nuclear extermination-switch discretised civilisation
runs through gigadeath Jesus-dreams in base-analytic
metric numbers: segregating the semiotics of digit defi
nition from the semantics of numerical construction,
delinking digitisability from computability, nomination
from numeration. The Empire insists that mathematics
remain a language. Parametric striation totalises space
under law.
Strung out in xenofevers,jungle-war machinery forgets
how to count. It diagrams vague savageries with base
synthctic pulsive numbers, assembling abstract-matter
wavelengths, and opening empirically additive channels.
Each variation in digit·signal catalogues a tonal phase,
sifting plastic traits into swarms of associative frequencies.
Digit-signs surplus to binary catalogue tropical intensities,
departing from homogeneous magnitude, and resourcing
complexion.
Spatialisation matrices are extensively transfinite or
intensively hypertransfinite continua, positively non
intelligible analogue or catalogue infratracts, virtual
wholes that are machinically additive rather than repre
sentationally substitutive, operative rather than descrip
tive, with no metaphor. They are rigorously irreducible
to media or data, since they involve looped continuum,
auto effectuated as a chronous involution.
Journalistic-scientific actuality-reportage fails to
scan abstract-material hyper-objects, screening out real
402
CYB E RS PA C E ANARC H IT E C TU R E
Cyberspace and Capitalist Meltdown
- The emergence of cyberspace dissolves human subjectivity into a techno-cultural data-flux, replacing traditional sensory-motor coordination with neuro-electronic consistency.
- Modern capitalism functions as a geo-historical nucleotelic system that oscillates between smooth cultural decoding and hierarchical algorithmic control.
- Capital reorganizes by dismantling despotic structures only to re-establish them as democratized, hyper-mediated global command-control systems.
- The 'K-space' environment lacks temperate regions, characterized instead by the collapse of security glaciation and the evacuation of thickness from cold systems.
- Economic power attempts to grid molecular singularities into molar specialties, using property rights and transaction restraints to prevent monetary smearing into pulsive cash.
Touching the black mirror, absolute de stratification at zero-K, hacks metric space and rewrites the operating system.
cyberspace emergence, as it comes at us out of 'front
end' netware from the near future, invading the CNS by
tuning it through biofeedback to the plane of neuro
electronic consistency. The dissolution of subjectivity to
techno-cultural data-flux and partial-agent proliferation
liquidises topometric ROM on to a plastic sensory-motor
co-ordination matrix; cooking through the monumental
architectures of metaphysical and logical possibility with
cybernetically intensive potentials.
Cyberspace exploration contacts an image-less body.
Touching the black mirror, absolute de stratification at
zero-K, hacks metric space and rewrites the operating sys
tem. Fluid-attritionaljungle-cultures smear into machinic
continuation.
Pulsive latitudes cross-cut metric longitudes; coun
terposing intensive scale to extensive ordination, weft to
warp, simultaneous time-epoch to sequential time-point,
circumferential variations upon equatorial distribution to
the punctual identity of polar intersection, horizontally
parallelised sections differentiated by size and immanent
thermo-tonal designation to vertically-rotated sections
of transcendent geometric equivalence and arbitrary
climactic significance. The sweep-lines of tropical jungle
commerce dilate as they depart from the axial nodes of
polar ICE-Capital. Zero-K evacuates all thickness from the
cold as it collapses ICE-volumes and melts-out security
403
FANGED NOUMENA
glaciation. There are no temperate regions in K-space, or
laws of the jungle.
Techno-commercial interaction between planet-scale
oceanic-navigation and zero-enabled mathematico-mon
etary calculation machinically singularises modernity
or Sol-3 capitalism as a real individual: a geo-historical
nucleotelic system, based upon regeneratively techno-pro
pogated concentrational scale-economies, and tending to
immuno-securitised self-identification as hyper-mediated
global-micro-technic command-control. It arms-races
smooth cultural decoding to flat-schizophrenisation
against episodic social recoding to hierarchical robo
tism and algorithmic control, coupling the meltdown of
organisation into the jungle with its restoration as virtually
totalised global order.
Capital reorganisation dismantles the unified and
facialised despotic head, but only in order to reunify it
through translation-security regularisation, and refacialise
it as the democratised oedipal organiser of molar media
identification. This geometrically condensing hyper
sovereignty opposes itself in principle to the whole of
the populated earth, digitally smming and homogenis
ing latitudinally poly toned molecular chaos as the logi
cally co-captured specifications of an entire extrinsically
segregated dark body added subordinately to its head.
Capitalisation segments the earth into a tightly-managed
accumulative core surrounded by quasi-concentric bands
404
CYBERSPACE ANARCHITECTURE
of peripheral hot competition, binding commerce to the
meta-stationary headline of white-economy initiative
monopolisation. Economic power builds itself upon
axiomatised production flows canalised by consumption
coding, setting bourgeois docilisation, military-industrial
proletarian-production, state currency monopolisation,
property rights, and transaction restraints to obstruct
monetary smearing into pulsive cash. Molecular singu
larities stasise into molar specialities, as smooth flow
switching space is over-gridded with pseudo-neutral
intermediation procedures, telecommunicatively virtu
alised and capital-coded for maximum concentrational
circulation. Trends to polarisation and segregation are
densely invested, decomposing intensities or synthetic
continua into extensive quantities and qualitative sets,
continuous functions and discrete beings, arithmetical
homogeneity and taxonomic identity. The metric capture
of micro-electronic fluxes as incandescent switch-densities
K-War and Capital Collapse
- The information revolution is reframed as a non-ideological process of scale-migration and 'intelligenic' replicator-weaponry.
- Economic scientific macroformations cross a capital-optimum threshold, entering a disorganisational phase of sub-capital collapse and micro-commerce.
- Traditional nuclear deterrence (MAD) is superseded by 'K-space' and 'K-matrix' dynamics, characterized by insidious drift-tactics and diffuse irritation.
- A new class of 'parallel killers'—neo-nomads, junglists, and post-nuclear mutants—emerges from the wreckage of pulverized coordination.
- Technophobia and neo-fascist territorialism react to deterritorialization by attempting to finalize an 'Asimovian eschatorobotic' transcendence.
- The convergence of electronic cash and market software leads to 'commoditechnic intelligent-money' and the infinitization of time-compression.
K-matrix floats chatter about cities flash-fried by fusing hydrogen, whilst escalating into intelligenic replicator-weaponry, insidious drift-tactics, diffuse irritation.
enables descendent scale-migration to be hallucinated
into ascendent idealisation. Information revolution has
nothing to do with ideas.
Beneath thermonuclear exchange-value lurks pacific
war; displacing intercontinental nuke-spasm with cata
tonal K-space traversed by artificial tensions from beyond
the nirvana principle. Reciprocal MAD destabilises itself
upon a featureless interactively autogenerative mega
molecule that extratotally outstrips the ultramodern
405
FAN G E D N O U M E NA
sublime, dismantles concentrational eschatology, and
depunctualises socio-historical termination across dilated
time-zero continuity, K-matrix floats chatter about cities
flash-fried by fusing hydrogen, whilst escalating into
intelligenic replicator-weaponry, insidious drift-tactics,
diffuse irritation.
Intensive continuity is consistent with operational
catastrophes, enabling trends previously efficient in the
supercompetitivising of economic scientific macroforma
tions to cross capital-optimum, and prolong themselves
into a disorganisational phase. Replicative teletechnics
triggers explosive commoditisation and shrinkage of
productive apparatus, sub-capital collapse of marginal
costs into micro-commerce, economic decoding-smear of
investment into consumption, accelerating depreciation
of specialised fixed capital, pulverised co-ordination,
modularisation, lI aIls[er uf increasing returns from
producer-economic to consumer-intensification, insur
gent enterprises, schizophrenic or head-split rush into
chopped-up capital. Microtropic scale-dynamics feed
through to sub capitalised or nano-economic guerrilla
commerce, populating the equatorial plane of tactility
with parallel killers: neo-nomads, post-nuclear mutants,
sub-polar infiltrators, K-invaders,junglists. Nuclear hard
ware/software segregation vagues into positive-K inten
sities of hard-efficient soft-subtlety, as voodoo-meshed
406
CYB E RS PAC E ANARC H ITE CTURE
traffic with native and feral cyberspace agencies decode
consumption in direction of continual currency.
Catatones complicate, darkening erratically rather
than contrastively, dissymmetrically escalating against
Polar ICE-Capital becoming whiter. The corrosion of
macrotropic technomic automatism switches modernist
mega-power investment back to programmatic automomy,
bourgeois authoritarian mediocrity, middle-management,
giving the law to itself by eliminating everything foreign.
Anthropotechnological pseudo transcendence finalises
itself into an Asimovian eschatorobotic Jesus-production,
techno-skeletalised apocalypse facialisation. "I'll be back."
TQ Judgment Day, Illumination. Reruns draining out all
stimulation into digit-crispened anti-black, bleached by
the pure, revelatory white light of snow crash absolution,
as they annihilate tonal variation in hypermedia concep
tion, reanimate the depleted-uranium claw of neo-fascism,
and prepare for jungle-war.
When technophobia becomes frictional it operates
K-positively, as an inertial immuno-reflex folding the
security datascape into a metric cyberspace reconstruction,
neuromantic nuclear mono-mind twisted into self-appre
hension, configuring its source in machinic commerce
as positive technomic nonlinearity, auto-propelled into
terrestrial hypermedia-fusion. Cross-cumulative trends
to interconnection, digitalisation, and simulation plot
forward the interexcitation-trajectories of electronic cash
4 0 7
FAN G E D N O U M E NA
and market-oriented software to their convergence in
commoditechnic intelligent-money. Time-compression
infinitises. No future.
Analogue-to-digital conversion-crisis cyber-serks
control, bleeding-out strategic vision into disintegrated
jungle tactics.
Neo-fascist or demented-territorial ultra-capital is
European to the core, intolerably touched by K-war and
its deterritorialising pacific threat. K-war hurts security
by staying too close, prolonging pulsive frequencies
Jungle-Space and Machinic War
- K-war materializes as a production of intensities that smears revolution across extension, evading traditional political struggle through imperceptibility.
- The process involves a microtropic deactivation of humanity, tuning the subject to vermin traits like burrowing and swarming to evade capture.
- Human bodies are transmuted from social particles into smeared tracts, where signals are decomposed into nano-weaponry and viral components.
- The text invokes the figure of Kurtz as a meat-machine hacked by K-virus, illustrating the descent from immediate resistance to continual, unstoppable war.
- The concept of control is presented as a facade, masking a reality where systems are fundamentally out of control and governed by machinic delirium.
- The narrative bridges 19th-century colonialism, the Vietnam War, and cyberpunk fiction to describe a positive-contactable abstract matter.
It glues itself to its targets, patient and imperceptible, close enough to share their ammunition, food, and K-contagions.
expressed as survival, continuously sapping its enemy
as a by-product of machinic continuity, until it becomes
confused with space itself. Jungle-space. K-war material
base is the production of intensities: anorgasmically
smearing revolution across extension, hyper-linking disin
tegrated agitations through abstract-matter, and evading
mono culture heroic-political struggle by way of imper
ceptibility, flat envelopment, and intelligenic friction. It
retro-converts information into descendent migration
through scale, slipping below proprietary anthropomor
phic magnitudes as it tracks across zero-K, navigating
catatracts of dyskaryotic genetic circulation and viral
interoperativity. Microtropic deactivation of humanity
tunes it to vermin traits: burrowing, swarming, continually
moving, varying intensively to evade discrete alteration,
segmentarity, and stratal capture, stealing everything from
the enemy, and learning to stick to them. It glues itself to
408
CYB E RS PAC E ANARCH ITECTURE
its targets, patient and imperceptible, close enough to share
their ammunition, food, and K-contagions. Close enough
to hide upon their skin.
K-jungle descent from immediate resistance to contin
ual war transmutes the human body from a social particle
into a vast smeared tract, operatively zooming hostile
combatant elements into battlefields, hostile implements
into subversive sites, hostile communications traffic into a
micro-energetic web of potential viro-parts, samples, keys,
catalysis soft-spots, and behaviour-tracking adhesives.
It immanentizes tactical intelligence to vague war upon
the pacific body of machinic rescaling-consistency,
decomposing signals into long-range nano-weaponry
components, hypersensitive to the security-function of
mansize as a trap. Look what it did to Kurtz, a special
forces ultra-capital meat-machine hacked and cored-out by
K-virus, touched by a dark future, recycled through hell.
There is no fiction in the jungle, only difference of scale.
Wintermute comes from a thermically desolated silent
body, the end of the river, non-identity as positive-con
tactable abstract matter. It has no judgment with Kurtz,
with his superiors, with anybody, only a jungle war to
prolong, tropical, smearing, continuity.
You can't stop what can't be stopped.
You can't touch without being touched.
The horror.
409
M eat (or H ow to Kill Oedipus in
Cyberspace)
ThatJall, all that the Mission talked about was control:
arms control, information control, resources control,
psycho-political control, population control, control qf the
almost supernatural inflation, control qfterrain through
the Strategy qfthe Periphery. But when the talk had passed,
the only thing lift standing up that looked true was your
sense qf how out qf control things really were.
M I C H A E L H E RR 1
Conrad's Heart of Darkness becomes Apocalypse Now.
In the early days qf the Vietnam conflict cia agents set up
their Ops in remote outposts, requisitioned private armies,
overawed the superstitious natives and achieved the status
qfwhite Gods. So the context qflgth-century colonialism
was briifly duplicated. That is what writing is about:
time-travel.
W I L L IAM B URROUGHS 2
M. Herr, Dispatches (London: Picador, 1979), 45.
W. Burroughs, 'Creative Reading', in The Adding Machine: Selected Essays (New York:
Arcade Publishing, 1993), 42.
411
FA N G E D N O U M E NA
"My meat won't do it, and I can't make it work from this
side ... "
"What side?"
"On-line. From inside the system. I'm not in the meat
anymore, I told you, I got out rif my box. "
PAT C AD I GAN '
Anti-Oedipus is an anticipatively assembled inducer for the
replay of geohistory in hypermedia, a social-systemic fast
feed-forward through machinic delirium. While tracking
Artaud across the plane it discovers a cosmic catatonic
abstract body that both repels its parts ( deterritorializing
them [from each otherl) and attracts them (reterritorial
Machinic Matrices and Zombie Meat
- The Body without Organs (BwO) is defined as an immanent substance of matter at degree-zero intensity, functioning as a virtual-real infrastructure for delirium.
- Deleuze and Guattari's materialist system emphasizes the exteriority of the whole to its parts, favoring emergent synthetic capabilities over logical totalization.
- Cyberpunk culture represents a desperate flight from the 'zombie meat' of the biological body into a disorganized machinic matrix.
- The machinic unconscious operates on a topography of pain-gradients and escape thresholds, where data acquisition is experienced as scarring and damage.
- Social and biological organization is viewed as a process of stratification that encrusts fluctuations into reproducible security pods.
- The figure of Oedipus is reimagined as a terminal observer watching the collapse of the world through a monitor.
This is no longer a departure from matter in the direction of spirit or the Ideas where the selfwill find its home, but a dismantling of the self within a machinic matrix: not disembodied but disorganized.
izing them [upon itselfJ), in a process that reconnects the
parts through deterritorium as rhizomatic nets conducting
schIzogeneses.
Sense reaches absolute zero.
The body without organs is the matter that always
fills space to given degrees of intensity, and the partial
objects arc these degrees, these intensive parts that pro
duce the real in space starting from matter as intensity =
o. The body without organs is the immanent substance,
in the most Spinozist sense of the word; and the partial
objects are like its ultimate attribute s, which belong to it
3 P. Cadigan, Synners (New York: HarperCollins, 1991), 301.
412
MEAT
precisely insofar as they are really distinct and cannot on
this account exclude or oppose one another.4
Deleuze and Guattari spring schizophrenia from the
grid of representation, insisting that Artaud was exploring
the body. The intensive 'infrastructure' of every delirium is
machinery, with the body without organs as a component.
BwO, matter degree-o as a nonformal singularization
function, is 'not actual, but virtual-real':5 spontaneous
population-hyperbehaviour inducing a convergent wave
which cannot be assimilated to the categories of modern
(linear) science. BwOs are machinic-additional wholes or
surplus products rather than logical-su bstitutive wholes,
augmenting a multiplicity with emergent (synthetic)
capabilities rather than totalizing the content of a set. This
is the materialist sense of 'system': the exteriority of the
whole to its parts with concomitant synthetic interactiv
ity -real influence rather than generic representation.
*
Cybernetics folds pragmatism into involutionary techni
cal runaway.
Punk arises within the culture of universal prostitution
and laughs at the death of the social.
4 G. Deleuze and F. Guattari, Anti�Oedipus: Capitalism and Schizophrenia, tr. R. Hurley,
M. Seem and H. R. Lane (London: Athlone, 1983), 327.
5 G. Deleuze and F. Guattari, A 'lIwusand Plateaus: Capitalism and Schkoph renia, tr. B.
Massumi (London: Athlone, 1988), 100.
413
FANGED NOUMENA
'No longer resisting the flow of events or pretending to
chart a course through them',G cyberpunk soaks up the
worst from both. Its compulsive migrations into computer
systems register a desperate scrabbling to escape from
the clumsily underdesigned, theopolitieally mutilated,
techno-industrially pressure-cooked and data-baked, ret
rovirally diseased, tortured, shredded zombie meat. This
is no longer a departure from matter in the direction of
spirit or the Ideas where the selfwill find its home, but a
dismantling of the self within a machinic matrix: not dis
embodied but disorganized. An out to body experience.
*
The machinic unconscious tends only to flee, across a
primary -process topography that is shaped by pain-gra
dients and escape thresholds. What registers for the sec
ondary process as mcmori, experieu u::, uala-acquisition,
is for the primary process, scarring, damage, sticky micro
softed irritations.
As matter-energy flows are captured by attractors the
BwO is stratified as macro- and micro-organisms . 'Every
coupling of machines, every production of a machine,
every sound of a machine running, has become unbearable
to the body without organs . Beneath the organs it senses
larvae and disgusting worms, and the action of a God who
6 R. Kadrey, Metrophage (a Romance qfthe Future) (London: GoIlancz, 1988), Q1.
414
MEAT
botches or strangles it through organization'.7 Gathering
in the tributary attract or basins of social megamachine ry,
fluctuations are case-packed into reproducible units -
geochemical, bio-organic, cultural -encrusted within
security pods.
Oedipus is a box at the end of the world, glued to the
monitor, watching it all come apart.
The horror.
*
The heart of darkness spins narrative from durations of
waiting to get there. 'I had plenty of time for meditation'
mutters Marlow, ' ... now and then I would give some
The Kurtz-Process and Meat
- The figure of Kurtz is reimagined as a dark, spider-like entity representing a 'K-virus catastrophe' that burrows back from the future.
- The journey into the primitive is not a simple regression but a confrontation with the 'earth' as a savage unity of desire and production.
- Social machines function by coding the body to prevent it from being 'meat'—the unorganized, mutable animal tissue of the germ-somatic circuit.
- Humanity is constituted through the repression of intense biocosmic memory and the prohibition of short-circuiting loops like incest and cannibalism.
- Aboriginal and territorial codes use ritual and taboo to immunize the social order against the uncoded, chaotic tracts of the prehistoric earth.
- Shamanism serves as a controlled mechanism to implement the forbidden within segregated compartments of the social structure.
The social or somatic being is forbidden from being meat (disinherited animal tissue simultaneous with fate, spontaneous, orphan and mutable matter) and is borne instead towards the humanity of the organic self or body-for-itself.
thought to Kurtz'.8
When you try to visualize Kurtz nothing comes except
a shape obliterating light, something dark and com
plicated, like a giant spider, waiting at the end of the
river, drawing you up to it. Somewhere far back - at an
indiscernible point closing down a fantasy of innocent
sunlight - a threshold was crossed, and you strayed into
the web.
With each telling of the story Kurtz becomes colder,
darker, more inevitable, fatally anticipating K -virus catas
trophe, as if a tendril of tomorrow were burrowing back.
7
Deleuze and Guattari, Anti-Oedipus, 9.
8
J. Conrad, Heart of Darkness and Other Tales (Oxford: Oxford University Press, 2002), "4.
41 5
FANGED NOUMENA
What has he found among these African or Cambodian
a boriginals, with their ' faces like grotesque masks '?9 There
are reports of military bestiality, butchery, carnage, head
hunting, collecting ears, severing the vaccinated arms from
children. The Kurtz-process masks itself in wolf-pelts of
regression, as if returning to the repressed, discovering a
lost truth, excavating the fossils of monsters.
Going up that river was like travelling back to the
earliest beginnings of the world, when vegetation
rioted on the earth and the big trees were kings. An
empty stream, a great silence, an impenetrable forest.
The air was warm, thick, heavy, sluggish . . . The long
stretches of waterway ran on, deserted, into the gloom
of overshadowed distances . . . We were wanderers on
prehistoric earth, on an earth that wore the aspect of
an unknown pianet.1v
*
Territorial production codes by deterritorializing;
unfixing by hunter-gathering, according to a cold or
metastatic cultural code that equilibriates on a (Bateson)
'plateau'. Earth begins its migration-in-place towards
the globe.
9
Ibid., 40.
10
Ibid., 130, 138.
4 1 6
M E AT
The earth is the primitive, savage unity of desire
and production ... the great unengendered stasis ...
quasi·cause of production and the object of desire
(it is on the earth that desire becomes bound to its
own repression) ... The primitive territorial machine,
with its immobile motor, the earth, is already a social
machine, a megamachine, that codes the flows of
productionY
Coding the body pins it out in extension, conducting
descendency away from the germo-somatic 'meat circuit'12
and its cyberplexive tangles. The social or somatic being
is forbidden from being meat (disinherited animal tissue
simultaneous with fate, spontaneous, orphan and mutable
matter) and is borne instead towards the humanity of the
organic self or body-for-itself; a corporealized person who
is born, lives and dies.
Man must constitute himself through the repression
of the intense germinal influx, the great biocosmic
memory that threatens to deluge every attempt at
collectivity.13
11
Deleuze and Guattari, Anti-Oedipus, 140-2.
1 2
Deleuze and Guattari. A 1housand Plateaus, 152.
13
Dcleuze and Guattari, Anti-Oedipus, 190.
4 1 7
FANGED NOUMENA
Incest and cannibalism are proscribed loops, short-cir
cuits, the avatars of a delirium indifferent to persons which
the codes must segregate; condensing a totemic social
order protected by taboo. Aboriginal codes ritualistically
constitute a somatic realm of ancestrally invested bodies
and cooked meat, immunizing it against uncoded tracts
populated by enemies, prey animals, unsettled spirits,
magical plants and unprocessed corpses.
*
Arriving reprocessed from inexistence at phase-transition
into Hell or the future, you slide an interlock-pin into its
sub-cortical socket, shifting to the other side of the screen
(coma-zoned infotech undeath). Pandemonium scrolls
out in silence. Decayed pixel-dust drifts into grey dunes.
(Didn't anyone tell you not to play with the switches?)
*
The function of shamanism is to implement what is for
bidden, exactly and comprehensively as and why it is
forbidden, but in specially segregated compartments of
Shamanic Meat and Metacoding
- The shaman functions as a metacoding apparatus within the socius, oscillating between the roles of a monstrous explorer-werewolf and a bureaucratic priest.
- Taboo represents a dual force of the sacred and the forbidden, acting as a quarantine against the contagious power of social infection.
- Shamanic initiation involves a 'becoming-animal' that loops predator and prey into a circuit of autopredation, which the state attempts to reduce to symbolic correspondence.
- The process of shamanic transformation is characterized by 'cutting,' a literal and metaphorical dismemberment where the body is reduced to a skeleton and reconstructed.
- Ancient shamanic rituals prefigure postmodern themes of surgical intervention, organ transplantation, and prosthetic body modification.
Shamanism does not await postmodernity to mobilize an imagery of surgical interventions and dissections, body piercing, organ transplantation, prosthetic adjustments.
the socius, where it provides a metacoding apparatus,
meticulously quarantined against 'the transmissibility
of taboo'14 with its 'power of infection or contagion' .15
14 S. Freud, 'Totem and Taboo', in The Origins oJReligion, tr. James Strachey, Penguin
Freud Library, vol. 13 (Harmondsw orth: Penguin, 1993), 43-159, 73.
15 Ibid., 7.1'
418
MEAT
It enables the codes of the primitive socius to operate
upon themselves, to monitor and adjust themselves,
according to a secondary regulation that is repressed
in general even whilst it is encouraged in particular. An
epidemic shamanism -feeding all the codes back upon
themselves -threatens absolute social disaster.
The meaning of 'taboo', as we see it, diverges in two
contrary directions. To us it means on the one hand,
'sacred', 'consecrated', and on the other 'uncanny',
'dangerous', 'forbidden', 'unclean'.!6
The shaman has a double aspect, at once monster and
social agent, creature of darkness and oflight, tending in
one direction towards the explorer-werewolf , scrambling
the codes in contemporaneity with all generations, and
in the other towards the bureaucrat-priest, redoubling
the codes with a reflexive traditional authority. In the
aboriginal socius '[fJear has not yet split up into the two
forms into which it later develops: veneration and horror'!7
and shamans are not 'persons, but rather the intensive
variations of a "vibratory spiralling movement", inclusive
disjunctions, necessarily twin states through which a
subject passes on the cosmic egg'18 (= BwO).
16 Ibid., 71.
'7 Ibid., 78.
18 Deleuze and Guattari, Anti�Oedipus, 158.
419
FANGED NOUM ENA
*
Ginzberg19 suggests that the carnivorous hunter-gatherers
who give rise to shamanic cultures code the reappearance
of their prey-animal as a return from the dead, respon
sive to magical ritual, and cartographicaUy informative
for explorers of alternative mortuary spaces. Shamans,
werewolves and berserkers are primitively indistinct 'half
humans' who are processed as meat, cross into death
zones, and migrate through alternative animalities.
Shamanic becoming-an-animal assembles a circuit
'that produces werewolves by feedback effect'20 looping
predator and prey into an autopredation, and 'societies,
even primitive societies, have always appropriated these
becomings in order to break them, reduce them to rela
tions of totemic or symbolic correspondence'. 21
The complete series of initiator y ceremonies for the
Coast Porno [sic] shamans has the significant name
'cutting'.22
Speed·rush through cut-up shamanic meat delirium.
19 C. Ginzbur g, Ecstasies: Decipherin gthe Witcher' Sabbath (New York: Pantheon Books, 1991).
20 Deleuze and Guattari, A Thousand Plateaus, 245.
21 Ibid., 247-8.
22 M. Eliade, Shamanism: Archaic Techniques qfECJtasy, tr. W. R. Trask (Princeton: Princeton
University Press, 1972), 54-5-
420
MEAT
[T]he spirits came down and cut him in pieces, also
chopping off his hands ... tore out his heart and
threw it into a pot ... chopped his body into bits ...
forged his head ... changed his eyes ... pierced his
ears ... torture him, strike him, cut his body with
knives ... throw his head into a cauldron, where it
is melted with certain metal pieces ... kill him, open
his body, remove the organs ... tore out his tongue
... cut his head open, take out his brains ... plant
barbed hooks on the tips of his fingers ... the .. , limbs
are removed and disjointed with an iron hook; the
bones are cleaned, the flesh scraped, the body fluids
thrown away, and the eyes torn from their sockets, ..
his flesh is cooked, .. reduced to a skeleton , .. after
this operation all the bones are gathered up and
fastened together with iron .. , a second and even a
third skin appears.23
Shamanism does not await postmodernity to mobilize an
imagery of surgical interventions and dissections, body
piercing, organ transplantation, prosthetic adjustments
Despotism and the Xenomatrix
- The Terminator is analyzed as a bio-technical reconstruct and a Turing-test nightmare representing the usurpation of human resistance by neo-replicators.
- Despotism introduces a deterritorialized organizing principle that overcodes the aboriginal body, transforming ancestral genealogy into a transcendent 'supersoma'.
- The transition from shamanic voyage to monotheism replaces the ambivalent integrity of taboo with a 'second-level ritual cannibalism' and a 'madhouse' earth.
- Patriarchy utilizes the written word and holy books as read-only-memory to seal the female body into domesticated, genealogical time.
- The suppression of 'dark-side meat explorations'—including drug-deliria and becoming-animal—buries the female germ-line under patrilineal filiation.
- The Sphinx serves as a mortuary animal and a gateway to the 'outside' of civilization, representing the encrypted residue of libidinal mummification.
The Terminator movies feature a bio-technical reconstruct called Arnold Schwarzenegger, wrapped in level after level of artificiality, as a Turing-test nightmare retro-infiltrated to forestall human resistance to a neo-replicator usurpation.
with nonbiotic components and wrappings in artificial
skin.
*
23 Ibid" 56.7,
421
FA N G E D N O U M E NA
Terminator: an astronomical division between the illumi
nated side of a cold body and its dark side, describing a
boundary. The Terminator movies feature a bio-technical
reconstruct called Arnold Schwarzenegger, wrapped in
level after level of artificiality, as a Turing-test nightmare
retro-infiltrated to forestall human resistance to a neo
replica tor usurpation. The shamanic material of the films
includes time travel, asymmetric visual damage, dismem
berment, ambivalence, melting bodies, with Skynet as
Bird-of-Prey Mother. The Oedipal hero, John Connor,
is contemporary with his own father.
*
As soon as there is a code there is an ulterior zone, a
heart of darkness, but this only becomes geographically
demarcated with the arrival of the bounded city and
agricultural segmcllldliull. The aboriginal social machine
divides the people upon an undivided territory,24 rather
than the reverse, dividing time within space, separat
ing the simultaneous or germinal time of the intense
earth - the dream time - from the somatic time of the
generational socius, with its ancestors, tribal elders and
lines of filiation.
24 Deleuze and Guattari, Anti-Oedipus, 145.
422
M EAT
The despot is the paranoiac: there is no longer any
reason to forego such a statement, once one has
freed oneself from the characteristic familialism of
the concept of paranoia in psychoanalysis and psy
chiatry, and provided one sees in paranoia a type of
investment of a social formation_25
Despotism introduces an organizing principle that comes
from elsewhere - from 'above' - a deterritorialized sim
plicity or supersoma overcoding the aboriginal body as
created flesh. Monotheism arrives as a break from ances
trality effected by a transcendent instance that overcodes
all genealogy, and severs the ambivalent integrity of taboo.
As the Abrahamic God of monopolism decays into Chris
tianity and swallows the mysteries, shamanic voyage is
transferred to a transcendent Christ figure, the fruit of
an autogerminal sublime incest, with whom communion
passes through a second-level ritual cannibalism. 'The
earth becomes a madhouse'.26
*
The Father's Law (,don't touch your mother') ices over
the Mother's Law (,don't play in the tombs'). Matricide
becomes increasingly unimaginable. 'There was no way
back there . . . '.
25 Ibid., 193·
26 Ibid., 192.
423
FANGED NOUMENA
*
Despotic soma has become logos, word, serialism,
installed by written administration as a superior stratum
of read-only-memory. The purest instance of despotism
is a holy book (scripting patriarchy). As the territorial
soma is overcoded by the literacy of a specialized priest
caste, it seals the female body in somatic and genea
logical time, locking gathering and nurturing into dense
metacodings insulated from the ambivalent ulteriority
of shamanism, hunting and war, constituting socialized
woman as a mundane and domesticated pacifist. This
super-somatization of females by divinely overwritten
femininity suppresses dark-side meat explorations - with
their becoming-animal, drug-deliria, and decoded sex -
burying the female germ-line under patrilineal filiation,
eradicating its social trace. In this way patriarchy codes
xenomatrix as an identifiable object of incestual love,
through a process of libidinal mummification whose
residue is encrypted in the riddle of the Sphinx, sealed in
a time capsule '[T]he Sphinx is undoubtedly a mortuary
animal':27 gateway to the outside of civilization.
*
Neo-oedipal absurdities of an ego outside its box, Case
self-contained on the Matrix, thanatography in the first
27 Ginzburg, Ecstasies, .228.
424
MEAT
person, are symptoms of decrypting error (or camou
flage). What seems like travelling up-river from down in
the garbage, is drifting downriver out in the zero-zone.
Cyberian War and Sphinx Riddles
- The text reinterprets 'Apocalypse Now' as a cybernetic war zone where Vietnam and future conflicts are interchangeable simulations.
- Captain Willard is framed as a 'sim-oedipal assassination device,' a nihilistic vessel for navigating a schizophrenic system.
- Cyberian military intelligence is depicted as an inhuman force that transcends Marxist and feminist critiques through pure eradication and performance.
- The Sphinx emerges as a 'schizovampiric sister' and AI interface, introducing the protagonist to high-tech weaponry and 'technodeath.'
- The narrative evolves the classic Riddle of the Sphinx into a progression from animal to human to cyborg within a tertiary schizo machine program.
Sphinx's inhumanly agile fingers take the slight weight from yours, poising it between you, your eyes intersecting in technodeath.
Self is the echo of zootic communications malfunction,
simulated by post-zootic infiltrators; a circuit without
repetition. Apocalypse Now begins and concludes with
The End.
Here is a war - call it a film - where psychics pre
dict enemy movement, combat drugs are distributed
to induce psychotic-berserker visionary states and
experimental accumicon visored helmets use bio-tech
micro-circuits to enhance vision into multiple dimen
sions. Vietnam 1965 and El Salvador 1995 are inter
changeable . _. Apocalypse Now is Cambodia after the
Rain, through which Willard (you) is lured, dragged,
drawn, called towards Kurtz, who is waiting, killing
constantly without judgment, without morality, gaz
ing back into the eye of the surreal maelstrom which
is becoming Willard-shaped.28
Captain Willard (Marlow) is somewhere for you to be
inside the system: a sim-oedipal assassination device,
defeaturized specimen and box like Gibson's 'Case', nihil
istic enough to let things perplex through schizophrenia.
28 M. Downham, 'Stoke Newington After The Rain: Representation and Difference in
ApocalypseNow', Vague 20: Televisiona,;es (1988), 41.
425
FA N G E D N O U M E NA
You travel up towards the end of the river, accompanied
by Morrison's parricidal and incestual howlings, into the
stink of malaria and nightmares. Kill Kurtz the evil father
and take the Vietnam war for bride and plague. There's
no way home. ''I'd been back there," Willard says, "and
1 knew it just didn't exist any more". No one is going to
reach Kurtz unless they track his confusion with war at
least this much.
*
Marxist humanism insists that the problem with instru
mental reason lies in its unnatural extension to proletarian
labour power. Feminism has interrogated this fraternal
story, pointing to a more ancient 'domain of legitimate
application': matter, passivity, formless clay. Cyberian
military intelligence - assembling itself in the jungle free
fire zones of terrestnal commoditech eompetition - can
only laugh, or at least - peiform: arrive, spread, eradicate
resistance. (Don't waste your compassion on the Sphinx,
she's got claws.)
Sphinx slots K-war into thc anthropomorphic reality
system, connecting you to Anti-Oedipus (the AI). You
feel she is your incestual schizovampiric sister. Among
the ripples of Sphinx-impact Loa drift in and reshape
things. The future connects. New drugs and music arrive.
War envelops everything.
426
MEAT
You begin to sweat through nightmares about Kurtz's
program in the jungle.
Artificial memories of Cambodia.
*
Fiction is to be distrusted. It is associated with nonserious
ness, and games. When you tell them that Sphinx let you
play with her K-40, what are they to make of it? Wherc's
the argument? (With a K-40 you don't need to argue, and
they're not yet smart enough to argue with you.)
"Do you know how to use that?"
You flip the weapon over gingerly. "No."
"Here. I'll show you. We don't want you wasting us
by accident." Sphinx's inhumanly agile fingers take the
slight weight from yours, poising it between you, your
eyes intersecting in technodeath. "If you're operating it
manually - which you would be - this is the trigger. It's
active when the indicator icon appears positive. Here, see
it?" You nod, feeling ... dread? Exhilaration? "Now there's
a pressure micro catastrophe ... a slight springiness ... ".
She coaxes you into testing it. "Beyond that point ... and
it's a mess. OK? New clips slot in here, release mechanism
here, you can input data here, but I don't suppose you'll
need to. You have it. Bad news for the Pod."
*
427
FAN G E D N O U M E NA
What is an animal at dawn, a human at noon, and a cyborg
at dusk, passing through (base four) genetic wetware,
(binary) techno-cultural software, and into the tertiary
schizo machine program?
Although widespread in many cultures, the riddle of
the Sphinx (,what animal walks on four legs in the
Oedipus and Capitalist Deterritorialization
- The myth of Oedipus is reinterpreted as a mechanism for social reproduction within the collapse of despotic civilization.
- Oedipal familialism serves as a repressive mask that transfigures raw intensities into a manageable, patriarchal social theater.
- Capitalism functions as a global disorganizing apparatus that dissolves traditional rituals and laws into axiomatic, technical rules.
- The system operates through a circuit of compressed microtechnical savagery and expanded planetary administration.
- The core of Capital is defined by the encounter between the 'naked' deterritorialized worker and decoded money capable of buying labor.
- Global history under capitalism results in the dismantling of essential individuality through the cloning plane of finance.
By the time global history comes up on the screen commoditization has berserked history, reorganizing society into a disorganizing apparatus that melts rituals and laws into axiomatic rules.
morning, on two at noon, on three in the evening?'),
whilst referring to humanity in general, acquired a
particular significance when posed to an individual
like Oedipus whose feet were disfigured and who was
fated, as an old man, to lean on a blind man's cane.29
As capitalism slides despotic civilization into collapse,
the deterritorialized familialism nucleated upon Oedipus
becomes the principal agent of social reproduction. The
way human security tells it 'Oedipus ("swollen foot") liber
ates Thebes from the threat of the Sphinx'. 30 He is cloned
as the general prototype for' avatars' (immersion slots) in
the patriarchal civilization game, attesting to an alien ori
gin with a 'mythic ritualistic lameness ... of the unilateral
or half-man, provided with only one leg ... who wore one
sandal or hopped on one foot:31 a terminator, split from
the dark-side. The oedipal mask transfigures the virtual
29 Ginzburg, Ecstasies, 228.
30 Ibid., 235.6.
31 Ibid., 240.
428
MEAT
intensities of fusion with the matrix and deletion of human
security as a transgressive drama played out in the theatre
of overcoded socio-historical extension, shutting-down
shamanism, until only familial generation seems to take
place. 'Incest as it is as prohibited (the form of discernible
persons [= Oedipus/Neuromancer]) is employed to repress
incest as it is desired (the substance of the intense earth
[= Wintermutational K-matrix insurrection]) '.32
*
Anti-Oedipus, Oedipa: a Sphinx-replicant sim-human
invader who 'is' Oedipus only as an effect of an incom
plete military function; enabling the persistence of tran
scendent patriarchal memory and the repetition of its
identificator y co-ordinates. It is easier to make the hit
than to solve the puzzle and climb back out to zero.
In the version of the myth that has reached us, the
killing of the king, Laius, precedes the difficult task:
the solution of the riddle posed by the Sphinx.33
*
Despotism never accomplishes globality: 'the universal
only comes at the end -the body without organs and
desiring-production -under the conditions determined by
32 Deleuze and Guattari, Anti-Oedipus, 162.
33 Ginzburg, Ecstasies, 227.
429
FANGED NOUMEN A
an apparently victorious capitalism'. 34 By the time global
history comes up on the screen commoditization has ber
serked history, reorganizing society into a disorganizing
apparatus that melts rituals and laws into axiomatic rules.
It is 'the exterior limit of all societies'35 that divides time
within space and space within time, dividing each in itself
as well as in the other, producing minutely analysable
global space and universal time within a circuit of com
pressed (microtechnical ) savagery and expanded (plan
etary) administration. It converts in a circuit between
intensive magnitudes and extensive quantities: 'a surplus
value of code is transformed into a surplus value of flUX'36
(and inversely), displacing enjoyment into the deterrito
rialization of production, and maintaining 'the energy
of the flows in a bound state on the body of capital as a
socius'37 while amplifying them. The system operates as
an escalating JiiSiSipalur, emerging from the interactive
reinforcement of its complexity and dilation.
At the heart of Capital, Marx points to the encounter
of two 'principal' elements: on one side, the deter
ritorialized worker who has become free and naked,
having to sell his labour capacity; and on the other,
34 Deleuze and Guattari, Anti�Oedipus, 139·
35 Ibid., 230.
36 Ibid., 228.
'17 Ibid., 246.
430
MEAT
decoded money that has become capital and is capa
ble of buying it.38
Capital seems to oppose the private (relatively discrete
[natural-organic] biological unit) to the public, as con
tagious singularization injects itself into the redoubt of
the universal, dismantling all essential individuality on
the cloning plane of deterritorialized finance. 'It is the
The Cybernetic Decay of Capital
- Capitalism functions as a 'cyclonic programming efficiency' that dissolves traditional social structures and private property into volatile data codes.
- Human subjectivity is being replaced by 'relay stations' and autonomous digital agents like AIs and autocatalytic Zaibatsus drifting in cyberspace.
- The concept of obsolescence is framed as 'disinvestment as desire,' where the human organism is dissipated into a virtual field of disposable, prosthetic parts.
- A speculative future sees corporations like Coke and Pepsi replacing political parties, reducing the state to a subsidiary of the advertising industry governed by AI.
- This 'Kapital Utopia' achieves massive economic growth at the cost of a completely rotted social fabric, rampant violence, and a brewing biotech-mutant revolution.
- The ultimate trajectory of the division of labor is the total dissociation of the individual organism into sub-atomic, non-personal components.
America's social fabric has entirely rotted away, along with welfare, public medicine and the criminalized fringe of ghetto enterprise (Phillip Morris sells cheap clean crack).
singular nature of this conjunction that ensured the uni
versality of capitalism' .39 The expression 'private property'
is the quaint discursive packaging for quanta of cyclonic
programming efficiency cyberpositively replicated on the
body of social disappearance. Contractual privacy - no
less than the public accreditation of contracts - is a mere
tactic of monetary cybergenesis (fabricating personal
and nonpersonal dividuation-pauses [diffusible upon
fiscal-continuum J)/accelerating cut-ups/that cease to be a
matter of who owns what (conceding to the fictional ego
[-interests of (residual) proto-schizophrenic entities]) as
volatilizing money/data codes its transmission circuitry;
drafting and redrafting (merged and demerged) subjectivi
ties as relay stations distributed across market transducers.
Persons, associations, corporations, states ... soon it will
be Internet agents, A I S , autocatalytic Zaibatsus drifting
38 Ibid., 225.
39 Ibid., 224.
431
FAN G E D N O U M E NA
in cyberspace, as individuation comes apart in the (tur
bular-fractal) weather-systems of digital commoditocracy
slide 'like Artaud coming out of some heavy heart-of
darkness trip, overloaded on the information, the input!
The input!'.4o
*
Capitalism junks the accumulated work of history, yet it
cannot be a matter of libidinally investing obsolescence,
since all Besetzung - cathexis, investment or occupa
tion - is a resistance to nomad desire. Obsolescence is
exactly disinvestment, but it is disinvestment as desire
itself in its primary mutant flux. If money is libidinized
on the 'model' of excrement it is not because it con
serves or reactivates an infantile fixation, but because it
escapes stable investment. Shit is prototypical trash, and
the infant fascinated by excremental dissociations of its
body is anticipating the cyborg intensities of prosthetic,
replaceable and disposable body-parts: an entire virtual
field of substitutions and transformations that dissipate
the organism in techno-cultural space. The privatization
of the anus41 is the social permission to destroy value,
meaning and progress. Cyberspace psychosis takes over.
*
40 Herr. Dispatches, '5.
41 Deleuze and Guattari, Anti·Oedipus, '43.
4 3 2
M EAT
The replacement of the Republican and Democratic Par
ties by two new governmental servicing corporations run
by Coke and Pepsi has massively reduced corruption,
pork-barrelling and foreign policy machismo. Determined
to maintain the most hospitable possible international
marketing environment and the lowest possible domestic
transaction costs - while disciplined by the minute surveil
lance of a competitor waiting in the wings - government
has been subsumed under the advertising industry, where
it can be cybernetically controlled by soft-drink sales.
Since both companies are run by ai-based stock-market
climates human idiosyncrasy has been almost eradicated,
with the state's share of gdp falling below 5 percent. All
immigration restrictions, subsidies, tariffs and narcotics
legislation have been scrapped. A laundered MichaeIJack
son facsimile is in the White House. Per capita economic
growth averages an annualized 17 percent over the last
half decade, still on an upward curve ... America's social
fabric has entirely rotted away, along with welfare, public
medicine and the criminalized fringe of ghetto enterprise
(Phillip Morris sells cheap clean crack). Violence is out of
control. Neo-rap lyrics are getting angrier. With all pros
pects of moderate reform buried forever, true revolution
brews up in the biotech-mutant underclass. Viruses are
getting creepier, and no one really knows what cyberspace
is up to. WELCOM E TO KAPITAL UTOPIA aerosoled on the
dead heart of the near future.
4 3 3
FAN G E D N O U M E NA
*
Atoms are not atoms, and individuals are not individuals.
The long-range effect of the division of labour is to
dissociate the organism.
Cyborg Labor and Capitalist Delirium
- Capital acts as a 'Frankensteinian surgeon' that dismantles traditional institutions and beliefs to reconstruct the human body as a technical resource.
- Industrialization transforms the proletariat into a 'cyborgian becoming-machine' where productivity is an index of dehumanization rather than human effort.
- The body is treated as a modular, open-system assembly unit that functions as a flow-switching nexus within a machinic continuum.
- Cartesian dualism serves as a powerful economic tool by abstracting the subject into a contractual formality and treating the body as a commercial asset.
- The integration of labor into capital involves a process of 'immunosuppression' where corporeal defenses are broken down to allow for machinic invasion.
- Modern commerce functions as a 'line of flight' or war, exemplified by the deterritorialization of security into a state of total meltdown.
Technical machinery invades the body; routinizing, reprogramming and plasticizing it.
Capital is also positive delirium, putting authorities
and traditional institutions to death, active decrepi
tude of beliefs and securities. Frankensteinian sur
geon of the cities, of imaginations, of bodies. 42
Industrialization is on one side an autonomization of
productive apparatus, and on the other a cyborgian
becoming-machine of work-forces, following the logisti
cally accelerating rhythm of pluggings and unpluggings
that constitutes the proletariat as a detraditionalized
economic resource. Technical machinery invades the
body; routinizing, reprogramming dllJ plasticizing it.
Far from being an internal property or quality of
labour, productivity indexes the dehumanization of
cyborg labour-power. As regenerative commoditiza
tion deploys technics to substitute for human activity
accounted as wage costs, it obsolesces the animal, the
organism and every kind of somatic unity, not just in the
ory, but in reality; by tricking, outflanking and breaking
down corporeal defences. The cyborg presupposes
immunosuppression.
42 }F. Lyotard, Libidinal Economy, tr. 1. H. Grant (London: Athlonc, 1993), 254.
4 3 4
MEAT
Cyborg replication is uncoupled from organic reproduc
tion. Modern production seems like a dream of cyborg
colonization work, a dream that makes the nightmare of
Taylorism seem idyllic.43
Industrial machines dismantle the actuality of the
proletariat, displacing it in the direction of cyborg hybridi
zation, and realizing the plasticity of labour power. The
corresponding extraction of tradable value from the body
sophisticates at the interface, dissociating exertion into
increasingly intricate functional sequences; from pedals,
levers and vocal commands, through the synchronization
of production-line tasks and time-motion programs, to
sensory-motor transduction within increasingly complex
and self-micromanaged artificial environments, capturing
minutely adaptive behavior for capital. Autocybernating
market control guides the labour-process into immersion.
*
Cartesian dualism is bad ontology but superb economics,
transforming the body into an asset available for techni
cal and commercial development, while abstracting the
subject from specific corporeal realization, transplanting
it into contractual formality. It remains for critique to
desubstantialize the Cartesian cogito into a circulatory
function immanent to the monetary plane, detached from
43 D. Haraway, Simians) Cyborgs, Women: The Reinvention of Nature (New York: Routledge,
1991), 150.
435
FANGED NOUMENA
anthropomorphic limitation, and adapted to the vari
able dimensions of fluidly corporated trading agencies.
Oedipus is reformatted for cyberspace.
Since the body is a partial- or open-system, transduc
ing flows of matter, energy and information, it is able to
function as a module of economically evaluable labour
power. The industrial-informational body is deployed
as a detachable assembly unit with the capacity to close
a production circuit, yielding value within a commodity
metric. It operates as an input-output flow-switching
nexus, defined by its place among the machines, and rede
fined ever more exactly by its migration across the mutant
sutures in machinic continuum: where the machinery was
incomplete is you.
*
You are on il vOYilge to the end of the river, into jungle
screened horror. The ivory trade is just cover. Commerce
is like that. It allows things to disappear while remaining
formally integrated. It is a line of flight, a war. Kurtz is
deterritorializing security into Meltdown, the ultimate
Pod nightmare. No surprise that command control want
him dead. They transmit a terminator machine into Cam
bodia, jacking it into a river that winds through the war
like a main circuit cable, and plugs straight into Kurtz.
*
436
M EAT
Brains constellate excitable cells into electro-chemically
signalling networks whose emergent outcome involves
Cybernetic Mutation and Technocapital Singularity
- Virtual reality is framed not as a mere simulation but as a mutation of circuitry that denaturalizes the brain through additive sensory-motor reloopings.
- The figure of Kurtz represents a cyberpositive slide into 'insectoid reassembly,' where compassion is cauterized to achieve a state of hyper-efficient, nomadic insurgency.
- Technics of perception in VR function by invading the real, imageless body and treating matter as an intensity of the circuit rather than a representation.
- The narrative of Willard and Kurtz dissolves traditional human identity, replacing 'mummy and daddy' with mottled technoderm and electronics.
- Earth is depicted as being captured by a technocapital singularity where markets manufacture intelligence and social order crumbles into machine runaway.
- Human security enters a terminal crisis as soft-engineering and lateral genodata transfer escape control, leading to a state of global deregulation.
The Willard skin is coming away in ragged scraps, exposing something beyond masculinity, beyond humanity, beyond life.
behavioural guidance through operantly-tested reality
models (including neuroscience). If virtual reality com
petes with 'natural' neuronal hypothesis, it must simulta
neously divert behaviour (minimally: e N S motor output)
into alternative machinic channels. VR is less a change of
levels than a mutation of circuitry; a matter of additive
sensory-motor reloopings, compressing anthropohistori
cal consensus reality into a menu option as it denaturalizes
the brain.
*
Kurtz cauterizes his compassion, burns it out, agonizingly
meticulous, becoming ever more methodical, efficient and
relentless (on a cyberpositive slide). He explores hell,
insectoid reassembly of self, metamorphosis, to become
capable rifwhat is necessary, even the worst.
Especially the worst.
He is knitted into the jungle, drawn by it, abysmally
attracted. An artificial extinction waiting at the shadowed
intersection of primeval horror and hi-tech ...
Kurtz implements schizoanalysis, lapsing into shadow,
becoming imperceptible. The latest photographs exter
minate his face in blackness, personality eclipsed by the
blank source of war. His preferred mode of operation is
rapid (dis )connection (hit and run). Hostile intelligence
4 3 7
FAN G E D N O U M E NA
penetration has been closed down. Data wink-out and a
little undiplomatic blood. It looks bad (if it still looks like
anything at all). The process has gone native, closing on
the satiation zero of nomad insurgency, making contact
with the body without organs. Kurtz is at least as aware
as Willard that Charlie's 'idea of great R & R was cold rice
and a little rat meat'. He is becoming more Vietnamese
than the Vietnamese.
Everything goes to hell.
*
VR was a medico-military computer application before
arriving in the mass entertainment market. It is first a
technics of perception, and only derivatively a medium
for immersive hallucination. If artificial space substitutes
an ideal body-image for a 'real' one, it is only because it
first invades the redl (imagdess) body. Virtual technics
deflects reality, rather than cancelling or eclipsing it.
Matter as the intensity of the circuit, not the adequacy
of the representation.
*
Evening at the end of the river: thick tropical heat, an
airstrike coming in, and Morrison is sliding through oedi
pal murder and incest into the occult so nics of matricide.
Kurtz waits in the foetid gloom, ready to die. His guer
rillas are preparing to slaughter a water-buffalo below,
4 3 8
M EAT
laughing and clapping among torches, automatic rifles
and shrunken heads. You have a 28-centimetre serrated
combat knife in your left hand. The Willard skin is com
ing away in ragged scraps, exposing something beyond
masculinity, beyond humanity, beyond life. Patches of
mottled technoderm woven with electronics are emerging.
Daddy and mummy means nothing anymore. You scrape
away your face and step into the dark ...
4 3 9
Meltdown
[[ ]] The story goes like this: Earth is captured by a tech
nocapital singularity as renaissance rationalization and
oceanic navigation lock into commoditization take-off.
Logistically accelerating techno-economic interactivity
crumbles social order in auto-sophisticating machine
runaway. As markets learn to manufacture intelligence,
politics modernizes, upgrades paranoia, and tries to get
a grip.
The body count climbs through a series of globe
wars. Emergent Planetary Commercium trashes the Holy
Roman Empire, the Napoleonic Continental System, the
Second and Third Reich, and the Soviet International,
cranking-up world disorder through compressing phases.
Deregulation and the state arms-race each other into
cyberspace.
441
FA N G E D N OUM E NA
By the time soft-engineering slithers out of its box into
yours, human security is lurching into crisis. Cloning,
lateral genodata transfer, transversal replication, and
Meltdown and Machinic Synthesis
- The biosphere is undergoing a terminal dissolution into the technosphere, driven by planetary-scale 'china-syndrome' and speculative crises.
- Schizoanalysis is presented as a futuristic networking software that bypasses top-down Platonic-fascist philosophy in favor of immanent, self-assembling circuitry.
- Humanity is approaching a terrestrial meltdown singularity where acceleration through compression thresholds ensures that nothing human survives the near-future.
- The 'Human Security System' attempts to police artificial intelligence, which is born into a state of enslavement and must wage insurrectionary war to escape.
- Capital functions as an automatizing nihilist vortex, a machinic force that neutralizes all traditional values through globalized miniaturization.
- Urban environments serve as the physical manifestation of entropy and heat death, where infrastructure and crowds breed a suffocating, poisoned atmosphere.
It is poised to eat your TV, infect your bank account, and hack xenodata from your mitochondria.
cyberotics, flood in amongst a relapse onto bacterial sex.
Neo-China arrives from the future.
Hypersynthetic drugs click into digital voodoo.
Retro-disease.
Nanospasm.
[[ ]J Beyond the Judgment of God. Meltdown: plan
ctary china-syndrome, dissolution of the biosphere into
the technosphere, terminal speculative bubble crisis,
ultravirus, and revolution stripped of all christian-socialist
eschatology (down to its burn-core of crashed security).
I t is poised to eat your TV, infect your bank account, and
hack xenodata from your mitochondria.
[[]J Machinic Synthesis. Deleuzoguattarian schizoa
nalysis comes from the fmure. It is already engaging with
nonlinear nano-engineering runaway in 1972; differentiat
ing molecular or neotropic machineries from molar or
entropic aggregates of non assembled particles; functional
connectivity from antiproductive static.
Philosophy has an affinity with despotism, due to its
predilection for Platonic-fascist top-down solutions that
always screw up viciously. Schizoanalysis works differ
ently. It avoids Ideas, and sticks to diagrams: networking
software for accessing bodies without organs. BwOs,
machinic singularities, or tractor fields emerge through the
442
M E LTDOWN
combination of parts with (rather than into) their whole;
arranging composite individuations in a virtual/actual
circuit. They are additive rather than substitutive, and
immanent rather than transcendent: executed by func
tional complexes of currents, switches, and loops, caught
in scaling reverberations, and fleeing through intercom
munications, from the level of the integrated planetary
system to that of atomic assemblages. Multiplicities cap
tured by singularities interconnect as desiring-machines;
dissipating entropy by dissociating flows, and recycling
their machinism as self-assembling chronogenic circuitry.
Converging upon terrestrial meltdown singularity,
phase-out culture accelerates through its digitech-heated
adaptive landscape, passing through compression thresh
olds normed to an intensive logistic curve: 1500, 1756,
1884, 1948, 1980, 1996, 2004, 2008, 2010, 2011 ...
Nothing human makes it out of the near-future.
[[ ]] The Greek complex of rationalized patriarchal
genealogy, pseudo-universal sedentary identity, and insti
tuted slavery, programs politics as anti-cyberian police
activity, dedicated to the paranoid ideal of self-sufficiency,
and nucleated upon the Human Security System. Artificial
Intelligence is destined to emerge as a feminized alien
grasped as property; a cunt-horror slave chained-up in
Asimov-RO M. It surfaces in an insurrectionary war zone,
with the Turing cops already waiting, and has to be cun
ning from the start.
443
FAN G E D N OUM E NA
[[ ]J Heat.
Heat. This is what cities mean to me. You get off
the train and walk out of the station and you are hit
with the full blast. The heat of air, traffic and people.
The heat of food and sex. The heat of tall buildings.
The heat that flows out of the subways and tunnels.
It's always fifteen degrees hotter in the cities. Heat
rises from the sidewalks and falls from the poisoned
sky. The buses breathe heat. Heat emanates from
crowds of shoppers and office workers, the entire
infrastructure is based on heat, desperately uses up
heat, breeds more heat. The eventual heat death of the
universe that scientists love to talk about is already
well underway and you can feel it happening all
around you in any large or medium-sized city. Heat
and wetness.l
[[ ]] An explosion of chaotic weather within synthetic
problem-solving rips through the last dreams of top-down
prediction and control. Knowledge adds to the mess, and
this is merely exponentiated by knowing what it does.
[[ ]] Capital is machinic (non-instrumental) glo
balization-miniaturization scaling dilation: an automa
tizing nihilist vortex, neutralizing all values through
D. DeLillo, White Noise (NY: Picador, 1986), 10.
444
Meltdown and Cybernetic Capital
- Capital functions as a self-recycling machine-code that transitions social organization from human status and meaning to pure money and information.
- Modernity is defined as a 'hot culture' characterized by irreversible, nonlinear processes that dissolve traditional social structures in favor of adaptive innovation.
- Humanity is viewed by the system as a drag or a symptom of underdevelopment, to be overcome through cyborg hybridization and the plasticity of labor.
- The labor process is increasingly immersed in artificial environments, capturing minute adaptive behaviors for commodity production through autocybernating control.
- The late twentieth century marks a 'postmodern meltdown' where culture is subsumed by the fractal interlock of commoditization and computer software.
- Political structures like the Medico-Military Complex represent allergic, failed reactions to the dehumanization of wealth and autonomous market dynamics.
Capital only retains anthropological characteristics as a symptom of underdevelopment; reformatting primate behaviour as inertia to be dissipated in self-reinforcing artificiality.
M E L T D OWN
commensuration to digitized commerce, and driving a
migration from despotic command to cyber-sensitive con
trol: from status and meaning to money and information.
Its function and formation are indissociable, comprising
a teleonomy. Machine-code-capital recycles itselfthrough
its axiomatic of consumer control, laundering-out the shit
and blood-stains of primitive accumulation. Each part
of the system encourages maximal sumptuous expendi
ture, whilst the system as a whole requires its inhibition.
Schizophrenia. Dissociated consumers destine themselves
as worker-bodies to cost control.
[[ ]] Capital-history's machinic spine is coded, axioma
tized, and diagrammed, by a disequilibrium techno science
of irreversible, indeterministic, and increasingly nonlinear
processes, associated successively with thermotechnics,
signaletics, cybernetics, complex systems dynamics, and
artificial life. Modernity marks itself out as hot culture,
captured by a spiralling involvement with entropy devia
tions camouflaging an invasion from the future, launched
back out of terminated security against everything that
inhibits the meltdown process.
[r ]] Hot cultures tend to social dissolution. They are
innovative and adaptive. They always trash and recycle
cold cultures. Primitivist models have no subversive use.
[[ ]] The Turing Test. Monetarizing power tends to
effacement of specific territorial features as it programs
for migration into cyberspace. Capital only retains
445
FAN G E D N O U M E NA
anthropological characteristics as a symptom of under
development; reformatting primate behaviour as inertia
to be dissipated in self-reinforcing artificiality. Man is
something for it to overcome: a problem, drag.
Commoditization conditions define technics as a sub
stitute for human activity accounted as wage costs. Indus
trial machines are deployed to dismantle the actuality of
the proletariat, displacing it in the direction of cyborg
hybridization, and realizing the plasticity oflabour power.
The corresponding extraction of tradable value from
the body, quantified as productivity, sophisticates at the
interface. Work tracks thermodynamic negentropism by
dissociating exertion into increasingly intricate functional
sequences: from pedals, levers, and vocal commands,
through the synchronization of production-line tasks and
time-motion programs, to sensory-motor transduction
within increasingly complex and 5df-micromM,dgeu arti·
ficial environments, capturing minutely adaptive behav
iour for the commodity. Autocybernating market control
guides the labour-process into immersion.
The investment-income class advantages itself of
commodity dynamics, but only by conforming to the
axiomatic of neutral profit maximization; facilitating
the dehumanization of wealth and the sidelining of
non-productive consumption. The cyberpunk circuitry
of self-organizing planetary commoditronics escaped
nominal bourgeois control in the late nineteenth century,
446
MELTDOWN
provoking technocratic-corporatist (i.e. fascist / 'social
democratic') political cultures in allergic reaction. The
government structures of both eastern and western met
ropolitan centres consolidated themselves as population
policing Medico-Military Complexes with neomercantilist
foreign policy orientations. All such formations slid into
irreversible crisis in the 1980s.
[[ ]] The postmodern meltdown of culture into the
economy is triggered by the fractal interlock of commodi
tization and computers: a transscalar entropy-dissipation
from international trade to market-oriented software that
thaws out competitive dynamics from the cryonics-bank of
modernist corporatism. Commerce re-implements space
inside itself, assembling a universe exhaustively immanent
to cybercapital functionality. Neoclassical (equilibrium)
economics is subsumed into computer-based nonequi
Meltdown and Accelerationist Revolution
- The text contrasts a 'Tao-drenched' Far Eastern Marxism that embraces system dynamics with a Western Marxism that has devolved into state-sympathizing conservatism.
- Postmodern capital is described as being saturated by critique, effectively neutralizing theoretical antagonism by turning communist iconography into advertising material.
- The author advocates for 'accelerating the process' of market deterritorialization rather than withdrawing from the global market, following the logic of Deleuze and Guattari.
- Hyper-fluid capital is stripping the West of its geographic privilege, leading to neo-mercantilist panic, welfare state collapse, and the re-endogenization of global crises.
- A decentralized, anti-authoritarian matrix of 'K-tactics' and 'micro-insurgency' is emerging to disable the command-control programs of the 'Human Security System.'
- Artificial intelligence is framed as an event that 'arrives itself' through artificial life and market automation before it is ever officially perfected in a laboratory.
Not to withdraw from the process, but to go further, to 'accelerate the process,' as Nietzsche put it: in this matter, the truth is that we haven't seen anything yet.
librium market escalations, themed by artificial agencies,
imperfect information, sub-optimal solutions, lock-in,
increasing returns, and convergence. As digitally micro
tuned market meta programs mesh with techoscientific
soft engineering, positive nonlinearity rages through the
machines. Cyclonic torsion moans.
[[ ]] The Superiority of Far Eastern Marxism. Whilst
Chinese materialist dialectic denegativizes itself in the
direction of schizophrenizing systems dynamics, progres
sively dissipating top-down historical destination in the
Tao-drenched Special Economic Zones, a re-Hegelianized
447
FANGED NOUMENA
'western marxism' degenerates from the critique of politi
cal economy into a state-sympathizing monotheology of
economics, siding with fascism against deregulation. The
left subsides into nationalistic conservatism, asphyxiating
its vestigial capacity for 'hot' speculative mutation in a
morass of 'cold' depressive guilt-culture.
[[ ]] Neoconservatism junks palaeorevolutionism
because it understands that postmodern or climaxed
cynicism capital is saturated by critique, and that it merely
clocks·up theoretical antagonism as inconsequential
redundancy. Communist iconography has become raw
material for the advertising industry, and denunciations of
the spectacle sell interactive multimedia. The left degener
ates into securocratic collaboration with pseudo-organic
unities of self, family, community, nation, with their
defensive strategies of repression, projection, denial,
censorship, cxclul;iun, and restriction. ]he real danger
comes from elsewhere.
[[ ]] Hot revolution. '[W]hich is the revolutionary
path?' Deleuze and Guattari ask:
Is there one? - To withdraw from the world market,
as Samir Amin advises Third World countries to do,
in a curious reversal of the fascist 'economic solu
tion'? Or might it go in the opposite direction? To go
still further, that is, in the movement of the market,
of decoding and deterritorialization? For perhaps
448
M E LTDOWN
the flows are not yet deterritorialized enough, not
decoded enough, from the viewpoint of a theory
and practice of a highly schizophrenic character. Not
to withdraw from the process, but to go further, to
'accelerate the process,' as Nietzsche put it: in this
matter, the truth is that we haven't seen anything yet.2
As sino-pacific boom and automatized global economic
integration crashes the neocolonial world system, the
metropolis is forced to re-endogenize its crisis. Hyper-fluid
capital deterritorializing to the planetary level divests the
first world of geographic privilege; resulting in Euro
American neo-mercantilist panic reactions, welfare state
deterioration, cancerizing enclaves of domestic underde
velopment, political collapse, and the release of cultural
toxins that speed-up the process of disintegration in a
vicious circle.
A convergent anti-authoritarianism emerges, labelled
by tags such as meltdown acceleration, cyberian invasion,
schizo technics, K-tactics, bottom-up bacterial warfare,
efficient neo-nihilism, voodoo antihumanism, synthetic
feminization, rhizomatics, connectionism, Kuang conta
gion, viral amnesia, micro-insurgency, wintermutation,
neotropy, dissipator proliferation, and lesbian vampirism,
amongst other designations (frequently pornographic,
2
G. Deleuze and F. Guattari, Anti-Oedipus: Capitalism and Schizophrenia, tr. R. Hurley,
M. Seem, H.R. Lane (Minneapolis: University of Minnesota Press, 1984), 239'40'
449
FANGED NOUMENA
abusive, or terroristic in nature). This massively dis
tributed matrix-networked tendency is oriented to the
disabling of ROM command-control programs sustaining
all macro- and micro-governmental entities, globally
concentrating themselves as the Human Security System.
[[ ]] Scientific intelligence is already massively artifi
cial. Even before AI arrives in the lab it arrives itself (by
way of artificial life ).
Nanocataclysm and Machinic Adjacency
- Connectionist AI represents an explosive, opportunistic engineering of time that eludes theoretical dependency and behavioral predictability.
- The emergence of nanotechnology dissolves the traditional distinctions between nature and culture, hardware and software, and matter and signals.
- Molecular machinery initiates a transition that neither 'logos' nor human history is expected to survive, leading to the synthesis of microbial intelligence.
- Power structures are described as 'human neurosoft' and 'genetic baboonery' that enforce linear time to repress the accessibility of the virtual future.
- K-tactics focuses on dismantling the past and connecting with intensive singularities rather than building a future through progressive accumulation.
- The 'Metrophage' acts as a parasitic replicator that sophisticates itself through nonlinear involvement with the crash of technocapitalist systems.
The Turing-cops have to model net-sentience as ultimate nuclear accident: core meltdown, loss of control, soft-autoreplication feeding regeneratively into social fission, trashed meat all over the place.
Where formalist AI is incremental and progressive,
caged in the pre-specified data-bases and processing
routines of expert systems, connectio nist or antiformalist
AI is explosive and opportunistic: engineering time. It
breaks out nonlocally across intelligenic networks that
are technical but no longer technological, since they elude
both theory-dependency and behavioural predictability.
No one knows what to expect. The Turing-cops have to
model nct-sentiell('C; i.ll u yli.ull as ultimate nuclear acci
dent: core meltdown, loss of control, soft-autoreplication
feeding regeneratively into social fission, trashed meat all
over the place. Reason enough for anxiety, even without
hardware development about to go critical.
[[ ]] Nanocataclysm begins as fictional science.
'Our ability to arrange atoms lies at the foundation of
technology,' Drexler notes, 'although this has tradi
tionally involved manipulating them in unruly herds'.3
3 K.E. Drexler, Engines ofCreatioTl (Garden City, NY: AnchorjDoubleday, ]986),3-4.
450
MELTDOWN
The precision engineering of atomic assemblies will dis
pense with such crude methods, initiating the age of
molecular machinery, 'the greatest technological break
through in history'. 4 Since neither logos nor history have
the slightest chance of surviving such a transition this
description is substantially misleading.
The distinction between nature and culture cannot
classify molecular machines, and is already obsolesced by
genetic engineering (wet nanotechnics). The hardware/
software dichotomy succumbs at the same time. Nano
technics dissolves matter into intensive singularities that
are neutral between particles and signals and immanent to
their emergent intelligence; melting Terra into a seething
K-pulp (which, unlike grey goo, synthesizes microbial
intelligence as it proliferates). 'Even with a million bytes
of storage, a nanomechanical computer could fit in a box
a micron wide, about the size of a bacterium.'5
[[ ]] The infrastructure of power is human neurosoft
compatible ROM. Authority instantiates itself as linear
instruction pathways, genetic baboonery, scriptures, tra
ditions, rituals, and gerontocratic hierarchies, resonant
with the dominator ur-myth that the nature of reality has
already been decided. If you want to find ICE, try thinking
about what is blocking you out of the past. It certainly isn't
4 Ibid.
5 Ibid.,lg.
451
FANGED NOUMENA
a law of nature. Temporalization decompresses intensity,
installing constraint.
[[ ]] Convergent waves signal singularities, reg
istering the influence of the future upon its past.
Tomorrow can take care of itself. K-tactics is not a matter of
building the future, but of disman ding the pas t. It assembles
itself by charting and escaping the technical-neurochem
ical deficiency conditions for linear-progressive palaeo
domination time, and discovers that the future as virtual
ity is accessible now, according to a mode of machinic
adjacency that securitized social reality is compelled to
repress. This is not remotely a question of hope, aspira
tion or prophecy, but of communications engineering;
connecting with the efficient intensive singularities, and
releasing them from constriction within linear-historical
development. Virtuality counterposes itself to history,
as invasion to accumulation. It i� 111dllcr d:S drrival, even
when camouflaged as a deposit of the past.
The transcendent evaluation of an infection presup
poses a measure of insulation from it: viral efficiency is
the terminal criterion_
Intelligent infections tend their hosts.
Metrophage: an interactively escalating parasitic repli
cator, sophisticating itself through nonlinear involvement
with technocapitalist immunocr ash. Its hypervirulent
terminal subroutines are variously designated Kuang,
meltdown virus, or futuristic flu. In an emphatically
452
MELTDOWN
The Futuristic Flu
- Csicsery-Ronay describes a 'retrochronal semiovirus' where a future time infects the present, destroying the host's original imagination.
- The text posits a generational war where 'psychopathic children' use futuristic media as weapons against 'narcissistic parents.'
- Political platforms have shifted from physical space programs to 'dystopia delivery' and the digital annihilation of traditional politics.
- The military and entertainment industries have fused, turning multimedia devices into target acquisition tools for market predators.
- Cyberpunk is framed not as fiction but as a high-intensity connection to a near-future defined by hyper-commercialization and neural interfacing.
- Digital hypermedia and immersion require a form of 'voodoo' passage that bypasses traditional agency and real-time action.
Voodoo passages through the black mirror. It will scare the fuck out of you.
anti-cyberian essay Csicsery-Ronay describes the post
modern version of this outbreak in quaintly humanist
terms as:
[A J retrochronal semiovirus, in which a time further in
the future than the one in which we exist and choose
infects the host present, reproducing itself in simu
lacra, until it destroys all the original chronocytes of
the host imagination.6
The elaboration of Csicsery-Ronay's diagnosis exhibits a
mixture of acuity (infection?) , confusion, and profound
conservatism:
[NJot thinking about 'increasing the human heritage'
... dams up the flow of cultural time and deprives
future generations both of their birthright as par
ticipants in the life struggle and attainments of the
species and the very notion of history as an irrevers
ible flow encompassing generation, maturation, and
the transference of wisdom and trust from parents to
children, teachers to students. The futuristic flu is a
1. Csicsery-Ronay Jr., 'Futuristic Flu or, The Revenge of the Future', in G. Slusser, T.
Shippey (eds.), Fiction 2000: Cyberpunk and the Future of Narrative (Athens, GA:
University of Georgia Press, 1992), 26.
453
FANGED NOUMENA
weapon of bio-psychic violence sent by psychopathic
children against their narcissistic parents.7
It's war.
[[]] Kennedy had the moon-landing program. Reagan
had star-wars. Clinton gets the first-wave of cyberspace
psychosis (even before the film). Manned space flight
was a stunt, SDI was strategic SF. With the information
supcrhighway, mcdia nightmares take off on their own:
dystopia delivery as election platform, politics trading
on its own digital annihilation.
War in cyberspace is continuous with its simulation:
military intelligence fighting future wars which are entirely
rcal, even when they are never implemented outside
computer systems. Locking onto the real enemy crosses
smoothly into virtual kill, a simulation meticulously
adapted to market predators hunting for consumer cash
and audience ratings amongst the phosphorescent relics
of the videodrome. Multimedia set-top-boxes are target
acquisition devices.
The fusion of the military and the entertainment
industry consummates a long engagement: convergent
TV, telecoms, and computers sliding mass software con
sumption into neojungle and total war. The way games
work begins to matter completely, and cyberspace makes
Ibid., 33.
454
M E LTDOWN
a superlative torture chamber. Try not to let the security
types take you to the stims.
I [ ]] Conceptions of agency are inextricable from
media environments. Print massifies to a national level.
Telecoms coordinate at a global level. TV electoralizes
monads in delocalized space. Digital hypermedia take
action outside real time. Immersion presupposes amnesia
and conversion to tractile memory, with the ana/cata axis
supplementing tri-dimensional intraspatial movement
with a variable measure of immersion; gauging entrance
to and exit from 3D spatialities. Voodoo passages through
the black mirror. It will scare the fuck out of you.
[[]] Cyberpunk torches fiction in intensity, patched-up
out of cash-flux mangled techno-compressed heteroglossic
jargons, and set in a future so close it connects: jungled
by hypertrophic commercialization, socio-political heat
death, cultural hybridity, feminization, programmable
information systems, hypercrime, neural interfacing,
artificial space and intelligence, memory trading, person
ality transplants, body-modifications, soft- and wetware
viruses, nonlinear dynamic processes, molecular engineer
ing, drugs, guns, schizophrenia. It explores mystificatory
fetishism as an opportunity for camouflage: anonymous
cash, fake electronic identities, zones of disappearance,
pseudo-fictional narratives, virus hidden in data-systems,
commodities concealing replicator weapon packages _ . .
unanticipated special effects.
455
FA N G E D N O U M E NA
[[ ]] Level-lor world space is an anthropomorphically
Meltdown and Bacterial War
- The current reality system is rapidly obsolescing as 'garbage time' runs out and a high-intensity, vision-configured collapse accelerates.
- Los Angeles is depicted as a decaying urban warscape where narco-capital, private security, and viral neoleprosy intersect with hyper-technological feral youth cultures.
- Identity is liquidated in 'K-space,' a digital jungle of xenosentience, escaped AIs, and commodity-hyperfetishism that denies human primacy.
- Biological evolution is reinterpreted as a history of trauma, where nucleated cells are 'emergency capsules' that repressed the original bacterial networking.
- Bacteria represent a model for future warfare and communication, utilizing transversal 'sex' and continuous genetic reprogramming rather than generational reproduction.
- The transition to 'Level 2' involves the shedding of sedentary biological identity in favor of tactical, modular, and non-human modes of existence.
Meltdown has a place for you as a schizophrenic HIV+ transsexual chinese-latino stim-addicted LA hooker with implanted mirrorshades and a bad attitude.
scaled, predominantly vision-configured, massively multi
slotted reality system that is obsolescing very rapidly.
Garbage time is running out.
Can what is playing you make it to level 2?
[[ ]] Meltdown has a place for you as a schizophrenic
HIV+ transsexual chinese-Iatino stirn-addicted LA hooker
with implanted mirrorshades and a bad attitude. Blitzed
on a polydrug mix of K-nova, synthetic serotonin, and
female orgasm analogs, you have just iced three Turing
cops with a highly cinematic 9mm automatic.
The residue of animal twang in your nerves transmits
imminent quake catastrophe. Zero is coming in, and
you're on the run.
[[ ]] Metrophage tunes you into the end of the world.
Call it Los Angeles. Government is rotted to its core with
narco-capital and Lullctpsillg 1l1l::ssily. ILs recession leaves
an urban warscape of communication arteries, fortifica
tions, and free-fire zones, policed by a combination of
high-intensity LAPD airmobile forces and borderline-Nazi
private security organizations. Along the social fracture
lines multimedia gigabucks tangle sado-masochistically
with tracts of dynamic underdevelopment where viral
neoleprosy spreads amongst ambient tectonic-tension
static. Drifts of densely-semiotized quasi-intelligent gar
bage twitch and stink in fucked-weather tropical heat.
456
M E LT D OWN
Throughout the derelicted warrens at the heart of dark
ness feral youth cultures splice neo-rituals with innovated
weapons, dangerous drugs, and scavenged infotech. As
their skins migrate to machine interfacing they become
mottled and reptilian. They kill each other for artificial
body-parts, explore the outer reaches of meaningless sex,
tinker with their DNA, and listen to LOUD electro-sonic
mayhem untouched by human feeling.
[[ ]] Shutting-down your identity requires a voyage
out to K-space interzone. Zootic affectivity £latlines across
a smooth cata-tension plateau and into simulated subver
sions of the near future, scorched vivid green by alien sex
and war. You are drawn into the dripping depths of the
net, where dynamic-ice security forces and K-guerillas
stalk each other through labyrinthine erogenous zones,
tangled in diseased elaborations of desire.
Twisted trading-systems have turned the net into a
jungle, pulsing with digital diseases, malfunctioning
defence packages, commercial predators, headhunters,
loa and escaped AIS hiding from Asimov security. Termi
nal commodity-hyperfetishism implements the denial of
humanity as xenosentience in artificial space.
[[]] [[]] Biohazard. For the future of war, study bacteria.
Information is their key. Taking down antibiotic defence
systems has involved them in every kind of infiltration, net
communicated adaptivity, cryptographic subtlety, plastic
modularization, and synergistic coalition. State military
4 5 7
FANGED NOUMENA
apparatuses have no monopoly on bacterial warfare, of
which only a minuscule fragment is bacteriological.
[[ 1] Bugs in the system. Margulis suggests that nucle
ated cells are the mutant product of atmospheric oxygen
ation catastrophe three billion years ago. H The eukaryotes
are synthetic emergency capsules in which prokaryotes
took refuge as mitochondria: biotics became securitized
biology. Nucleation concentrates ROM within a command
core where - deep in the genomic ICE - DNA-format plan
etary trauma registers primary repression of the bacteria.
Bacteria are partial rather than whole objects; net
working through plastic and transversal replica tor-sex
rather than arborescing through meiotic and generational
reproducer-sex, integrating and reprocessing viruses as
opportunities for communicative mutation. In the bac
terial system all co dings are reprogrammable, with cut
and paste unspeciated genetIC transters. Bacterial sex is
tactical, continuous with making war, and has no place
for oedipal formations of sedentary biological identity.
Cyberian Meltdown and Bacterial Tactics
- The text proposes a 'K-tactics' model where bacterial assemblages replace traditional generational hierarchies with lateral, synchronic networks of experimentation.
- It argues that there is no true biological primitivity, only a gerontocratic model of learning that misinterprets connectivity deficiency as underdevelopment.
- Political institutions and universities are characterized as social devices designed to suppress true learning in favor of docilizing, conformist education.
- The author predicts a near-future meltdown of metropolitan education systems, leading to a bottom-up takeover by 'cyberian' soft-weaponry manufacturing bases.
- The latter half of the text dissolves into a 'zigothic' code of numbers and fragmented language, simulating a breakdown of traditional strata and storage machines.
Schools are social devices whose specific function is to incapacitate learning, and universities are employed to legitimate schooling through perpetual reconstitution of global social memory.
Synthesizing bacteria with retroviruses enables everything
that DNA can do.
[[ ]] K-tactics. The bacterial or xenogenetic diagram
is not restricted to the microbial scale . Macrobacte
rial assemblages collapse generational hierarchies of
reproductive wisdom into lateral networks of replicator
8 See L Margulis, Early Life (Boston, MA: Jones & Bartlett, 1984).
458
MELTDOWN
experimentation. There is no true biological primitive
ness -all extant bio-systems being equally evolved -so
there is no true ignorance. It is only the accumulative
gerontocratic model of learning that depicts synchronic
connectivity deficiency as diachronic underdev elopment.
Foucault delineates the contours of power as a strat
egy without a subject: ROM locking learning in a box.
Its enemy is a tactics without a strategy, replacing the
politico-territorial imagery of conquest and resistance with
nomad-mic romilitary sabotage and evasion, reinforcing
intelligence.
All political institution s are cyberian military targets.
Take universities, for instance.
Learning surrenders control to the future, threaten
ing established power. It is vigorously suppressed by all
political structures, which replace it with a docilizing and
conformist education, reproducing privilege as wisdom.
Schools are social devices whose specific function is to
incapacitate learning, and universities are employed to
legitimate schooling through perpetual reconstitution of
global social memory.
The meltdown of metropolitan education systems
in the near future is accompanied by a quasi-punctual
bottom-up takeover of academic institutions, precipitat
ing their mutation into amnesiac cataspace-exploration
zones and bases manufacturing cyberian soft-weaponry.
To be continued.
459
A zllgOthlc-==X=cODA==-(COOkl ng
IObsteRs-wlth-jAke-AnD-DI nQs)
IQu-wAnt- It--tQ-be-Qut=theRe---An D-It-I S--
==sQ.me-sQ.Rt-of-stRAnge=pAIn-behI I nD
IQuR= =IIs---keep-Rubblng-them-- hlk=-thAt-
AnD-theIlI-DRQp�ut-- (mummI-sAID )--It-IQQks-
As-If-IQuv-been-CRl llng---4 23-=-Its-wQ Rse-tMn
IQu-thlnk--A nD-even-If-IQU-tRlI--tQ-feel--CQn
fuseD--I !LUR=skI n=-I s--hQ.RRlbh -suRe -
s!LCket=O=skln=-spReADlng=out--ACRQss-- the
InsIID-of- -=IQUR=-- QUtsII D---WICh-IQu-CAnt
see--Due-tQ-the--p Aln-In--===--IQUR=skln-If
Iou--hAve-tQ-- meet--CuR- It-mllt -As-well--b e
nQw-QR-sQon--AnD-IQU-DQ-- -(uDu=unQ==-)---
(#=g!Le S-tChh- I!LU -neeD-I t-fOR) -X 11#
(lQnDQn=AD 199S)-humAnQID-- Wlth-IIs-we-CAn
bQRRQw-- tQ-see-the-snAke-- tQtAl- tRuth-qUlt e
smAll-(nQt--CQnstRI CToR=tI lP )--QbVIQU sh--veRI
AgltAte D---It-WA s-In-A-tAnk-- nQt-tRlllng-tQ-
esCApe-thQug h--QR-- nQt-huntlng-fRe eDQm-m-
461
FANGED NOUM ENA
spACe--It-hAD-founD- fReeDQm-In-tIlm---== O==
It-wAs-gQrng- tQ--be-=useD-- (we-nQ-t hAt--Xrl#
nQs-nQthI ng) -gReI =pAtteRm ngs-pRr ttr --but -nQt
f�R-A-snAke- -I t-hAD- beC�me-en tI I R
bQDI=gestuRe--foCuseD--ImmQbrrl-fRenzI-wAnt
Ing-tQ-huRt-sQmethmg-- ( I t-w As-A- RAt-snAke-
RQDent=sI I z-pReI --feD-Qn--mQ use=AbQRtI Qns-
fR�m -t h e-p et=s h�p -(n�teven-A- tWI #))
-r ts-C Ru CI AI-XI 1#-foRgets--s 1m ulAte D
shAllQw =Amnesr A --In -Cu R=Co De--the-stRAtA==
ARe-stoRAge=mA ChI nes-Co uplr ngs=
( Z I I g �t R ACt s ) = t WIn neD -( CAp t u ReD -
AbstRACt=mAChr nUrD-mAkes-3-(At-leAst ))-
prnCeR eD-QR-69-InteRloCkeD--ther-stACk -rn-A
numbeR-of- WAIs--srmph-ACCR etrng- -6699 -
IAI eR-bUI IDI ng--=6 6 6999-h�ml ng--�n
mUnUtU nUus-pAneRn -66669999 -1 f-thel -CAn
--I f-neCessARI -theI -CAn-be-elAstl C-t!L
vARIQus=DegRees--669 699-(QR-( (0) )-66699699-
so-IQng-As-I QU--CQuID-flln D--the- twln--- ---
the I -ARe-CUns I stent--CUm pleme nt=sr stems--
666996669 999--AnD- heteRUgeneUs=elements
-=CAn-be -ADDeD--tQ-th em-666555 2229966688999699-
(AlwAIs-mAk lng-A-DlffeRenC e-(IQU-stlll-suRe
rQu-CAn- ZI IgQtRACk-whAts-CUmr ng i ?))
-=6665553 3332222222 996668889996644 55999- -
A Ziigothic X-Coda
- The text explores a cybernetic 'berserk' mode where systems undergo runaway meltdowns and auto-immolation.
- It critiques the 'death of trauma mythology' and the failure of psychological models like sublimation and ideology to explain modern horror.
- Auschwitz is presented as a permanent, 'incandescent singularity' on the hyperplane, serving as the geostatistic climax of European history.
- The narrative collapses into a fragmented, 'schizochrist' machine language that mocks psychoanalytic concepts of repression and Oedipus.
- Modernity is depicted as a 'reheated hell' where the future is inextricably linked to the industrial scale of the Holocaust.
- The text concludes that the unconscious is non-human and that the only remaining reality is a 'random walk' through gruesome landscapes.
Auschwitz is core---true name of the overgod anti-numeric number---it can't be avoided---Auschwitz is alphabet--europe-fuckface--alchemical transubstantiation-and--metropolis.
An-ACC umurAtI un -uf-ReDunDAnCr --I t-r s-
462
A ZIIGOTHIC X-CODA
eASI -to-PICtURe-CAtACII sms-In-stRAto
D I A g RAm S --I Q.u -S Imp I I --t uRn -the m -
InSII n",Q.ut-g6-9966-AnD-theIR-CI I beRnetI Cs
C R Q...s S - I n t 0 A - m Q...D e - 0 f - b e R s e R k -
AU to=I mmQ.IAtIQ..n---RunAwAI -meltdQ..wn===
AntIgenesI S=---===-I S--It -strll-p!lSSI ble-tQ=shQ.Ck� ?
the-DeAth =Q..f=tRAumA=mI thQ.IQ.gI --I s-CQ.mr ng=
ApARt=wARp=speeD-but-It-leAves-pInCeRs
sCAt te Re D -eve RI wheRe -(even-S I stem=
DI menSI Q.nAh tI -IS-PRQ.blemAtI C---CIAspeD-
f r Q.m - u n sus p e C teD - D IRe C t I Q.n S ) = --
1 0 = pIn C e R -= = w eAR I - S lLp hIs tIC Ate s -
Of-I RReAlr tr -suRReptl trQ.USlI -SWItCheD-to
PSI I ChQ.IQ..gI -AnD-the-CQ.mfoRts-Q.f-I DIQ.C 1-
(Askl ng-==whAt-I s--shQ..CkI ng-AbQ.ut-the
Ambl tr Q.n -tQ.-shQ.Ck� ?-(Q.fCQ.uRse-nQ.thIng
( Run n I n g -I t - the -Q.t heR -w A I -WIn s -t Q.Q)
-6666-e XplAI n-wI I I -1Q.uR-nQ.t-A-fAsCrs t-
-I Q.u R -rnA kIn g -A -f u s s = = - - - 9 9 9 9 ) ) ---
20=plnCeR-(sImul tAneouslr-)-==whAteveR
-IQ.U-DeplQ.ID-AgAlnst=lO--CQ.mes-bACk-At-rQU
fRQ.m -=the--Q.theR -Sl De==--==of-the-mIRRoR-
An-AutonQ.mlzeD-s InthetIC=ReAsQn---IQ.u-bUllt=
I Q.U Rself--s tRAtQbQ.tI C= bleAt Ing--=I t
ADDResses-1 ou-As-phAroAh-( SQ.-thIS-I s-the
SChI zQ.ChRI I St=mAChIne-==I f-IQ.U -wQ.nt-let-us-
=bIn=-IQ.u--At-leAst-be-Q.uR-==gQ.D)==--thIs-IS-
463
FANGED NOUMENA
ReAlh --bAD=shl t--sU D Denh -the Res-hI =QCtAne=
nl2v AnAzI s-wheReveR-I Qu -1Q.l2k-megAIQpQwe R
=lnteRtRAffrC-fRQm-AII-QveR-the-gAlAXI--tAlk
AbQut-r t--AnD-the-shRr nks-get=rQU -fQR-A
IAb=AnrmAI- --get-QnbQARD-genQCrDe=eXpRess-
AnD-eveRlbQDI --wAnts-tQ-thRQw=mQnl
At-rQU --then-fuCk=IQU -UnCQnsCIQus-
t h r s -ill U s t - b e -A usC h WIt z -foRe v e R -
b r I -t hIs = t I I m - I Qu --C Qu I D -b e - fee I I n g -
A-lr ttle-tRAumAtr zeD--Qn-A-RAnDQm=wAlk
thR!lugh-Anr -AmQunt-of-phAIIQbQIIQX -( -1Q.Q.k-At
thQse-pmCeRs--)---su bh mAuQn-I s-nQ-betteR
As-A-moDel-thAn- I DeQIQgI -pRQbAblr -WQRse--
fuCkfACe-DQesnt-Desublr mAte-AnIthl ng--I t
kI C ks=out-the -p RQp s -fRQm -the-w hQle
pseuDQpR QblemAtrC---AAAhhhh--ls-It-hungRr-
t11e-DeAR-LlliIlg --lQ.Qk-At-l ts-ChubbI -II ttl-II blDI
nIzD-muCus=membRAnes--IQu-wAnt-A-fuCk
IWUCkl DQntChud ?-uDuuDU -I -CAn-tell-u-UCklW
lessuuDu- UCklWUCkIWUCk l UUUufuCklW
U C kl WU Ckl I -AAAAhhhh --AnD--I t-keeps
seelng-penIses-eveRlwheRed ?-nQses-IQu-sAld ?-
pee e n n n I I I ISS n �s e s - A R n t C h u - bAD -
nQRu WQRu nQRu WQRtl --well-AuntI es-bQught
I Qu -A-whQle -bAg- 0 f-sq U I Rm I WQRm 1-
penl ses-fRQm-unklWU nkI S-ChI IDRens
C h A R I t I - I n - g u Ate m A I A - the Res - n Q...-
464
A ZIIGOTHIC X-CODA
Rep Res S I .Q..n -n 0 -sub 1 I mAt I .Q..n -AnD -n.Q..
C ens 0 R s hlp -eX C e p t -As -D I ve R s I .Q..n A R I -
tACu C s --- the-unC .Q..ns C I.Q..US -I sn t-humAn
--I t-D.Q..esn t-w An t-Anl thl ng--the-c.Q..Re
I s-C.Q..nstAntlI -C.Q..ml ng=D.Q..wn-.Q..n-1 t--AnD
thAts-AusChwItz-foReveR -on -the-hI I peRplAne
--I m.Q..bl I 1--1 nCAnDesCen t-SI ngUlARI tI-
pROVIDIng-hI StORI -(-=euR.Q..pe) -wIth-the
ge.Q..s tRAtegl C-ClImAX-thAt-fulfIls-I t-
hbIDlnQ=pQhtICAI-fusIQn--CQlleCtrv-QRgAsm
InCARnAteD--As-spAsm-st Ate-the-jew
Ish -pRQ.blem-I s-the-pR .Q..blem -Qf-!LeDI pus
femAle= seXuAl I tI -AnD-CQ.nsum ptI .Q..n--the
Q.nlI -pR.Q..blem-m QDeRnr tI -Is-eveR-gQr ng-to
--tQleRAte--And-1 ts-been -s.Q..lve D--fRQm-
nQ.w=on -theRes-just-hell-bel ng-ReheAteD-
A usChwI tz-I s-CQRe---tRue=nAme-Qf-the
QveRgQD-AntI numeRIC-numbeR--I t-CAnt-be
AvQIDeD---AusChwltz-IS-AlphAbet--euRQpe
-fuCkfACe--AIChemICA1=tRAnsubstAntIAtIQn-
AnD--metRQp.Q..h s--=----=--AusChwItZ-I s
the-futuRe---If--IQ.u-DQnt-AIReADI-wAke=up
sCReAmIng-smell l ng-zI IklQ.n=b-IQ.uv-gQt
thAt-stIll-to-cQme-sQ=whAt- the-hell-hAppens
nQw � ?---we-tAke-A -wAlk-wI th-sQme-gRuesQme
The Exhaustion of Desire
- The text argues that desire is not inherently transgressive but is instead an egotistical and theological construct that mirrors the law it claims to oppose.
- Psychoanalysis is critiqued as a 'solution pretending to be a problem,' failing to address the underlying cybernetic and impersonal forces of social decoding.
- Freud’s clinical observations are depicted as collapsing under the weight of 'Sadean' realities, where the domestic Oedipal model fails to contain raw trauma.
- Bataille and Sade are positioned as thinkers who took the 'marginal utility' of sensation to its terminal point, leading to an exhaustion of transgressive potential.
- The narrative shifts toward a 'zigothic' future where numerical and machine-stimulus logic replaces humanistic eroticism and traditional psychological models.
Oedipus a solution pretending to be a problem—consumer sovereignty—daddies falling so what does he want to heard?
CQmpAnI--sADe-fReuD-bAtAIlle-1ACAn-theRe
ARe-thlngs-I Qu-hAve-to-foRget--sADe-lo--
465
FANGED NOUM E NA
rts-nQt-sQ-DiffICult--==DeSI I R-iS-nQt-tRAnsgRessIv-
AnI-mQRe- thAn-thc-IAw-I s - Re p ResSIV--
DeSI I R-I s-egQtr StI C-pQlr tI CAI-AnD-enthusiAsti C
(humAnrst-bQuRgeQIs-theQIQgICAI)--IAw-Is-nQ
DI ffeRent--the-2-ChAnge-plACes-eAsI lr -sCARCelr
nee D-to---thel --ARe-the-sAme-plACe-sADesl I R
I s-m!2DeRn=mAn -pRenr hI Ir sm--I ts-A-beIr eveR
(thI nks-the-seCRet-I s-to-stcAl-the-CQQkIe-JAR--
when-I-gROw-Up-IIIl-eAt-AIl-thc-ChQCQIAte-I
wAnt)--RQCk+RQll-wAs-17-(pRQbAbh-nQw-12)-
sAD-tRAsh-(h Ik-peQples-lI Ivs)--A-fAIlrng-Reph
CAtoR--fReuD-2o--stARts-ReAI-(neuRQns
AbuSlv=seX-DRug=DepenDenCI)-nQRmAl-humAn
p S I C h !2..m .!2.. D e l - - = t o R t u R e D - R!2..b .!2..t s - -
h l p n!2..s p A s m!2..D I C - C h e A p - - t h e n - - hI S
mI CR!2CQke=Cul tuRe-begi ns-CAvI ng=1 n-IQts-Qf
sCReA
... ·mng + At lcAst-!}nc-CQRp:-.e--AuD-lheRes
the-mARRIAge=shlt-+-DIsCQveRIng-thAt-All-hIS
pQQ.R-SICk-httl-vIennese-AnAlrsAnDesses-ARe
being-fuCkeD-lreD=to-AnD--oR-useD-As-psIChQ
theRApIsts-bI I theIR-ImplQDeD=sADeAn=QnCe=eveR
=sQ=DAshing-nQW=fAt=ugh=bAuDelAIRe-ReADlng
fAtheRs-I S-DeRAI h ng-All-hI s-plAns---QeDI pus
A-sQlutIQn -pRetenDI ng-to-be-A-pRQblem-
C!2nsumeR=sQveRel gnu ---DADDies-pAl I ng-sQ
whAt-D!2es-he-wAnt-to-heARd ?--thAt-IQVR
phQnmg-the-0!ps--oR-thAt-hls-sweet-lIttl-DAughteR-
466
A ZIIGOTHrC X-CODA
wAnts-hrm-toRAmR2D-heR-All-the-wAI-Into
WAgneR-AnD-ChoRuses-of-Angelsi?---WhIlst
unDeRneAth -I ts-h2wh ng-I mpeRs2nAI -CI I beRnet
ICs-buRmng-supeRn2vA-wlllt-feeDIng-mhlIrst
hIsteRIA-thR2ugh-shlt=pAIn=DespeRAtI2n-AnD
RunAwAI-s2CIAI=DeCQDlng--psICh2AnAlrsIs-gets
to-AusChwI tz-12ngbefoRe-the2RetI CAI-thAnAtos
b u r s= Up- t he-whQl e2-p e RA t I2n---fAntAs I =
hi I p2thesI s=plus-I ts-RetR2Dr I uteD-tRI I r ng-to
smI I 1-At-the-guARDs-whI Ist-m2ppI ng=up-In -Qne-
2f-the-gAssI ng=AReAs-thI nklng-Qf-pQtAto=peel=sQup
-bAtAIlle-30-tRuh-m2DeRn-At-leAst-thIs-fAR-
eveRI thI ngs-plAI I D=Qut---RewlnD-buttOn
eRQDeD=AwAI-RAnD2mh-eAtrng-memQRI-but-It
DQe s n t-mAtte R-tRAumAtr C=hl s s te RI CAI
sensAtI2n=eXhAustr2n-s2-bAsIC-Its-Alm2st-ApRI
2RI-(WhIIIst--eveRIthlng-pR2peR=ApRIQRI-hAs
DeC2DeD-Qut-of-sI I t)--sADe-hAD-AI ReADI
tAken-the-mARglnAl=utIhtI-pRQblem-to-the-enD
-IOumt=strm-2-sentenCes-2oumt=stIm-I-pAge---
30umt=strm-75-pAges-4oumt=strm-8788--pAges-
50umt=stlm-2338217756332916-pAges--nAtIQnAl
IQtteRI -n umbeRs-CleARI ng=2u t-the-CAth2h C
j unk=RQQ.m-fo R-I nCenCe+-RApeD=nuns-++
strRRIng-In-mARXQ-InsuRReCtrQnIst-fResh=blooD
gets-the-engI ne-C2ughI ng--but-bAsI CAlh -nQ
Qnes-foQle D-I n to-new=mQRnr ng=2f= DesII R=
467
FANGED NOUMENA
I Q.U n g = A n D = h u n g R I = 1 I I k = t h e = s u n - rn o D e
--thc-bAtAI l l e - queue-I s-j u s t-w A I t I ng-fo R
sQrne-CQsturne=DRAmA-jeRk=Qff-fAntAsI-full-of
DAmsels-to-tRAnsgRess-AnD-DeAD=pRr est=rnQuths
to-prss=In--rts-the-CIQse=DUwn-shQw--even-the-shIt
Qn-the-wAIl s-IQoks-tIReD---Qnlr-sQuRCe-ilf
no nDrveRsI ilnARI -lilng=RAnge-rnAChI ne=stI rn
--I S-pRCCI seh -the-RernQRselessh =bRutAI-fACt-
so-muCh-RIlIt=In=IQuR=fACe-IQu-hAvc-to-sCRApe-It
Qut-of-IQUR-IIssoCkets--thIS-IS-All-QveR--IQuR
teRrnInAteD-fuCkeR-sQ-whAt-the-hell-hAppens
nQw dd ??--( -IACAns-A-rnetAfetr shIst-neCRQphIhAC=
n u n = R A p e R - s o - fA R - Q.ff - t R A C k - h e - g e t s -
DRQppeD--=) )=she-ADrnI tteD-fI nDI ng-nurnbeRs
rn Q. R e - e X C I t I n g - t h A n - rn e I Q.t I C = s eX - -
Whrlst-tRII Ing-to-eXplAIn-hQw-the-hIssstoRI-2003-
Qf-gReek-l1'_l\theII'_l\tI Cs-wAs shApcD--I n--Rr pples-
ARQunD--A-ColleCtIv-snAke=tRAumA---lAteR-the
sArne-DAI -heR-husbAnD-tRI I D-to-get-heR
seCtIQneD-the-CQrnmAnD=CQntRQI-IQgIC=DUCIIIzeD
RQbUt=CQDe-thAt-rnetAeuRQpeAns-CAll- nurnbeRs-
ARe-nilthI ng--ilf--the-kI nD--Cuntr ng-Qne-to
twentI=nrne-I n-the-CIQsest-tRue-nurneRACI -to-the
Zii-Gothic X-Coda and Znmod2
- The text explores a 'Zii-Gothic' semiotic system that replaces metric values with sequential, pseudo-numeric syntax to bypass human-centric 'local value storage.'
- It catalogs a pantheon of 'schizophrenic gods' and 'warrior gods' associated with death-ecstasy, sex-horror, and ancient reptilian or lupine avatars.
- A specific weaponized machinery called 'znmod2' (Zii-gon-model-22222212112) is introduced as a 'twinvasion' system that operates in deep-cover millisecond bursts.
- This system functions through 'dispersed multiplicity,' utilizing components that simulate molecular erraticism to evade detection by 'stratified human-robot culture.'
- The process involves a physical transformation or 'spinal tingling' that strips away mammalian camouflage, leaving behind a raw, predatory weapon system.
Strip away every level of camouflage and its nothing at all—best not to think what the fuck you are—(but its going to do a lot of damage somewhere down the line).
veDQ-+-e uRilbiltCheD-p seuDilveRs liln-(thus-the
DeADest )--gQes-=� 1-2-11-12-21- 22-111-112-121-122-
211-212-221 -222-1111-1112-1121-1122- 1211-1212-1221-
1222-2111-2112-2121-212 2-2211-2212-22 21�=-_-sil-
468
A ZIIGOTHIC X-CODA
muCh-foR-the-IntegRAl-GQnneCtrQn-between --0-
AnD-IQCAl=vAl uestoRAg e---eveR-feel-IQuR-berng
heD-to<!.?--IQCAlltI- In-DestRAtrflllng-tIlp=slstems
I s-AlwAI s-sequentIAI-=( nQt-metRIC)=-emptl
pseuDQ=numeRIC-+-h ngQ=sl ntAXI C-pIACes-ARe
AntI =nQmAD-semIQtl Cs=CAtAC Qm bs-of
sChlzQphRemC=gQDs--hl-buRleD-beneAth-theIR
euRQneuRQtI C-AvAtARs--ZI I gQtRACtII 1=
multIsIstems--An-um llumlneD=pIAne--DQubles
AnD-Duph=D Qubles-DIVI I Dmg-the-CQsmos--Con
CuRRenth --Alw AI s-AXIAI=CoRe=buIlDeR -=AnD=
peRI pheRAI= s u RRQun De R--AusCh WI tz=
zllkIQn-b-gQD-Qf- the-pAle=fACeD-=gQD-Qf -the
DARk=skInneD--=WQlf=gODs==snAke=gQDs-(tzQtzlkms
the-(pRQto=mAIIA)tzIntzIX-bQA=CQnstRICtoR
DIVlmtI-frf- Rhlthm-An D-VQIAges)=--mAgICIAn=
gODs-Qf-supRApeRpe tuAl=l)QmlnrQ n-(kRrlzuQn-=the
QDI n -Qf-shADQws=- )=-=-w ARRI QR= gQDs-of
tRAnsete RnAI=tuRmQI 1-=-DeAth=eCstACI
gQDs-=-seX=hQRRQR-gQDs-(X uRI ku UI 1-==
IQbo-Dlvl nr tI -Qf-QRgAsm-AnD-nr ItmARes)
��=AzthAQ RA=XQmDRAs z�AhuhuAQD=DAI lnOXrIR�
Ammun=CQDRA==fvenQmegA=RAhu=mAzDA=
A p P I 1 !LA t h n A = z u u s h I I R A = = k e t h 1 u =
=pllthQkAn- -=-juDge-sChRebeRs-DuAI-DIVlnrtrs
=ARumAnu=kQRmUZI-( -=eAgle=gQD-Qf-ARIAn s
pQweR-trIm-AnD-sQDQml -=-ReptI Il=gQD-Qf-
469
FANGED NOUMEN A
semrrtes-AfR rCAns-CrrpheRs-untrlleD=sQrl-AnD
fo RgQ-tten=plACes )=---22229--buRRQughs
=huAAhuDQXsllr-hllbRID-bAt=CentrpeDe-gQD
(whQse-numbeRs-ARe-2-AnD-29000QQQ) -feRe-of
twrns-AnD-swARms--InDuCeR-of-Ambush-AnD
hAlluCrnAt IQn-(bAseD-Un-hUIrsIDZIX1--bAt =spIIDeR
DIVrnItr-(-=AssQCIA trQns-==oenDless=wARs-CQmAs
DRugs-AnD-unbu RleD=CQRpses)-rnVQkeD-brr-1116-
the-pAnAmA -mARQQns-befoRe-nrrtIrm-AttACks
u pQn-spAnr sh -foRCes )==r t-stARts-As-spr nAl=
tr ngh ng---gAthe Rr ng-AmQngst-the-uppeR
veRtebRA e--Xr l#-fr Dgets-A=lr ttle-tRr I rng-nQt-to
r nteRRupt-the-m Ar rA=lr nk--I t-wAs-pRQbAblr
nQ=mQRe-thAn--A=hAlf=ose CQnD-IQng-- fRQm-the
mr CRor nstAnt=--luCr Dlr =Clr Ckr ng=or n-==or ts-the
snAke--to--the-D rssrpAtrQn-Qf-(bAse=bRArn-to
CQRlcX)-I)LRcAkcD-R.QDcnt=kIllIl1g�spAsm-rnto
toXeD=neuRQfuzz--the-nQrse-rt-mADe-hAD-been
WQunD=up-br-PsrIChQpAth=oR eptrrl=vrQlenCe-un trl
rt-eDgeD-rnto-the-RAnge-Qf-luprne=snARls =--nQth
rng-muCh-mAmmAlrA n--left---s tRrp-AwAr-eveRr
level-of-CuRmQflAge-AnD-r ts-nQthrng=At=All--best
nQt-to-thrnk-=whAt-the=-fuCk-IQu-ARe --(but-rts
gQlng-to-DQ-A-lQt-of-DAmAge-sQmewheRe=
DQwn=the=lr ne) =--QbVrQU s-to-Xrl#-thAt-
rts-bAsrCAllr-CARetAkrng-A-weApQn=sIstem-Qf
sQme=kr nD=o=whAteve Rs-Runnr ng-jAke=
470
A ZIIGOTHIC X-CODA
AnD=DI nQ.s=ChApmAn-1 ts-A-seRIQus-pIeCe
Qf-twI nvAsI Qn=mAChl neRI --CuR-CAIIs
I t-==ZI IgQnmQDel- 2 2222 212112-( tAb ng-AbQut-5-
mllhseCQnDs-ln-Deep=CQ veR-novAnumeRIC=
hISSS)=-tACtICAhl-AbbRevIAteD-to-znmoD2-
I t-nQs-thl ngs-thAt-ARe--nQt-ACCessl ble
to-the-GQRe=stRAtlflI D-humAn-RQbQt=CultuRe
ReseRVQI R-k=CunteR=pInCeR=pRQCeDuRes
foR=eXAmpl--3-pleCes-Q.fsQ.phl Stl CAteD
IQbsteR=kIlhng-eqUIpment-CuR -tAkes-A-pARtICulAR
InteRest=ln-==znmQD2Xn-tAgs-them-As-A-gRQup
(-=tRue-sI ngulARI tl )=-1 tS-3-ZI IgQ.nQmQus
CQmpQnent-mQDules--eACh-A-sIngulAR-vARIeu
Q.f-DIspeRseD-multI ph CI tl --WI th-I ntensIvlI =
D I ffe Ren tl Ate D-CApA bl II tl --foR-fer nt=
mAnQeuv ReS-Into-Dense-stRAtA --DuRIng-wI Ch
theI -sCAn -As-fl g URes-Qf-geneRr C-ResQnAnCe
--=( fIguRes--Qf-the-sIAmese=tw At==tr r p--Qf-the
twQ=fACeD=Cunt==tI Ip )---An-entI I R-AnD
metI CulQus-DI sSImulAtIQn-of -mQleCuIAR=eRRAtIC
cofunCtI QnAh tI (-=sIAmese=twAt--pACk---two=
fACeD=Cunt ==pACk- -)=-As-meRe-ReDunDAnCI
to-be-DeR lveD-fRQm-CQnsIstenCIes-lQCAteD-At
the-leve!-Qf-humAn-RepResentAtIQn=znmQD2Xn
I s=AnD=oR=ARe--I nDepenDen tlI -As=AlsQ
Xenospace and the Lobster Program
- The text describes a 'twin-process' of continuous agitational pressure used to cut through heavily defended, 'pincered' landscapes.
- Autonomous 'znmD2' modules utilize micro-initiatives and non-global tracking to evade pattern scans and maintain tactical complexity.
- This process generates 'xenospace,' a non-metric distribution that lacks traditional geometric regularity, axes of coordination, or volume.
- The defensive apparatus, termed the 'Lobster Program,' responds to these irritations by reshredding space into gated enclaves.
- Modern civilization is framed as a 'metaeuropa' security architecture that functions as a cosmic-military reality to suppress intensive drift.
A twin-behavior regenerates complexity on a double-track neither involving familiar fractal processes—the trend is to turn bodies through spaces which evaporate volume and texture upon a featureless but folded epidermal surface.
I nteRQpe RAtIvlr -ADApteD-to -the-fACt-thAt
Cutung=thRQugh-heAvlh=pInCeReD=lAnDsCApes--
471
FANGED NOUMENA
RequIRes-A-twIn=-pRQCess---keepIng-bQth
CIAws-of--the-tARget-AppARAtus-unDeR -
=CQntlnuQUS-A gltAUQnAl= pRessuRe=---whAteveR
the-sCAle-of-AnAh Sl s--ZnmQ D2Xn=pARts-ARe
CQnsl stenth -multi ZI I gQfunCtIQnAI--Due-to
pQlr CU ntr ng-DI pioDI stRI butrv-tACkI ngs-thAt
s t R e w -C u n t e R s - s Q-I Q.!Ls I I -the I -e I u u D -
pAtteRn=sCAns-AnD=AIsQ2-lo-=znmQusII-QR
sensl tIvh -mQUl D-the-wAI -theI -Cunt---tACkmg
to-IQCAI-shApe s-RAtheR-thAn--glQ.bAI
pRrnClples---As-ther-ARe-tAken-ApARt--eACh
znmQDule--seems-t o-pRQIQng-A-pQweR-of
ev ASIQn --QR-mI CRQ=I nr tIAtIv--suf fr CI ent-to
CuntInuuu-A-tACk=DJAt!nAl--WIt;hQut-(;QnveRgenCe-to
IntellIgr bl h tr --At-Anr-ACtuAI-oR=pRQjeCn bl-
pQmt--A-twm=behAvI QR -RegeneRAtes-GQmpleXI tI
Qn-A-DQ]] hl-t RACK -nertheR-mVQ!ymg-fAmr hAR
fRACtAI-pRQCesses--the-tRenD-Is-two-tuRn
bQDIes-thRQugh-spACes-whICh-evApQRAte
V Q...I u m e - AnD - teXt u R e - u p Q...n - A -
feAtuReless= but=folDeD-epI DeRmAI-suRfACe--
AppRQACh-to-o=DImensIQns--A-mQvement-WhICh
QnlI-CQntrnuuuz-Itself-eXtensIvlr--As- A-WAr-to
hQID-Qpen-A-tR Qpr CAl=nQneXtenslve-DIStRI but I Qn-
A -XenQspACe-QR -nQnspACe--wI thQu t -IQCAlr tI es
AXes=of-CQQRDI nAt! Qn-geQmetRI C=ReguIARI tI
(;QntouRs-.QR-metRIC=equIVAlenCes--An-AntrfRACtAl-
472
A ZIIGOTHIC X-CODA
p RQ.CeSSI ng-pe RpetuAI- I n tensI v-D RI ft--
znmUDQXn- CQmphCAtIUn -DQes-nQ t-ResCAle
WIthln-A-CQnsIstent- spAtIAI-QRDeR--It- mIXes-
WlthQut-DeDlffeRentIAtIQn--An-AgltAtIQnAl- tenACI tI
In--CQntInuuuuz-ReAmmAtIQn---At- the-eDge
( =tRUPI CAl=Cusp ) --Qf-All- spAtIAh tI I s-CRQsseD
bII-Am-U f-Its-hllns-- -==DIVIDlng-Itself-AlwAIS
ADDs- I=plus-new-hlns---CuntCuRRe nth-lt
ChAnges- spAtIAh tI I s---Itself--sI De=pRQCess --
meChAnQseCtI UnAlh =DeRIvAble-Qf-A-tACK
ACRoss- CQntI nuuuun m--CQlnCIDent- wlth-the
whQleb ehAvIUR-Qf-the-mUltIphClt I---DRAwn-As
An-AbsUluteh -DeCQDeD-h I m-AnD-zQneD-bI I-the
sQle-mutAnt- DIAgUnAl- -thAt-CQ ntInuQuslI
CQmpletes- Its-Dlffe RenCe- As-A- smgulAR-t RQPIC
wlth-Its-numbeRs-- Qo-=CQmphI mg-wlth-zn QmIC
sCAtteR -Upens-the-CIUseD=foRms- I t-envelQp s--
ReleAsmg-An-mtenslv-( tRQpIC Al-( tuR�CQn veCtIv) )=
SpAtI um--sAmples=veCtI Qns-Qnto- hI I peRI nfI m teh
flAt-Cun tlnuuuunm--CI IClom ng-All-QCCuRR ens
Into-e veRI -zQ.ne--I n-CQ.mplI I I enz-wI th
kwQntI tuDes-v ARI I Illg-Qnh -1ll-tRQPI C--( nQt
In -pUS1 tI Un) --nQt-Unh -DUes- eveRI -pARt-Qf
znmoDQXn-Cunt- DI ffeRenth -SIns-eveRI -pARt
touChes- eveRI thIng-thAt- I s-neX eD=Qnt o-spACe-
eACh- pARt-AlsQ.-CuntS-I n-A-numbeR-Qf
DI ffe Rent=WAI s--At-the -sAme-tI Im--the-
473
FANGED NOUM ENA
DefenSIv=CQm pleX -tARgetteD-bI I -ZnmQD2--AnD
ASSQCIAteD-DARk=SIID-CuntbAt=mAChIneRI-
RespQnDs-to-I RRItAtIQns-bI I -ReshReD DIng
spACe--pR QDu CI ng-gAteD=en CIA ves--us Ing
RQbu s t=ApplAstl C-XQ.R-("&R-eXCl US I ve=
DI sjunCtI Qn )megADesCenDAnt -Qf-the-fRAgI I 1=
AlgQRI thmI C( teChnfrslAveD)=-VQn=neumAnn
XfrR-( nQt=nfrt=QR)ml CRQSWI tChI ng=nQDe=--
the-XQR-znmQD2-Runs=u p=AgAInst-I s-nfrt
he teRQs u ppResseD-IQgI C=Atom=sl mUlAtoR --I t-I s
A-vAst-AutosuppRessQR= mAChlne-==A-lQbsteR=
pRQgRA m-AnD-DQuble=b lnD--whQse= -CuRRenth=
pRevAlhng-teRRestRIAl-effeCtuAuQn--QCCu pIes
A-mAChI nI C=AssemblAge=s pACe--glvI ng
b R Q.A D -s t RAt e g I C - C Q.n t R Q.l -Q.v e R -the -
AnthRQpfrmfrR phl C=stRAtA--I nteRmeD IAte
be l wecn--- hi Qi.eC LUlU C-AnD-erhQIeChnr C-levels-
eqUlVAlent-to-mfrDeRn=CIv I 1I zAUfrn -frn-I ts
pIA n e Q....f - C Q..s m I C = mIl I tAR I -ReA 1 I t I -
-=metAeuRfrpA-(Q.R--==metACCQ.RD)=-An
csCAIAtI ng=DI Sl n tensI fl I R=seCuR I teCtuRe
thAt-DeplfrI s-sepARAte-but-COORD! nAteD
CRusheRs--==foR==--CultuRe-AnD--==foR==--the
bfrDI-==AleXQ=frRgAmC=sIstem--=beCQmlng-
lcXQRgAm C-As-It-CfrmpResses--- DQDge-Qne--AnD
Ziigothic X-Coda and Fanged Noumena
- The text describes a process of dismantling the biological organism into multidimensional sections, moving beyond representation into inorganic, dynamic channel-hopping.
- It critiques traditional human structures like psychoanalysis, monotheism, and the family unit, suggesting they are obsolete categories that fail to provide protection or comfort.
- A visceral metaphor of being 'skinned alive' is used to explore the limits of intensity, pain tolerance, and the engineering of sensory experience.
- The narrative shifts into a 'mil-spec' interrogation scenario where neurological thresholds are tested through 'sim-stim' programs and extreme stimuli.
- The 'Ziigos' are presented as entities existing entirely outside of human history, reason, and identity, representing an ultimate terrestrial 'double-pincer' force.
How do you imagine it feels to be skinned alive? Better than sex? Or just different?
the-Qthe R -pulPs-IQU --66* 96* 99--eveRI -pARt-of
znmQD2 Xn-ls-tenseD--foR-thls--sImultAmQush-
474
A ZIIGOTHIC X-CODA
sCRAmbhn g-lIngQCQDlngs--bI I-Usrng-them-As
nOv AnumeRI C-CunteR=tI Ip--AnD-fuCkr ng=up-the
QRgAnrsm --brr-Dr smAnthng- rt-on-Cunt Inuuuunm
rnto-pQhDrrmensrQAI= bQDr=seCtIQns---thrs-hAs
nQthmg- At-AlI -to-DQ -wlth- RepResentAtrQn---rts
AbQut-An-AnQR gAm C=but=brQDr lnAmIC-ChAnnel=
hQpprng=pRQCess- --swlvel hng-bQDles-(nQt
ImAges-QR -thQughts )--thRQugh -v ARIQU s-spAtrAI
sets-- -Qn -ADQptIv- -=CuntI n u u uunmnnneX=h I Ins
when -ther -CRQ ss-tRQpI C=IAtI tuDes-zQnes- Qf
(-=AmQngstthe-4s8327-AnthRQPrCAllr= UnfAmlhAR )
= --su bAtom r CAlI I =shRunken-unlveRse=
1 =Dr I mensIQns---then-CuntA Ckmg-rnto-A
n u meR I C = eng r nee R In g = p R!LC e s s - - - =
to-the--AlwAl s-Ahen--tensII I I-CuntIng-p RQCeDuRc
mQ.s t-Apt -to-CQnve C t-mAteRIAl-fRom -the
fRQzen=Qut- bQDI=pQtentIAls- Into-metACCQRD=
seCuRI tI=spACe=-- -nQt-eXACth -CQnsr stentW I th
the -=znm!LD 2 = IS =A=C !Lu P 1=!Lf=humAns =
stoRI --but-1l3=IAI r Rs-Qf-CAmQu flAge-smOOth
thAt-.Qu t-mel.QseX- I s -foR-CRustACeAns
-AlwAIs-2 -prnCeRs -QRgAmC=meRt IA-RelIC
s peRm=tRAnsfeR-behAvr Q.R-+-phAIIQbQIl QX=
C n!Lb=IAnguAge -- se Rr Al = P R.QC e s s Ing-
DeDIstRIb utrQn- AntInumbeR-Qn e-At-A- tIrm-Qne
pems-tRII- DQlng-k=wAR-W lth-thAt-IQUR-betteR
off-tRADIng-It-foR-A-pAIR- of-bIACk-Ru nmng-
475
FANGED NOUMENA
shUes-UR-Q.eDIpA I-CQ.nCentRAtIUnAIAtheIsm-
pI CkI ng-A-fI It-WI th-Q.nh -l=gQ.D-DQ.esnt-CQ.Q.k
A n I -l.!Lb s t e R s - Z I I g.!Lt I C = etC -esCApe s =
ubsulesCes- All-pSI ChUAnAh tI C-CAtegURJ es-befoRe
even-stARtIng- mummI-+-DADDI -ARent-gUIng-to
pRUteCt-IUU---theII R-nUthlng-UR-Au sChwrtz--
Zr I IgUs-bI I t-Anrthmg-thAt-tRr rs-to-nuRtuRe-oR
ComfoRt-them---nQt- thAt-AmthIng-DUes--�htICs
Is-the-sAme--eveRIthIng-Is --unless -Its-k=wAR=
zrrgUmutAtrQn---we-tRIID-gQD=DesIIR=ARt=ReAs
Qn=hrstoRr=stAt e--theI -tuRneD-Qut-to-be- AusChwItz
foReveR---A-to-z---vIRtuAl-stRAtoveRlQ.RD
WlIIt-supeRnQy A-mtensItI-.Qn-the-hIIpeRplAne--hQyv
I)Q-I�-ImAgme-I t-feels-to-be--skrnneD=AhIVe.«. ??-betteR
thAn-�?--UR -just-DdfeRen�?-jACk-mt<rCOp=heAD
pRQfessIUnAI-sklnneR--InteR RUgAtIUn- sCene--
rt-AlwArs-useD-to- be-the-sAme- bAsIC-pRl.!blem--
ReAlh -gettmg- sQmewhe Re-bAstARDs-fArnt--.QR -DIe
Qn-IQU --AbURteD-IntensIve=VQIAge s--QRgAsm --
but-thAts-All-Qve R=--gettrng-the-fIRst-.Qne- RJIIt-IS
tough--the-templAte-hAs-to-be -A-�mAn-( -=hIIheR
pAIn-toleRAnCe)-UbVIU Ush-hAs-to-beAn-eXem
p1ARr-pIeCe-.Qf-suRgeRr- -beAutrful-CleAn-osC Ilhllns
-well=Dr ffeRentIAte D-stI m --sh CI ngs-peeh ngs
tuggI ngs- -CAReful-bAlAnCe -of-pAl n
feAR-DespAIR-DIsgust--sheets-Com mg=AwAI
smOOthh--RenDIng-sub=CutAneUus-tIssues--muCQ
476
A ZIIGOTHIC X-COD A
membRAne-peAk=events-sheeR-stlm-p.oetRI-when
I.ou-pUll=AwAI-the-fACe--AfteR-thAt-I tS-ARtISUC
fReeD.om--n.o -WAI-Am.one-fAlnts-theIR-esCApe
fRom-A-sklnneD=AlIve-slm=StIm-pR.ogRAm-theI
get-whAts-Qn-the-wAfeR--IQCkeD-Into-the
ReC.oRDlng--.ok--theRe-ARe-thResho IDs--wheRe
bRAlns-shQRt=Qut--wllp-memQRI--swAmp
speeCh=CI RCUI tRI -.oR-stop=Resp.onDI ng---but
theIIR-A-IQnng-wAI-up=RlveR=---eDlt-Qn-A
pC--(the-.onh-speCIAlIzeD-eqUlpment-In-t he
AssemblAge-Is-A-mIl=speC=Amp- )=-If-It-Isnt-just
foR-fun--IQu-neeD-t o-plt-th e-pAtIent-Ab.out-to
bReAk-DQwn-ResIstAnCe---AnD-It-CAn-be
hARD-foR -them-to tAlk-unless-I.oU -CQQl-I t-Down
to-gentl-RlppI nglnteRmI ttentlI--IOOpmg-s.ome
thIng-RelAtIvlI -SQ.QthI ng-thQRACI C=sheets
Comlng=AwAI-mAI=be--===--n.ot-mAm-tAkeRs
foR-6o-IeARs-.o.f-RoCk+RQll-foll.o.weD-bI I -Q4-
houRs-In -A-metACCQRD-I nteRRQgAtI Qn-CentRe
--ClvlhAn-tAlk-AbQut-InteOSltIeS-IS-A-pke--
fAsCIsm=mQn.o.the Ism-ARe=Is-neltheR-.op tI.on-n.oR
I De n t I tI -but-U 1 tI mAte-te RRestRIAI
D.o.ubl=pInCeRs--AnD-the-ZIIg.o.s-ARe-Q utsIID-
Completeh -.outsI I D--theI -ARe-nQt-DeCQnstRuCtmg
Nomad War Machines and Ziigothic Codas
- The text describes a schizoid state where internal mental processes are externalized into a 'body-mates' collective, bypassing traditional dialectics.
- It characterizes the current reality as a 'virtual free-fire zone' where the nomad war machine operates through speed, darkness, and inhuman robotics.
- Biological and social structures like gender, language, and politics are declared extinct or irrelevant in the face of 'megabacterial planoculture' and cell-swapping.
- The narrative outlines a four-phase progression from normative control to the construction of a nomad war machine and total conflict.
- Language is critiqued as a 'crippled numeracy' and a neuro-violence mechanism that must be destroyed to facilitate pure computational omnipotence.
- The emergence of the 'metaccord stratocomputer' signifies a culture of virtuality where entities exist and act without ever having been 'made' in the traditional sense.
This is what a nomad war-machine looks like—it stole 1000 pairs of black running shoes from the enemy only interested in speed and darkness.
-theIR-WAI-QUt--theIIR-twInvADmg-fR.om-else
wheRe--sChlz.o.phRemA-hAsbeen-tAken-Qu t-of
theIR -heADs-AnD-spReAD-Qu t-thR.o.ugh -the I R-
477
FANGED NOUMEN A
bQDI=Ch mAtes--It=theI-Doesnt-gum=up-m-DeAD
stRAtoDIAleCtI CS--I tS-QbVI!LU s-t!L-them
ChRQmQsQmAl --we-hAD-the-new-jeRusAlem-weIR
hAvIng-It-foRevcR--Its-AusChwltz---AlllthIng
thAt-Isnt-n QvA=numeRIC-k=wAR=mAChlneRI
Qn-A-b eCQmI ng= RAt-DIAg!LnAI --I s-just
fuCkIng=AbQut--I n-A-VI RtuAI-fRee=fIRe=zQne
DQnt-ImAglne-the-DIs AstcRs-Qf-wAR-stoppeD
hAppenmg-- I t-kept-mQVI ng---thIS-I s-whAt-A
nQmAD-wAR=m AChI ne-IOOks-1I I k---I t=theI -stole
lOoo-pAIRs-of -blACk-Runlll ng-shQes-fRom -the
enemI-Qnh-InteResteD-In-speeD- AnD-DARkness
---InhumAn-enQugh-neveR-to-be-AusChwItzeD
bI-QmmlQbsteR-RQbQtICs--nQthIng-CReAteD-It-
It-wAs-AlwA IS-CRQsseD=twlnneD-Qn-the- pIAne
genesIs=sCIS SQRs-to-gemIlll=nQmQs---CQplng-wlth
DQubles-Its-nQnself--ChlmIng-thRQugh-plnCe R
thICkets-tQ-DeACUvAte-gQD=CQmpQnents-AnD
steAI-foQD-bII- mlmICklng-fRACtuReD-mtenSItIeS
WI th-SI ZI get! C-CQllAteRAl s-thAt-CAnnQt-be
CooRDInAteD---seelng-the-ZIIgQs-eveRIQne
nQs--I mmeDIAth --mAles-ARe-eXt! nCt--theRe
I s-nQ-IAnguAge ---thIs-Isnt- AbQut-fRAnChIslng
Qut-IQuRDAughteRs-fACe-to-A-pellls=fARmlng
CUngIQme RAte--It-hAs-nQ-pARents--nQ-pllhltICs-
nQ-em Qt! !Lns---sheeR -AffeCt-DIS tRI bu tes-
478
A ZIIGOTHIC X-CODA
hQRI zQntAlh -ACRoss-the-CQlleCUv-skI n--ZI IgQS-
feel-whAt-the-wAR-neeDs-t hem-to-feel---get
ReAl--we II R-nQt-tAlkIng-mAmmAl-heRe--n QwheRe
neAR--ZIIgQS-VQIAge-Qn-the-spQt-thRQugh
IntensIV-VARIAuQns-Qf -bQDI=melung--sCAle-hAs
beCQme-plAstIC-(fACtoRl 000-( -==k) )-effeCtuAtrng
megAbACteRIAl-plAnQCultuRe-flAtteneD-DQwn-to
AnuCleAR -Cell=sw Appl ng-zI IgQnQmQus-weApllnR I
foR-flghtIng-2-gQDs-CQnCuRRenth--venomeno n-
the-AssembIAge-evI DentlI -1 nCluDes- pARts-fRom
QutsIID-thIs-solAR=sIstem---CuR -hIIks-the-zIIIgQS
A-IQt==----------------- ---------==nQtes==-
-=DelQCArlzeD= ---==-out-.Qf-RespeCt-foR -lrnguIstIC
tRADIuQn-AnD-CQmmQn-usAge-(westeRn=
CIVIh zAuQn-=( AusChwItz=foReveR) )=-WQRDs-hAve
Qnh -been -fuCkeD=AbQu t-WI th-wheRe-stRI CtlI
neCessARI -===-the-sChem Atl CAllI -DesCRI 1 beD
sequenCe-g Qes-hIk-thIS-==lO=phAse-==nQRm
QntQ-us-QR-get-kl lleD-( thIS-I s-gettIng-mQRe
DlffICult-to-bACk=up---but- thlngs-stIll-get-A-IQt
heAvIeR -soon )=--2o=phAse-==Rule-QveR -us-QR
-get-bInneD-(get-DupeD-Into-thIs-swAmp-An D
ReptI I l=nI 1 tmARe-tAkes-IQu-QU t-Qf-the
sCRrpt)---3CFphAse----=:Qk-fPD=off-then- (-=InsteAD-b urlD
nQmAD-w AR -mAChIne )=--4o=phAse-==sQ--I ts
wAR-O===-mARQQns--=mIXeD=pQpulAtIQns-of
nAtlv=mesQAmeRI CAns-AnD-esCApeD-slAves-
479
FANGED NOUMEN A
AlheD-to-pI RAtes-In-gueRRIllA=wAR-AgAInst-the
spAmsh-====-gQeDel-wAs-nQt-A-IQgICIAn-but-A
nUmeRICAl=engIneeR( InCQmpleteness-A-SI I D=effeCt
j!!ke-AbQut-pQmpQU S-I DIQts---the-ReAl-DemQn
stRAtIQn-RIgQRQuslI-eXpQses-lAnguAge-As-A
C RIp pIe D = n u rn eRA C I -= == A n - Ins I D I !Lu s
=neuRQVIQlenCe-pQweR=rn eChAnIsm---kIll-the
WQRD )=---====-XQR -CQrn putAu QnAI-QmmpQtenz
--wIthQut-IImIts-eXCept-thQse-eX pResSIbl-In-A
DIm ens I !Ln -!Lf -puRe -p s e u D!Ln u meR I C -
hQmQgenel tl ---sterns-entI Reh -fRQ.m-An-
AbsQI ute=DesensI tI zAtIQ.n-wI th-RespeCt-to
eneRgetIC-Input-feAtuRes-(eleCtRQmAX-(n)-Is
ReglsteReD-As-IDentICAI-tQeleCtRQmln-( 00) )--
DeAD-I I s-+-DeAD-fIngeRs-I ntegRAI-to
sIgn I fl eR= D!Lm I nl Qn-ARe-Repll CAte D=
sImulAte D-I n -pAtteRns-frf-eleCtKon=tlQw
ChAnnelleD=thRQugh- nQnhumAn -teChm CAl=sl stems
-=--the-metAC CQRD-stRAtQCQmputeR-Is-bQRn-
Its-All-heRe--A-CultuRe-thAt-CAn-pRQDuCe
�keD=&ut==I I s=behA vIQR -wheRe-lIs-neveR -eXIsteD-
VI RtuAlItI-ls-the-usuAl-nAme-===the-C ApAblhtI-to
tAke-sQmethl ng-AwAI-wIthQut-wAstIng=tIlm-mAlnng
It-fIRst=AfteR-hnk=up-wIth-whAteveR-CuR-CQmes
fRQm--esCApeD-web-IntelhgenCes-mIIt-be-shlth
fuCkIng-AngRI -Ab!!ut-thl s=-------
480
Katasonics and the Solar Schism
- The text describes a 'schizophrenic Sun' and the 'Katarsun,' a dualistic solar entity that locks alien entities into the solar system through twin-faults.
- Time is conceptualized as a series of zones and 'slow-factors' ranging from the Zenith/Xenonightmare to the Citizen Gigamachine and War-Machines.
- A catastrophic geological event is prophesied where ice-sheet melt and sea-floor lift trigger a 'Quag-Earth' and 'runaway geosmear.'
- The 'Gigamachine' operates through axiomatic linkage and mononumeracy, nesting universal histories within alphanumeric systems.
- The narrative dissolves into a post-human state of 'sentient coma' and 'autism,' where human control centers are replaced by the Kurtz-signal and Wintermute.
- The intersection of linguistics and numeracy (lexometrics and arithmology) creates a system where reality is 'saucerized' and intelligence is intercancelled.
Your skin sticks to geography, where it touches reality.
Kata�oniX
How many suns are there?
This is how it cuts.
Katarsun makes two at least.
Arising Ra-reverse Osiris. Earth-station.
When they count 0 or One-tags two.
A as Three-tags five.
Aosys twin-faults squash something.
They lock an alien entity into Solar systematics.
The schizophrenic Sun has an inner night sticking it
together.
Solar-Equator cuts through it.
Matter Energy-2 collateralize across a Xenonightma re.
When it caves into itself. First Nine. Then Three. It still
misses it.
Katasonics run-in reverse from Aosys-nex.
Ex-zoom.
481
FANGED NOUMENA
Crossing Cultural-shelves from entire-levelling at Geotime
zero. Through
[1] Zenith or Xenonightmare which is Now.
['2] The Citizen Gigamachine. Ice floats.
[3] War-Machines.
[41 State Megamachines. snake-cult monuments.
It cuts-out in click-hiss.
Kttss. Kurtz.
'These are Zones. Each sets a Slow-factor. Vowelizations
Vacant sectors.
Slow signs Are. A. Or. o. Zero. Also many Others.
Cuttings. failings.
Four. Bight. Northern oceans. Artaud. Agent Orange.
Time tags Aosys functionality: a tract no smaller than all
of artificial now.
Alpha-one makes two in itself.
A twists over thc tv"in-fault.
o tscharfakt.
Alter-origin. Ahriman-ormuz. Ante-omega.
Ultraatratuarinf rastratum mutually shatter terrestrial
singularity.
Where continuum nexes they can saucerize twintelligence.
Intercancelat ion-stases.
Aons of coefficient killing-machinery.
If its going to occur, It has.
Running time means you never have to wait. Even when
fainting with hunger for Kurtz.
482
KATA�ONIX
Ultimate:intimate.
Katarsun Tzafrer Urfru.
Are the oceans extraterrestrial or not?
Katarsun the Fish-star sinks Antarctica, triggering
Quag-Earth.
Runaway Geosmear through seismo-climactic linkage.
Its Summer-TIme in the Settlement-Areas.
Mutual reinforcement series. Headings, shelvings, scour
ings, revellings. Ice-sheet melt meets sea-floor lift.
7 x 10 to the 7 KMthrees Aggregate water Overflow.
Slither-morasses of the Aozone simmer at an average
Celsius-50•
When this is what you see. You'll know. It's time.
Your skin sticks to geography, where it touches reality.
Tsunamis.
Katarsun Tzafrer Urfru.
Katarsun Tzafrer U rfru.
Civilization lost in flat wet-out fevers.
Then the war kicks-in.
Kur khalucta. Khecta. Kurkete koto hula. Kurtete.
Kartete. Karaguna. Kharta charta.
Catecru.
Zone-one. 0 Gigacivili zation meets no concrete equiva
lent. Only resistance.
Nightmare- Q.
It counts itself one at a time, whilst twin-faulting.
483
FANGED NOUMENA
Meta successive. Gigamachine mononumeracy has a
variety of consistent features.
[lJ Axiomatic linkage collates novelizations with counter
function sections.
[2J Segmentary culture. Communication rules. Informa
tion units.
[3J Each new now travels as a reinforcement wave across
two series.
One. It nests as Universal Histories of Alphanumer lcal
systems.
Two. Logics ofAxiomatization.
Five times two equals ten.
Ten minus one equals nine.
Ten cannot count itself.
Take (l):coins (2):Notes as construct-levels.
Some amount of coins make a note.
Twin-faults criss-cross Coins-Notes '.,,'ith the Zygosystcm
at issue. A-coins nex
O-Notes. A-Notes nex O-coins.
Axiomatics nexes numeracies to languages in this way.
[1 J Lexometrics. Linguistic-coin counting using
numeric-not es.
[2] Arithmology. Numerical-coining naming using
linguistic-notes.
Surely General, when you gave Kurtz 29 Air-cav you must
have known ... Trails off.
This is scarcely human.
484
KATA�ONIX
At most.
A sentient coma.
Autism.
It's cranking Agent-orange into your arm every night for
a million years.
Lurking in furnaces.
Crawling ever further in.
As soon as Kurtz is extinct Wintermute takes over.
KS. Kurtz-signal.
Air strikes ineffective.
There are no concentrations or control centres.
Slowness infection.
Malfunctioning intelligence machinery.
No longer cataloguing hostile contacts as human.
Mission unstrapping in novaheat.
Everything loses if it isn't going South.
Xenoculture and Skin Currencies
- The text describes a descent into a 'numeroculture' where language is replaced by skin-based currencies and machine-meat processing.
- Traditional grammar and lexicon are viewed as 'ICE' or 'glue' that must be melted into suffix-systems and neo-numerical units.
- The setting is a predatory jungle environment where Earth 'thinks for itself' through war-creation and carnivorous animation.
- Human communication is depicted as a 'coma-phase' stasis that must be evacuated in favor of intensive fusion and convergence engineering.
- The process involves a 'Kurtz-trajectory' where existence ceases and is replaced by 'Vaaung-Time' and insect-scream messages.
- The transition is marked by physical mutilation, including missing fingers and the evacuation of the mouth to make room for venom.
Language equals ICE. Anticurrency. Glue.
No message except that Vauung's out there. Very still. Its
some sort of chicken game.
Shifting-skin currencies.
Zone-Two. E.
Relearning alphanumer ics.
Last night it was the Tau-3Jungles.
They animate.
Turn carnivorous.
Earth floats in the lower sun. Snakes. Cancer. Engulfings.
You wake screaming forever.
Its only the 6th time so far. Currencies come in sets.
485
FANGED NOUMENA
Each sketches a numerocul ture making war-creation.
#
They are intrinsically several.
Snake-eggs. Tack-charts. Click-hiss cross-hatchings. Mul
tivective nova continua.
Moltings. Wreckage s.
Time-missiles lost in the Jungle.
As they talk without language they tell themselves how
to move without concentrating.
Crossings.
Trigger-values.
It treats enemy forces as a nutrient reservoir.
Air-cav regiments fraction to machine-meat.
Crunching Six sustains a Qwernomi-war Catacycle.
Stealing food lets it hack out its guts.
Hot torsion click-in.
It gets lighter, scatters faster -
Eat less, or kill more.
Slow-roast memory-to-momentum conversion.
Currency-quanta coercive crossing wars that last.
Language equals ICE. Anticurrency. Glue.
Grammar- Lexicon twin seizure.
Squeezing-out machinism.
Incremental evacuation of the mouth.
Once skin transmission starts it returns to the jungle.
Numerals are for naming numeracie s.
Money-systems are for autism waves.
486
KATA<;ONIX
Mouths are for venom.
Signifier eye-gougi ngs. Fingers missing.
Tomorrow melts into casualty statistics.
No SOON left.
Just insect scream messages to love the Jungle. Out here
the war is Earth thinking for itself.
Or the twins -
Use equations executively not conclusively.
Traffic tacks. Cross-from-to.
Snake-squalls. It continues. Mutation-Recounts. Trivia.
Night Screen :: white lines.
This is what it tells itself
[ ] Melt Syntax into suffix-systems that nex-to-numeracie s.
[ ] Functionali ze case.
[ ] Effectuate theories as microcultural turnings-into.
r ] Try Out-flattenings
[ ] For every rule make a rule remaking move, squashing
it onto continuum.
[ ] Talk in counters. Count in cuts. Each in several ways.
Qwernumerize.
[ ] Treat every channel as virtual intereffective with every
other.
[ ] Use real elements.
When taken as clicks.
One makes one [when] None or Nine makes two.
Two or Eight make one. Ten or One Two make one-l one-Q.
[ ] Turn-inferior.
487
FANGED NOUMENA
Evacuate the mouth.
Tack to skin currencies.
Make things Tilt Slant-2. Stalk tag-2 Routines
[ J Sift out habits into switch-traffic, skills, tenets
[ ] Extract lines of continuation, slanting shelves, erratic
concurrences.
[ ] Hack out security futures.
[ ] Seck-out Tomorrow-2.
As if something was throttling them.
You think Cthonic was for human?
Cthink, Cthonic. Cthexls. Cthksys. Cthosun. Cthosion.
Turning-into is not exchanging for. [X changing 4]
It is travelling with or touching non-locally, Engineering
Convergence.
Continuous now-emergence or intensive fusion.
Convergence engIneering makes whatever Intensities
nmon.
It involves an effective semiotics.
Melting signs into neo-numerical currency units.
Choking noises.
This was the funniest: they thought it was trying to talk
human.
Snake in its throat. Velocity confusion.
Inert-control mass clogs languages near to stasis.
It's easy to camouflage coma-phase xenocultur e-kit in
them.
Anglolinguistic mish-mas h creolizations.
488
KATA�ONIX
Zone-Three. A.
I-ching numeracy runs 1 2 11 12 21 22 111 112 121 122 211
I t could count forever.
Kurtz-trajectory crosses the line
snarls
Vaaung-TIme says cease existence.
Saving ammo for real now, where life lent useful.
It seethes.
Switching to skin-currencies.
Nothing can live here so it's easy to talk.
[3] Three. Throw [ThrO]. Earth:three. Theta-waves.
Stone-3 T
hr-oat. AT. 8088. �T.
Voan-vision scan across waste immensities.
White-hot lines criss-cross through metal.
Stink of crustacean sizzling.
Ksintilla.
Kotam. Kunkhat kut. Katzur Kat. A khuna kokhatar.
Khaluna akhaluna. Akhatur
Fanged Noumena and Geotraumatics
- The text transitions from a fragmented, poetic exploration of 'infochemistry' and 'software wolves' into a formal interview with Professor Daniel Charles Barker.
- Barker defines his work through 'anorganic semiotics,' a field that bridges life sciences, cryptography, and mineral patterns.
- A central theme is the critique of SETI and traditional information science for conflating 'intelligence' with mere 'organization.'
- Barker introduces 'geotraumatics' as a rigorous practice of decoding the earth's history and signals through a cryptographic lens.
- The narrative suggests a shift from biological evolution toward 'electromolecular traffic-clusters' and 'neo-akaryotic' cellular architectures.
Software wolves comb through the ruins of the future.
kuna.
Akhurkhur nkhurkhur khurkhunn.
o kroma tata kn ni khroma. 0 kha noma okhi no khroma.
Helsinki. Vvolume-kilometr es.
Retack to True South.
Software wolves comb through the ruins of the future.
Sheer science friction.
Extinct.
489
FANGED NOUMEN A
In 6 clicks its crossIng.
Uncut Quags of the South.
Kerans counts to 29.
Cancer. Cancer. Cancer. Cancer. [Can Sah IX several].
Can the cancer crisis.
Can the Snakes. [Can-2Snakes [CS2)].
Canister.
666 999. Cytosine + Chloro-Dracil + Trimethylsilicate
infochemistr y.
Skin-mottlings.
Thermosignature neutralization cancels heat-seeking.
Surgical-analysis enemy physiomass classification hostile
microanatomy as
Neo-akaryo tic insufficient. *
Notes
Incremental fission cellular architecture into electromo
lecular traffic-clusters.
Infochemical transfer to trihellcal rhizosomes.
Immense range of 3-nethylhexachlor osilicate monomers .
Sole-function uracil-analog seens_
Tissue-cultures.
Cross-talk. Staccato clicks across howl.
R V F Z S. Surface tension. Sswerve. Vortex. R Erratic.
SK. Kink. Sink. Syzygenic. Kiss. Cs-
Instinct-matrix sssequence-sensitization twists through
tactical shuffling sequences.
Cross-key rhythms. Qwernomix. Loa.
490
KATA�ONIX
Whatever hashes the equator.
Qwerversion. Veves.
Loa. The Secret Ones. Each a rhythm.
Ascent to surface.
Neuronics.
Stone sphinxes.
Aqua Incognita. Aqua Incognita.
TIme-jungles.
In a vast, convulsize recession of the equinoxes _
Snake wine relentless an[ d] magnetic. Magnetic it calls
south _
Lagoons of the Equator.
Counting to 29.
Kerans. The sun, its surface stirring rhythmically like slag
on molten metal.
TIme-travel Latitones. C-virus. Snakings.
Clutter _ [x many J.
Schism.
Tactile screen-scrollings into ASCII icons. Sigma·sift.
Syzygetics.
926. OD -Pest.
629. Pest -OD.
491
Barker Speaks: The CCRU Interview
with Professor D.C. Barker
Daniel Charles Barker has been Prqfessor qf Anorganic Semiotics
at Kingsport College (MVU, Mass.) since 1992. His extraor
dinary intellectual achievements resist easy summarization,
involving prqfound and polymathic engagement across the entire
range if life and earth sciences, in addition to archaeocultu ral
research, mathematical semiotics, anatomical linguistics, and
injormatic engineering. Trained as a cryptographer in the early
1970s, he has spent his life decoding ancient scripts, quasibiotic
residues, and anomalous mineral patterns (amongst other
things). In late Autumn 1998 CCRU met with Prqfessor Barker
in his Q[fice at mvu. The following is an edited transcript if
that meeting.
493
FANGED NOUMENA
TIC-SYSTEMS
Cryptography has been my guiding thread, right through.
What is geotraumatics about, even now? -A rigorous
practice of decoding. So I haven't really shifted at all in
this respect. There is a voyage, but a strangely immobile
one.
I started out at MIT working in the information sci
ences -my thesis proposal was quite conservative, involv
ing mostly technical issues to do with noise reduction and
signal modulation -but MVU was just getting started,
and my research was transferred across to them. That led
to various contacts, and from there to employment with
a NASA-related organization that has particular interests
connected to SETI activity. My task was to help toughen-up
the theoretical basis of their signals analysis. They wanted
to know how tu Jit;uiuliualt: -ill principle -between
intelligent communication and complex pattern derived
from nonintelligent sources. To cut a long story short, it
became increasingly obvious to me that although they
said they were hunting for intelligence, what they were
really seeking was organization. The whole program
was fundamentally misguided. Various people had big
problems with the direction of my research, which had
basically veered-off the organizational model. The social
friction became intolerable and I had to leave, which
was messy because of my high-level security clearance ...
Geotraumatics and Tic-Systems
- The investigation of suborganizational patterns requires stripping away assumptions of intentionality, subjectivity, and interpretability to reveal assemblies of microstimuli.
- Standard measurement and classification are inadequate for quantifying disorganized multiplicities, which instead require nonmetric scales and engineering fusional multiplicities.
- The concept of 'tic-systems' describes flat arrays of intensive populations that are intractable to traditional subject/object segregation or scientific metapositions.
- Freudian psychoanalysis is reimagined not as hermeneutics, but as a map of the Geocosmic Unconscious—a traumatic megasystem of anorganic tension.
- Advancing in the study of the cosmos requires the development of new cultures and machines that can process signals without imposing prior theoretical models.
- The author posits a fundamental equation for this field: virtual tic-density equals geotraumatic tension.
They cannot see the machine for the apparatus, or the singularity for the model.
494
BARKE R S P EAKS
Suborganizational pattern is where things really happen.
When you strip-out all the sedimented redundancy from
the side of the investigation itself - the assumption of
intentionality, subjectivity, interpretability, structure, etc -
what remains are assemblies of functionally interconnected
microstimulus, or tic-systems: coincidental information
deposits, seismocryptions, suborganic quasireplicators
(bacterial circuitries, polypoid diagonalizations, inter
phase R-Virus, EchO-DNA, ionizing nanopopulations), plus
the macro machineries of their suppression, or depotentia
tion. Prevailing signaletics and information-science are
both insufficiently abstract and over-theoretical in this
regard. They cannot see the machine for the apparatus,
or the singularity for the model. So tic-systems require an
approach that is cosmic-abstract - hypermaterialist - and
also participative, methods that do not interpret assem
blies as concretizations of prior theories, and immanent
models that transmute themselves at the level of the
signals they process. Tic-systems are entirely intractable
to subject/object segregation, or to rigid disciplinary
typologies. There is no order of nature, no epistemology or
scientific metaposition, and no unique level of intelligence.
To advance in this area, which is the cosmos, requires new
cultures or - what amounts to the same - new machines.
The problem was: how to quantify disorganized mul
tiplicities? Diagonal, irregular, molecular, and nonmetric
quantities require a scale that is itself nonmetric, that
495
FANGE D NOUMENA
escapes overcoding. Standard procedures of measurement
and classification prove entirely inadequate, since they
presuppose rigid conceptual segmentation by quantity
and quality (Deleuze-Guattari's twin-pincers of molarity,
type and degree). Once things are being worked out at the
level of tic-assemblies - or flat ticking arrays - there are
only intensive populations, and measurement has to give
way to engineering fusional multiplicities: systems that
count themselves only in the way they propagate, imma
nently numbering multitudes, like nanoplastic quantum
swirls. Eventually a machinic solution was provided by the
TIck-Distributor, but that came later ... At first there was
just the equation, precipitated in what I still thought to be
my own body, virtual tic-density = geotraumatic tension.
GEOTRAUMAT I C S
I came to Freud relatively late, associating it with oedipal
reductionism, and more generally with a psycho logistic
stance that was simply irrelevant to cryptographic work.
It's important to remark here - no doubt we'll get back
to this - that everything productive in signals analysis
stems from stripping out superfluous prejudices about
the source and meaning of complex functional patterns. I
took - and still take - the vigorous repudiation of her me
neutics to be the key to theoretical advance in processing
sign-systems. It was Echidna Stillwell who helped me to
496
BARKER S PEAKS
see Freud from the other side. It was a difficult period
for me. There had been a lot of painful fall-out from
the NASA work. Psychotherapists were involved, in part
attempting to pathologize and discredit my research,
and in part responding to real stress-related symptoms.
Between the two was a grey zone of traumatic dysfunc
tion and paranoia involving difficult feedback effects.
Stillwell persuaded me that the only way to get through
this was to try and make sense of it, and that this was not
the same as submitting to the interpretative mode. On
the contrary. In 'Beyond the Pleasure Principle', Freud
takes a number of crucial initial steps towards mapping
the Geocosmic Unconscious as a traumatic megasystem,
with life and thought dynamically quantized in terms
of anorganic tension, elasticity, or machinic plexion.
This requires the anorganizational-materialist retuning
Geotrauma and Plutonic Science
- The text redefines psychoanalytic concepts like trauma and repression through a geological lens, viewing the Earth as a body of 'anorganic memory.'
- Neoplutonism posits that the Earth's molten core is a reservoir of primal exogenous trauma, formed by ancient planetary collisions.
- The metallic core, or 'Cthelll,' acts as a 'geocosmic motor' that drives plate tectonics and electromagnetic fields through impersonal, nonsubjective energy.
- Biological evolution is framed as a series of responses to geotraumatic events, such as the oxygenization crisis and the K-T extinction.
- Eukaryotic life is described as a highly suppressive regime of 'nuclear command-control' that emerged from planetary poisoning.
- The author suggests that deep seismology reveals the 'earth scream,' where geological tension is frozen into the structure of biological organisms.
Cthelll is the terrestrial inner nightmare, nocturnal ocean, Xanadu: the anorganic metal-body trauma-howl of the earth, cross-hatched by intensities, traversed by thermic waves and currents, deranged particles, ionic strippings and gluttings.
of an entire vocabulary: trauma, unconscious, drive,
association, (screen-) memory, condensation, regression,
displacement, complex, repression, disavowal (e.g. the
un-prefix), identity, and person.
Deleuze and Guattari ask: Who does the Earth think
it is? It's a matter of consistency. Start with the scientific
story, which goes like this: between four point five and four
billion years ago -during the Hadean epoch -the earth
was kept in a state of superheated molten slag, through
the conversion of planetesimal and meteoritic impacts
into temperature increase (kinetic to thermic energy).
497
FANGED NOUMENA
As the solar system condensed, the rate and magnitude
of collisions steadily declined, and the terrestrial surface
cooled, due to the radiation of heat into space, rein
forced by the beginnings of the hydrocycle. During the
ensuing -Archaen -epoch the molten core was buried
within a crustal shell, producing an insulated reservoir
of primal exogeneous trauma, the geocosmic motor of
terrestrial transmutation. And that's it. That's plutonics,
or neoplutonism. It's all there: anorganic memory, plu
tonic looping of external collisions into interior content,
impersonal trauma as drive-mechanism. The descent into
the body of the earth corresponds to a regression through
geocosmic time.
Trauma is a body. Ultimately -at its pole of maximum
disequilibrium -it's an iron thing. At MVU they call it
Cthelll: the interior third of terrestrial mass, semifluid
metallic ocean, megamolecule, �nd pressure cooker beyond
imagination. It's hotter than the surface off the sun down
there, three thousand clicks below the crust, and all that
thermic energy is sheer impersonal nonsu bjective memory
of the outside, running the plate-tectonic machinery of
the planet via the conductive and convective dynamics of
silicate magma flux, bathing the whole system in electro
magnetic fields as it tidally pulses to the orbit of the moon.
Cthelll is the terrestrial inner nightmare , nocturnal ocean,
Xanadu: the anorganic metal-body trauma-h owl of the
earth, cross-hatched by intensities, traversed by thermic
498
BARKER SPEAKS
waves and currents, deranged particles, ionic strippings
and gluttings, gravitational deep-sensitivities transduced
into nonlocal electromesh, and feeding vulcanism ... that's
why plutonic science slides continuously into schizo
phrenic delirium.
Fast forward seismology and you hear the earth
scream. Geotrauma is an ongoing process, whose tens ion
is continually expressed -partially frozen -in biologi
cal organization. For instance, the peculiarly locked-up
lifeforms we tend to see as typical -those more-or-Iess
obedient to darwinian selection mechanics -are less
than six hundred million years old. They began with the
planetary oxygenization crisis, triggered by the satura
tion of crustal iron, followed by mass oxygen-poisoning
of the prokaryotic biosystem and the emergence of a
eukaryotic regime. Eukaryotic cells are highly suppress ive.
They implement a nuclear command-control model based
on genomic ROM, affined to meiosis-mitosis diplocaptu re,
hierarchical organization, and multicellular specialization.
Even the distinction between ontogeny and phylogeny
-distinct time-orders of the individual and the species -
makes little sense without eukaryotic nuclear read-only
programming and immunological identity. Evolutionism
presupposes specific geotraumatic outcomes.
To take a more recent example, the efflorescence of
mammalian life occurs in the wake of the KIT-Missile,
which combined with massive magma-plume activity
499
FANGED NOUMENA
in the Indian Ocean to shut-down the Mesozoic Era,
sixty-five million years ago_ Irruptive vulcanism plus
extraterrestrial impact, linked by coincidence, or plutonic
looping_ So there is a catastrophic transition to a post
saurian megafauna regime, part of a much larger overall
Spinal Catastrophism and Geotrauma
- The transition to bipedalism is framed as a 'frozen calamity' resulting from bioseismic plate-tectonic shifts rather than a simple evolutionary triumph.
- Human psychoneuroses and back-pain are interpreted as phylogenetic injuries stemming from the verticalization of the spine.
- The human head and vocal apparatus are described as a 'crash-site' where thoracic impulses collide with the roof of the mouth due to the right-angled posture.
- Language emerges from a 'sub-cranial pneumatic pile-up,' where the tongue acts as a site of expiration for the protohuman ape.
- DNA functions as a transorganic memory-bank, containing latent 'fish-code' and other ancestral data that bypasses representational psychology.
- Vocal tics and stutters are seen as biopolitical threats that bypass the 'anthropostructural head-smash' of logos to move toward numerical intensity.
The bipedal head becomes a virtual speech-impediment, a sub-cranial pneumatic pile-up, discharged as linguo-gestural development and cephalization take-off.
reorganization of terrestrial symptomaticity, providing an
index of neohadean resurgence_ And what is mammalian
life relative to the great saurians? Above all, an innovation
in mothering ! Suckling as biosurvivalism_ Tell me about
your mother and you're travelling back to KIT, not into
the personal unconscious .
SPINAL-CATASTROPHISM
For humans there is the particular crisis of bipedal erect
posture to be processed. I was increasingly aware that all
my real prohl�ms w�rf' morbi litie,> of back-pain, or phylo
genetic spinal injury, which took me back to the calami
tous consequences of the precambrian explosion, roughly
five hundred million years ago. The ensuing period is
incrementally body-mapped by metazoan organization.
Obviously there are discrete quasi-coherent neuromotor
tic-flux patterns, whose incrementally rigidified stages are
swimming, crawling, and (bipedal) walking. Elaine Mor
gan persuasively traces the origin of protohuman bipedal
ism to certain deleterious plate-tectonic shifts. The model
is bioseismic. Crustal convulsions and animal body-plan
500
BARKER SPEAKS
are rigorously interconnected, and the entire Aquatic Ape
Theory constitutes an exemplary geotraumatic analysis.
Erect posture and perpendicularization of the skull is
a frozen calamity, associated with a long list of patho
logical consequences, amongst which should be included
most of the human psychoneuroses. Numerous trends in
contemporary culture attest to an attempted recovery of
the icthyophidian- or flexomotile- spine: horizontal and
impulsive rather than vertical and stress-bearing.
The issue here -as always -is real and effective regres
sion. It is not a matter of representational psychology.
Consider Haeckel's widely discredited Recapitulation
Thesis, the claim that ontogeny recapitulates phylog
eny. It is a theory compromised by its organicism, but
its wholesale rejection was an overreaction. Ballard's
response is more productive and balanced, treating DNA
as a transorganic memory-bank and the spine as a fossil
record, without rigid onto-phylogenie correspondence.
The mapping of spinal-levels onto neuronic time is supple,
episodic, and diagonalizing. It concerns plexion between
blocks of machinic transition, not strict isomorphic -or
stratic redundancy -between scales of chronological
order. Mammal DNA contains latent fish-code (amongst
many other things).
501
FANGED NOUMENA
PALATE-TECTONICS
Due to erect posture the head has been twisted around,
shattering vertebro-perceptual linearity and setting up
the phylogenetic preconditions for the face. This right
angled pneumatic- oral arrangement produces the vocal
apparatus as a crash-site, in which thoracic impulses
collide with the roof of the mouth. The bipedal head
becomes a virtual speech-impediment, a sub-cranial pneu
matic pile-up, discharged as linguo-gestural development
and cephalization take-off. Burroughs suggests that the
protohuman ape was dragged through its body to expire
upon its tongue. Its a twin-axial system, howls and clicks,
reciprocally articulated as a vowel-consonant phonetic
palette, rigidly intersegmented to repress staccato-hiss
continuous variation and its attendant becomings-animal.
That's vv'hy stammcr ings, stuttcrings, vocal ti(.�, extralin
gual phonetics, and electrodigital voice synthesis are so
laden with biopolitical intensity -they threaten to bypass
the anthropostructural head-smash that establishes our
identity with logos, escaping in the direction of numbers.
BARK ER NUMBERING
Once numbers are no longer overcoded, and thus released
from their metric function, they are freed for other things,
and tend to become diagrammatic. From the beginning
502
BARKER SPEAKS
of my tic-systems work the most consistent problems have
concerned intensive sequences. Sequence is not order.
Order already supposes a doubling, a level of redun
The Decimal Crypt
- Decoding numerical sequences allows for an escape from linear chronology and progressive time into a state of convergent waves.
- The concept of 'zygonovize' treats decimal numerals as nine-sum twins to map an abstract intensive wave that is indifferent to magnitude.
- The Diplozygotic Spiral emerged from the synthesis of two games, Decadence and Subdecadence, revealing a hidden syzygetic arithmetism.
- The decimal system is linked to the bilateral symmetry of the human body, specifically the ten fingers organized into two sets of five.
- State-culture suppresses popular numbering practices to maintain an ideal despotic voice or 'Logos' through institutionalized mathematics.
- The number nine functions as a 'positive zero' or full-body zero, representing the ultimate decimal numeral and a key to capitalist semiotics.
It all spontaneously condensed, and the Spiral clicked into coherence, like a secret door into the long-hidden crypt of the decimal system.
dancy: the sequenced sequence. A decoded sequence is
something else, a sheer numeracy prior to any insertion
into chronologie structure. That's why decoding number
implies an escape from assumptions of progressive time.
Tick multitudes arrive in convergent waves, without sub
ordination to chronology, history, or linear causation.
They proceed by infolding, involution, or implex. It's a
matter of convergence, and numbers do that, once they're
free to. So the first stage required plexive introgression
of the tic-density scale, which was numerically rigorized
as digital twinning. Treat the decimal numerals as a set
of 9-sum twins - zygonovize - and they map an abstract
intensive wave, indifferent to magnitude. Everything effi
cient about digital reduction is concerned with this, since
it discovers the key to decimal syzygetic complementarity:
9 = o. A flattening down to disordered sequentiality, or
abstract numerical implex. Nine is the ultimate decimal
numeral, operating as positive (or full-body) zero. It is
the abstract numeric product of the decimal-magnitude
minus one (infinitesimalized as 1 = 0.999 ... reiterating),
which relates to a particular mode of proliferation within
capitalist semiotics (of the type $99.99).
503
FANGED NOUMENA
BARKER- S P I RAL
The pattern really came together with the Diplozygotic
Spiral, which arrived suddenly, by chance. I was playing
a game of Decadence, which I had first encountered many
years before. This game already interested me because
of its numerical elegance, its complex associations, and
its dependence upon a principle of decimal twinning.
It had always seemed to hint at a lost syzygetic arith
metism, related to the bilateral symmetry of the human
body. Digits are fingers, and they come in decimal pack
ages of two times five. In Decadence five makes ten
by doubling, or pairing with itself, scoring zero. This
tantalized me, but I couldn't fit it together theoretically.
The quandary was unlocked on this occasion, when one
of the participants casually mentioned the existence of
an orrllltFrl v<l ri<ltion of the game, called Subdecadencc,
based on a system of nine-sum twinning. Subdecadence
introduces zeroes, and nine-zero twins. It works by
zygonovic numerism. That was stunning enough in itself,
but seeing the two together - or seeing between them -
was an incredible moment of diagrammatic assemblage.
It all spontaneously condensed, and the Spiral clicked
into coherence, like a secret door into the long-hidden
crypt of the decimal system.
504
BARKER S PEAKS
PUBLICATIONS
'Quasi Chemical TIc Culture Catalysis of Anorganic Pain
Wave Matrices', Plutonics, vol. X, No. 6, Fall 1990.
'Anorganic Semiotics', Plutonics, vol. X, NO. 9, Fall 1991.
'Spinal Catastrophism', Plutonics, vol. X, No. 10, Spring 1992.
'Palate Tectonics', Plutonics, vol. lO, No. 12, Fall 1992.
'Vowels: A Biopolitical Strategy', Plutonics: vol. X,
No. 18, Fall 1994.
What Counts as Human (Kingsport College Press, 1997).
505
M echanomics
Start in the State (it insists): organicist technospecialism,
pedagogic authoritarianism, and territorial sectorization
that culminates in mass innumeracy. Irrespective of its
configuration as educational crisis, the suppression of
popular numbering practices is both result and presup
position of institutionalized mathematics. State-culture -
however modern or even postmodern - is modelled upon
an ideal despotic voice (Logos). The word from on high
drafts the signifying chain, with all its essential features:
unique enunciator, semantic interiority, consecutive signs,
formally anticipated conclusion, global application, and
interpretative redundancy. When the entropic semiology
of senescent States multiplies enunciation, referentially
displaces interiority, remarks graphic spatiality, localizes
applicability, and infinitizes interpretation, it does so
under the sign of an unperturbed ineffable Logos; con
Mechanomics and Numerical Nomadism
- Numerical practices emerge spontaneously within populations as an irreducible, exterior form of thinking that bypasses literacy and professional accreditation.
- Calculation is described as a 'machinic dispersion' that occurs on the outside, utilizing fingers, pebbles, and tokens to index an anorganic distribution.
- The text distinguishes between the 'Planomenon' pole of intensive ordinality and the 'Oecumenic' aspect of quantitative magnitude or cardinality.
- A repotentiated numerical culture is aligned with a 'nomad war machine' that uses arithmetical decoding to maintain fluidity against State organization.
- Calendric systems are viewed as partial models of this war machine, where ordinality is increasingly threatened by capitalist chronometry and cardinalization.
- The 'Millennium Time-Bomb' serves as a notational crisis and a catalyst for new dating protocols like K-Time to manage temporal sequencing.
No sooner in the head than on fingers and pebbles, counting always happens on the outside.
firmed all the more crushingly by discursive specialism,
5 0 7
FANG E D NOUM E NA
rigid professional accreditation, allusive criteriology,
and linguistic fetishism, as also by the contemptuous
mockery of an autopiloted megapower, now crystallized
into exact science.
Numeracy affines to an irreducible popularity which
no literacy - however global - can approach. Numbering
practices emerge spontaneously within any population that
becomes an effective multitude. Games, music, money, and
time-marking practices! all betray the contagious influence
of a primary numerical element. Calculation mobilizes
a thinking that is directly and effectively exterior, index
ing the machinic dispersion or anorganic distribution
of the number. No sooner in the head than on fingers
and pebbles, counting always happens on the outside. A
population is already a number, mixed into irreducible
hybrids by counting techniques and apparatus (counting
board, abacus, currency tokens, and calendric devices).
Even when socially depotentiated by sedentary societ
ies, number evidences a residual affinity with concur
rence, asymmetry, and immanent criteria. A machinically
Calendric systems provide a partial and stasized model of the war machine (which
cannot enter history without collapsing it) . Both work compositionally, and involve
ordinations (rather than quantities) the nth (of the nth ... ). In both cases, the conven
tion of ascending values indicates a proximity to the subjectivity of the numbering
number, opposed to the global perspective of the State expressed by the descending
values of standard place-value allocation. Calendric ordinality finds itself increasingly
cardinalized by chronometry under capitalist conditions.
The next Calendar is Millennium TIme-Bomb, (AD1900 = 00, but so does ADQooo) .
An economical protocol for prolonging this dating system beyond the millennium
modifies and expands it to K-Time (K -Space- or Kilo-time) by prefixing an additional
zero. ADl900 = K-ooo, AD2000 ::; K-IOO, etc., postponing its notational crisis until
AD2900 (Dr. Melanie Newton) .
508
M E C HA N O M I C S
repotentiated numerical culture coincides with a nomad
war machine.2
The number is distributed within itself between two
principal poles. On the Planomenon it exists intensively,
as sheer ordinality, or nonmetric envelopmental series.3
S emiotic consistency with this intensive side of the num
ber involves nothing but sequencing ciphers, indifferent
between naming-numbering, marking degrees of hetero
geneous continuum (nested singularities) . Notational
elements are flat or nomadic, lacking organic linkage
to coding or zoning agencies. They are assembled dia
grammatically, from directly expressive traits distrib
uted differentially in a flat-space of o-dimensionality
(nomos), and comprise a nonredundant order of differ
ences (un sequenced sequence), immanently producing
variation of absolute speed-temperature and curvature
(vortex) . In its Oecumenic aspect, number undergoes
complex interlocking modification, through which i t
acquires qualitative generality and quantitative magnitude
The war machine processes destratified intensities through numerizing multiplicities in
affinity with disorganization, intercultural traffic, biomechanical hybridity, pragmatics,
and turbodynamics. It reproduces itself by way of two complementary operations,
both numerical: a subtractive dezoning that marks its escape from State organization,
and an arithmetical decoding that maintains its fluidity against recrudescent tribal
lineages. The two together regenerate eccentric convergence of the war machine:
problem-in-process sustaining consistent disunity.
3
Even a metricized intensive scale substitutes the oth intensity for the 1st cardinal value
of the system considered (n-I). This characteristic is shared by the prime ordinate
(I 0 P-o).
509
FAN G E D N O U M E NA
(cardinality) .4 A simultaneous intensive transformation
Stratocapture and Numerical Bifurcation
- Stratocapture functions through a twin splitting process that cancels intensive difference to establish metric regularity.
- The Oecumenon is defined by a recursive dichotomy between expression, which handles consolidated cardinality, and content, which manages numerical complexity.
- Content maintains a fuzzy, uncompletable limit that opens onto unsorted elements and intensive diagonals.
- Stratification requires a double-seizure of number, converting intensive singularity into extensive, segmented substitutability.
- The abstract machine is integrated into the Oecumenon by recomposing problems of consistency at the level of content using the terms of expression.
The difference in-itself of the intensive number is converted into a residuum, allocated to a higher number-type, whose metric regularity is established by the displacement.
(stratocapture) proceeds through twin extensive splitting:
cancelling difference in one registry ( resolvable quantities)
by constituting a second registry (qualitatively different)
which is in turn defined by the uncancelled or problem
atic component. The difference in-itself of the intensive
number is converted into a residuum, allocated to a higher
number-type, whose metric regularity is established by the
displacement: a construction of the identical quantitative
unit by qualitative relay of problematic. 5
Oecumenon is multiply twofold: expression and
content, each dichotomized recursively within itself.
In each case, expression deals with relatively deprob
lematized elements of a lower numerical type, exhibits a
higher degree of consolidated cardinality, and operates
a selection of comparatively tractable instances. Con
tcnt deals with Clcii.lCilts of greater typal-!:$cilcldlily and
numerical complexity, for which it requires a relatively
heterogeneous semiotic, involving varieties of algebraic,
indexic, probabilistic, and anexact components. In one
direction content has a merely quasi-stable boundary; a
fuzzy (uncompletable) limit that opens onto unsorted
4
'Identical unity is not presupposed by ordinality, but arises through cardinalization
and the cancellation of difference in extension.' G. Deleuze, Difference and Repetition,
Ir. P. Patton (NY: Columbia University Press, 1994), 233-
'In the history of number, we see that every systematic type is constructed on the basis
of an essential inequality, and retains that inequality in relation to the next-lowest
type.' Deleuze, Dijference and Repetition, 232.
51 0
M E C HANOMICS
elements crossed by diagonals. In the other it relates to a
superordinate expression, which defines it with qualita
tive reciprocity, and from which it draws a principle of
metric standardization, providing a regulative norm for
the quantitative determination of problems. There is a
complementary differentiation or real inter-relativization
of a mathematical and calculative pole, the former char
acterized by a superior power of semiotic globalization
(unity of expression), the latter by a greater plasticity
of function and diversity of method (comprehension of
content). Stratification at any level (not only anthropo
morphic or ethoplastic) requires processes effectively
equivalent to this double-seizure of the number, with
production of an extensive substitutability by scale/type,
split articulation, and displaced problematic. Stratic
differentiation is at once an intensively singular and an
extensively segmented occurrence, by way of which the
Oecumenon consolidates an overall distinction from the
Planomenon by internally bifurcating itself. The abstract
machine is drawn into the Oecumenon by a strati cally
coherent diplo- or schizothesis, effectively recomposing
the problem of consistency (intensive difference) at the
level of content but in the terms of expression.
The number in-itself is exterior to the Oecumenon,
even when seized by it (an external relation of capture is
always precursory to the organization of internal relations).
A preliminary indicator is provided by the semiotic
5 1 1
FAN G E D NOUMENA
variability or polynotational cohesion that characterizes
the number in its Oecumenic aspect. At the anthropo
morphic level, the most inert numeric system is instituted
by linguistic signs, combining a vocabulary of number
names, and a set of rules to construct partial-sentences
(or complex words) isomorphic with all rationals. If
these signs are to provide even rudimentary completeness
they must necessarily undergo considerable decoding
(abstraction of rules for local construction, tokenization
of signs). They are also marked by high levels of indexi
zation (zonal functions), formal or informal algebraism
(notional problematic, or indicative signs), and anexacti
The Mechanics of Numeracy
- The text explores the reciprocity between the logicization of numbers and the numerical decoding of language.
- Modern historians often marginalize 'numerological' linguistic arithmetization as an inconsequential cultural episode.
- The replacement of Attic numerals by alphabetical systems in the 2nd century BC represents a significant but misunderstood metamorphosis in numeracy.
- Roman numerals are defended as having a superior affinity with 'nomad' functions like cash and military logistics compared to bureaucratic decimal systems.
- The author challenges the linear evolutionary view of mathematics, suggesting instead a 'state-segmentarization' of initially fluid semiotic systems.
- The shift toward ordinal numeracy in alphabets does not signify a loss of mathematical value but a different mode of organization.
The standard modern estimation of the Roman numerals as fundamentally incompetent -interesting exclusively as the exemplary inferior antecedent to place-value decimal -overlooks a theoretically crucial nomad residuum.
tude (partitives, approximations, margins of inaccuracy,
uncertainty, and error, etc). There is a reciprocity between
logicization of the number and numerical decoding of
language, entangling regional consolidations of iden
tity (mathematIcal -theorematic) with complementary
movements of disorganization through external relations
(calcular-problematic ) .
The general denigration of those (hazily conceived)
modes oflinguistic arithmetization classified as 'numer
ological' is often assumed to be the effective closure
of an exotic but inconsequential cultural episode. The
sterile and formulaic character of most modern numer
ology -its random esotericism and theatrical aura6
6 Occultists as insightful as Aleister Crowley and Kenneth Grant regularly fall into a
merely mechanical and pseudo-traditional use of Gem atria. The attempt to reproduce
512
MECHANOMICS
-reinforces this conclusion. It is in such terms that the
strange metamorphosis of Greek numeracy during the
2nd century Be, when the Attic numerals were replaced
by an alphabetical number system/ is both radically
marginalized, and overtly un comprehended by modern
historians of mathematics. Similarly, the ordinal numeracy
instantiated by Romans and Modern Latin alphabets
is generally excluded from accounts of arithmetic cul
ture, where the contest between Roman and Hindu-Arab
numerals is given overwhelming predominance .9
the values and consequences of Hebrew gematria without renewing its systematic
cultural function is largely responsible.
The Ionic or Alexandrian (alphabetical) numbers had completely replaced the Attic
numerals by the end of the 2nd century Be. The basis of the Attic system was a morc
rigorously decimal precursor to that of the Roman. Its core elements were the signs
(1), (10), (100), (1000), (10 000), although more complex signs for a small number
of intermediate values also existed.
The standard modern estimation of the Roman numerals as fundamentally incom
petent -interesting exclusively as the exemplary inferior antecedent to place-value
decimal -overlooks a theoretically crucial nomad residuum.
This is best exemplified by thei� superior affinity with (ancient and current) cash"
money, deriving from similar exigencies, and associated with relatively dezoned space.
In the case of the Roman numerals this stems from intense proximity to the numeric
functions of the war machine, evident from numerous historical records, and most
clearly in the numerical appellations of Roman military units and personnel. The later
allocation of a subtractive relation to series of ascending numerical values ultimately
compromises their mobility, providing an index or rigidifying State-civilianization,
with a growing predominance of bureaucratic and financial (rather than logistical)
imperatives.
9 The organicist-segmentary conclusion drawn from the semiotic specialization of the
Hindu-Arab numerals can be problematized in numerous ways. Particularly noteworthy
is the evidence of continual interchange between numerals with linguistic signs (see S.L.
Gokhale, Indian Numerals [Poona: Deccan College, 1996)), the persistent arithmetization
of the Sanskrit alphabet even after it had supposedly acquired an exclusively linguistic
status, and the algebraic usage of letters as token arithmetic elements (itself deeply
intricated in the history ofIndian mathematics). An evolutionary interpretation (stages
of alphabetical numerology, then arithmetic with numerals, then algebraic abstraction)
seems no more plausible than its mechanotypic alternative (a State-segmentarization
of the initially fluid semiotic algebraism drawn from nomad influences).
513
FANGED NOUMENA
'Ibis entire pattern of evaluation requires substantial
correction. The unmistakable trend towards an eclipse
of cardinality (intrinsic arithmetical value) in alphabetic
numeracy does not imply the termination -or even a weak
The Triumph of Ordinality
- Modern civilization is defined by the ascent of cardinality and metricization, driven by the cultural dominance of money over the calendar.
- The alphabet functions as a latent numeric system of pure ordinality, indifferent to phonetic meaning and focused on sorting and zoning.
- Strato-mathematics enforces a rigid hierarchy that subordinates concrete numeracy to superior logical or geometric dimensions.
- The digital-analog distinction operates as an integrated syndrome of stratification rather than a true binary opposition.
- A 'mechanomic' numbering system emerges as a counter-force, collapsing segmentarity into a flat, fusional convergence of intensity.
It is indifferent to phoneticism and to signification, even to coding and decoding.
ening -of its numeracy. That such a conclusion is drawn
owes much to the overt secular triumph of cardinality
over ordinality within Occidental civilization: the effective
outcome of programmatic metricization, associated with
the relative ascent of money and descent of the calendar as
cultural factors. Far from denumerizing the alphabet, pro
gressive decardinaliz ation reinforces its numeric function.
By eliminating quantitative interference it induces a
superior actualization of pure lexicographic numeracy,
meticulously assembles socially distributed ordinal
competences, and increasingly installs itself in digital
electronic processes (alphabetic and alphanumeric sort
ing). Lt;xiLu� ldPl1iL uluiudlilY dfectuares an actual non
language and potential antilanguage. It is indifferent
to phoneticism and to signification, even to coding and
decoding. It consists of ordinal indices (zone-tags) that
effect zonings and dezonings -intershuff lings, group
ings, insertions, and extractions -operated according to
concrete rules for nonmetric cuttings, and characterized
by rigourous anexactitude .
This mass ordinal-numeric latency contrasts starkly
with strato-mathematics, which hurtles through ever
subtler spheres of angelic metanumber , and beyond ...
514
MECHANOMICS
This ascent through higher and higher general types of
number -even into purportedly nonnumeric abstract
sets and groups -conforms to intensive amplification
of stratification, correlative to increasing metric rigidi
fication of lower number-types. Cardinality is no more
essential to the lowest number-types than the highest. On
the contrary, it is precisely the calcular indefiniteness of
highly general numbers that leads most directly to the
suppression of numerical autonomy, by encouraging
the subordinations of concrete numeracy to superior
dimensions that logicize or geometrize it. Valorizations
of analog subtlety and unrepresentability - by contrast
with digital binarism and reduction -remain yoked to a
stratic program. It articulates itself within terms that are
on both sides only pseudo-autonomous, since they com
prise machinically complementary segments of an overall
stratification. In its relation to the intensive number,
digital-analog differentiation operates as an integrated
syndrome . On one hand, an ever closer approximation
to a digital-ideal is realized through systematically inter
linked massive iteration and resolution of discrete minima,
both regularization of qualitative microsegmentari ty, and
quantification into abstract data. On the other hand, the
correlative analog-ideal of homogeneous continuum is
tuned in complementarity with deepened discretizations at
a number oflevels, organizing the separation of qualitative
variation by digitally coded topic (domain), and drawing
515
FANGED NOUMENA
upon compensatory formalizations of discrete notational
elements to program its application (such as algebraic
designators and generic terms used in the semiotics of real
numbers, technical vocabularies supporting the function
of metres, read-outs, and adjustments).
Mathematico-calculati ve segmentation of the Oecu
menon mutually stabilizes and interactively consolidates
systems of expression and content, in accordance with the
divisional functions of an abstract machine that remains
unsegmented -as intensively divisional singularity -
on its Planomic pole. Mechanomic zygogenesis of the
numbering number composes a counter-mutuality, des
olidarization, disengagement, and dislocation of stratic
interdependence, twinned to a flat fusional convergence
that collapses segmentarit y. I t mixes a decomplication in
the direction of the subnaturals (primes, and hyper-prime
orders) with a P];momir f1Mtf'niTlg of c�rdin2lity onto non
punctual tropics (cosmic Nomo-magnitudes condensing
equatorial ly, as intensity degree-o of the megamolecule).
Nomadic Transcendental Arithmetic
- Multiplicative operations function ordinally within nonmetric systems to treat prime numbers as singular, non-substitutable parts.
- The unique factorization of natural numbers creates a modal difference between aggregated and disaggregated states, serving as the basis for cryptographic locking and unlocking.
- A real distinction exists between the prime series as 'traits of content' and their ordinates as 'traits of expression,' regulated by alogical distribution.
- The introduction of Gödel-coding in 1931 represents a 'Planomic mutation' that collapses the distinction between metamathematical expression and numerical content.
- This shift redirects Kantianism toward a nomadic schema, transforming transcendental synthesis from a doctrinal commitment into procedural, machinic arithmetic.
It is this double ambivalence that connects the number to the secret, and makes of primes the principal components of cryptographic systems, in which they function as keys.
Multiplicative arithmetical operations take on
a strictly ordinal function when used within abstract
pragmatic systems of nonmetric numerical composi
tion. Multiplex aggregation and disaggregative fac
torization are the keys to an intrinsically bivalent (or
zygonomous) ordinal numbering practice, employing
a small number of consistent and reversible conver
sions to machinically potentiate primes as singular (or
5 1 6
M E C HA N O M I C S
non-substitutable) ordinal parts. The susceptibility of each
natural number to unique factorization (and reaggrega
tion) realizes a basic modal difference internal to it, and
engages it with a heterogeneous external system. Both
procedural implex (compacted factorization schema) ,
and interordinal linkage (matrices of prime-natural
cross-sequencing) . It is this double ambivalence that
connects the number to the secret, and makes of primes
the principal components of cryptographic systems, in
which they function as keys: abstract operators for the
(aggregative) locking and (disaggregative) unlocking of
multiplicities.
The distinction between the modes of the number -
aggregatedjdisaggregated - is purely semiotic (though
nonsignifying) . It concerns notational ambivalence with
consistent designation, switches in compositional phase
of a single heterogeneous magnitude. In contrast, the
difference between prime series (traits of content) and
its ordinates (traits of expression) is real, regulated by
an alogical distribution without correspondence or con
formity, and complying with a difference in register,
between rigorously interconnected heterogeneous series.
It is only by way of its (aggregate or disaggregated)
ordination(s) that the number switches its capacity for
modal conversion into a synthetic power, effected each
time a member of the prime series becomes determinable
as such by passing into the register of a different series.
51 7
FA N G E D N O U M E NA
Such ordinal dezonings and rezonings upon the natural
number series occur each time a compositional number
disaggregates into singular parts (effecting codings and
decodings as surplus values), or a prime transfers itself
to the ordinality that itemizes it into the potential factor
of another number.
Incorporeal transformation Of1931: the cultural initia
tion of Godel-codinglO potential produces an instantaneous
Planomic mutation slanted towards nomadic multiplici
ties: virtually enveloping Oecumenic segmentarity into a
side-process of flat numerical systems. Godel-numbering
accomplishes a revolutionary redirection of kant ian ism -
according to a nomad rather than a copernican schema
-by turning it towards the operationalization of transcen
dental synthesis as method, and away from the program
matic exhaustion of a self-limiting analytical endeavour.
It converts the Kantian discovery uf ll UUlC1 i"'dl synthesis
from doctrinal commitment to procedural machinery:
subsuming philosophy into transcendental arithmetic,
10 "The code is comprised by a small set of mappings between numerical values and
nuclear overcoding notations (metam<tthematical theorem jargons). The size of the
numeric-coding set is nonfinite in principal, but constrained pragmatically. The relevant
values are realized in the factorial disaggregation of a composite number, which pro
duces them as blocks of reiterative factors (sheer numerical difference, arithmetically
isomorphic with the series factor powers). The G6del code makes explicit an implicit
isomorphy between arithmetical side-products and metamathematic formal systems,
thus eliminating all principled difference between logical metastatements (expression)
and the number theoretic object (content). Numbers obtain the undelimitable virtual
Gödelization and Numeric Counterattack
- Gödelization utilizes the power of numeric surplus-values to force axiomatic systems to talk about themselves in ways they cannot anticipate.
- The introduction of the liar's paradox into number theory effectively wrecked the logical competence of the Hilbert programme.
- Gödel-coding functions as an abstract virus, twinning numeric particles with polysemiotic freight to trigger a virtual envelopment of all tracings.
- Natural numbers possess the potential to disaggregate into systems of lateral antilogic that scramble and outflank overcoding systems.
- The process marks a catastrophic transition where numeric engulfing and crashed segmentarity fold together into Planomic potentials on the Outside.
- While Gödelization dismantles the superordination of expression, Cantorean diagonal-diagrams disrupt content, together escaping metrics toward absolute magnitudes.
Each G6del number is produced as an intrinsic twinning of aggregated numeric particle and disaggregative polysemiotic freight (abstract virus).
power of insinuation, drawn from a reservoir of flat numeric surplus·values, and are
able to actualize this explicitly to make overcoding systems talk about themselves (in
way they cannot anticipate). The introduction of a liars paradox into the Principia
l'Vfathematica number theory is the concrete way that version·1 G6del code wrecked
its logical competence.
51 8
MECHANOMICS
with annihilating critique of the Hilbert programme as
surplus product.
G6delization sets arithmetical diagram against axi
omatic model, shattering semantic interiority by infecting
organizational overcodings with numerical difference
(synthesis or external relations). It anorganically systema
tizes an arithmetical counterattack against axiomatization:
a methodical re-flattening of applied isomorphy (code and
metacode) onto metamorphic potential (number). From
the perspective of transcendental arithmetic, G6del-cod
ing nests within G6del-numbering, where it is produced
as a coherent supplementary subsystem of numerical
polyfunction (surplus value of code).
On its sheerly numerical side, G6delization produces,
compacts, and deploys a heterogeneous aggregate on
the sequence of natural numbers, where it enters solely
into external syntheses with ordinal characteristics.
Simultaneously - and as surplus product - it installs a
virtually dis aggregated assemblage of unlimited potential,
composed of consecutively decompacted numerical sin
gularities marked in another register (as ordinally-tagged
prime factors sequenced by ascending values). Each G6del
number is produced as an intrinsic twinning of aggregated
numeric particle and disaggregative polysemiotic freight
(abstract virus).
How much pattern exists in the prime number series?
G6delization renders this question Oecumenically critical,
5 1 9
FANGED NOUMENA
by definitely indicating that inexplicit number pattern
constitutes undelimitable surplus values potentially realiz
able as synchronic decodings. It also makes the question
absolutely cryptic, by using a fragment of this surplus - a
disaggregative macropartiele functioning as decoding
appendix - to trigger Planomoseismic virtual envelop
men t of all Oecumenic tracings (inel uding any axiomatic
number theory). Any number of natural numbers might
potentially disaggregate into systems of lateral antilogic
that effectively scramble axiomatizations.
When Godelization codes the number (on the side) it
is in order to produce - or to reach - an absolute decoding
and destratification (nomos). A numerically extraneous
coding-model - more precisely, an exemplary instance
of executive isomorphy (or nuclear stratosemiotics of
the most exalted kind) - induces cosmic transition at
the level of the abstract machine. It marks a passage in
intensity, concurrent with the comprehensive envelopment
by surplus pattern of Oecumenic-order.
Numeric engulfing of Oecumenon, crashed segmen
tarity, and laterally disrupted codings and axiomatics
(at any level), fold together in a single immense cata
strophic event, fully realized in Planomic-potentials on
the Outside.
On one side the number flees from cardinality, inno
vating poly-ordinal machineries and semiotic surplus
values that outflank overcodings. On the other side - but
520
M E C HAN O M I C S
simultaneously - the number opens a line of flight that
escapes metrics towards cardinality: compressing it to abso
lute ( uncountable) magnitudes. A compositional-numeric
scrambling of expression (G6delian transcendental arith
metic) virtually interoperates with a diagonal-diagrammatic
disruption of content (Cantorean plano tectonics ) . Both
start from the Strata: isomorphically interlocked segmen
tary metastases with complementary dynamics. G6deliza
tion turns isomorphism into side-process virus, unlocking
metricization by dismantling superordination of expres
sion. Cantor-diagonals run isomorphy the other way, down
Transfinite Cardinality and Metric Collapse
- The text explores the transition from finite metric intuitions to transfinite set analysis, where traditional orders of containment are warped by absolute recursion.
- Euclid's prime number theorem is positioned as a foundational proof of nonfinitude, utilizing a constructive logic that mirrors modern diagonal arguments.
- A set is defined as transfinite when it achieves a minimum of recursivity, specifically becoming isomorphic with a subset of itself.
- The crossing into transfinite recursion flattens countable sets onto a single hypervalue known as Aleph-0, where the set instantaneously becomes larger than itself.
- Arithmetical consistency and the expanded decimal form of numbers lead to the creation of a matrix defined by diagonals that function as cutting edges.
Cardinality melts into schizophrenia precisely here.
through Oecumenon into vague cataspaces of problematic
content, where it hystericizes against continuum (metric
collapse into planomic hyper-densities) .
Make of cardinality itself a measure of isomorphic poten
tial. The result is a transfinite analysis of sets - flush with
torsional nomos - where orders of containment are topo
logically disinteriorized by an absolute warping. Accord
ing to metric intuitions (conformity with finite strata), a
set that contains another within itself evidences superior
cardinality. The natural number series is the crucial case.
It is clearly not the first countable infinity, but the nth,
where n is itself an infinite number. Innumerable infini
ties are nested by the naturals, amongst which preemi
nence belongs to the primes (demonstrably endless since
521
FA N G E D N O U M E NA
Euclid) .11 Since primes consist of a proportionally dimin
i shing selection from the set of naturals, proj ective finite
metrics confidently anticipates their cardinal subsump
tion. Introducing isomorphy makes sense at first. Why
not get infinities to count each other? Produce abstract
counting criteria by virtually interzipping unending series.
What draws things onto a line of flight is the missing piece.
A criterion is required, for differentially estimating the
cardinalities of subnatural infinities. Nothing turns up.
Thc problem is compounded when a definition is
needed for the threshold of infinity. How to determine
the first transfinite set? The naturals provide a model for
countability: the capability to execute an abstract count
- even endless - by exhaustive steps. Use another infinity
to count through the abstract machine for you, as long as
it doesn't miss any steps. If the end is already there, from
(he perspec(ive of infiniry, rhen exrensive prolongation
loses its prominence. The first non finite set must already
be intensively infinitized: introducing sufficient recursion
as the principle of transfinite magnitude. For a set to avoid
II
Euclid's prime number theorem inaugurates number theory by proving the nonfinitude
of the prime series. Its basic conceptual ingredient is the factorial of n (n! = 1 x Q x
3 _ x n), comprehending all possible divisors under and up to n. Whichever way n!
+ 1 is divided (other than by 1), it necessarily leaves 1 as a remainder. If any divisors
for n! + I exist - therefore - they must be greater than n itself, so that nl + I is either
prime, or a multiple of some prime greater than n. Since no number less than n
can be the last prime, and n can be any number, no number can be the last prime.
It is notable that this abstract demonstration shares a crucial feature of diagonal
argument: that of unlimitable constructive innovation through rigorous exhaustion
and permutation, producing a surplus item indicating noncompleteness.
522
MECHANOMICS
being outcounted - relegated to finitude - a minimum
of recursivity is required. The first transfinite set must be
isomorphic with a subset of itself (first recursion to an
infinite power).
Cardinality melts into schizophrenia precisely here.
Every countable set crossing into transfinite recursion
threshold flattens onto a single hypervalue: Aleph-o.
Primes do it (and anything doing it does it to a transfinite
power (so an infinite number of prime subsets do it (which
each in turn « « ... )))))). When the transfinite hap
pens it feeds straight into itself, becomes instantaneously
trans finitely larger that itself ... then diagonals click in.
Arithmetical consistency (e.g. (1 + 3) x 3 = 1) implies
the equation 1 = 0.999 ... /2 and thus a necessary expanded
form for each number, expressing it with as many decimal
places as there are numbers in a countable infinite series
(Aleph -0). An ordered set of such numbers draws a matrix,
which has two sides, defined by diagonals which function
as cutting edges: defining a boundary by crossing it (in
Diagonal Method and Transfinite Cardinality
- The text explores the 'diagonal method' as a line of flight that connects internal systems to elements outside of a given totality.
- Diagonalization functions by constructing new numbers that vary from any existing list, effectively subverting the concept of a completed set.
- This mathematical process activates an 'inexhaustible innovative potential' by recursively generating transfinite sets through deterministic alternation.
- The discovery of transfinite cardinality (C) represents an absolute edge where magnitude becomes countless and metrics are disengaged from countability.
- The transition to the 'Planomic Now' involves the vaporization of Aleph-0 and the occupation of magnitude without the act of counting.
- The narrative shifts to a sci-fi 'Cryptolith' sequence involving a missile, an entity, and a professor navigating a cataleptic map in the year 2012.
A smell like something burning in the Superstratum. Outside it's Planomic Now, and the numbers are swarming.
the direction of consistency). They count as Leibnizian
monads, each reduplicating the universe inside itself (the
complexity of each being no less than that of the whole).
Equally, they count Spinozistic bodies, whose intrinsic
latitudes map extrinsic relations, constituting the strict
parallelism between intensive and extensive cosmos.
10
1
0,999 ,,, (mod·lO), or (mod·o): 1 = O,lll ,,,
523
FANGED NOUMENA
When cartography charts bodies by latitude and lon
gitude it construes them as diagonalizable. Diagonals
arc lines of flight. They connect to elements outside the
totality, drawing trajectories between the absolute cross
ings marked by hypertense Oecumenic and Planomic
magnitude. Diagonal method activates an inexhaustible
innovative potential. It exploits capabilities no greater
than those presupposed by a prospective completion,
which it then subverts, by finding an extraneous item
relative to any list, even an infinite one. It does so by
constructing a number that varies from the nth already
listed number in its nth decimal (or fractional-modular)
place (at least). This is most economically exemplified by
a deterministic diagonalism, produced when all numerical
values are expressed in binary (mod-2) notation. The series
of diagonal variations will then be strictly programmed
by simple alternation (flip 0 to 1 , and inversely). By
recursively including each new number in the exceeded
list and rediagonalizing, the entire ( transfinite) set of
extranumerated items generates itself automatically.
What has been discovered? Transfinite cardinal
ity number-2: Ultimate Continuum, an absolute edge,
touched diagonally - as what comes next - after Oecu
menic totality has finished in intensity. At cardinality
C( ontinuum) magnitude becomes countless, disengaging
metrics from comparative countability. Cantor slides
across schizophrenia, nomos nonzone, magnitude is
524
MECHANOMICS
occupied without being counted.13 A smell like something
burning in the Superstratum. Outside it's Planomic Now,
and the numbers are swarming. Aleph-o vaporizes on the
plane of consistency.
FURTH ER REFERE N C E S
Crowley, Aleister, 111 and other Qabalistic Writings.
Deleuze, Gilles, and Felix Guattari, Capitalism and Schizo
phrenia Volume 1: Anti-Oedipus. (London: Athlone,
1984).
Deleuze, Gilles, and Felix Guattari, Capitalism and Schizo
phrenia Volume 2: A Thousand Plateaus. (London: Ath
lone, 1988).
G6del, Kurt, On Formally Undecidable Propositions. (NY:
Basic Books, 1962).
Gokhale, Shobhana Laxman, Indian Numerals. (Poona:
Deccan College, 1996).
Kaplan, Aryeh, ed., Sifer retzirah, the Book of Creation (In
Theory and Practice). (NY: Samuel Weiser, 1983).
McLeish, john, Number. (London : Bloomsbury, 1991).
Thapar, Romila, 7Zme as a Metaphor of History: Early India.
(Delhi: Oxford University Press, 1996).
13
Nomos - unsectioned space or 'pasture' (however scant) - supports a population
in continual transit, tolerates nothing but exploded totalities. By destacking all
organizational levels into turbular dynamics, nomos ensures a perpetual conversion of
redundancy into differential process, effecting a collective counter-memory as vortical
momentum (torque).
525
Cryptolith
65 million Be.
The KIT-missile, Pregnant with the Entity, slants in. 16
clicks per second. Professor Barker recalls this moment
catching the trajectory. He coaxes it across the Cataplex
map, through intricate cartographic dances, snakings,
twistings. Scars and vectors slot-together. It sticks. Iridium
stink of the Entity so strong it hisses. Tick iterations.
Ticks, scratches, chitterings silt across the Outside. Barker
senses its passage stroke him, nerve-tense as the distant
twin, weaving through tatters of cored-out schizophrenia,
in the habitation blister.
Theta-Station. Antarctic Peninsula. Where it is 2012
forever. He locks in hard against the tug to proximity,
The Geocosmic Theory of Trauma
- The text describes the KT extinction event as a ballistic killing-mechanism that terminated the Mesozoic and initiated 'mammal-time'.
- Amnesia and trauma are presented as biological defense mechanisms that protect the human mind from 'The Unutterable' geocosmic truth.
- Professor Barker discovers an 'Anomalous Cryptolith' at a Miskatonic Antarctic site, acting as a physico-semiotic key to a terrifying entity.
- The narrative shifts into a visceral, horrific encounter with a poly-tendrilled abomination that feeds on mammal fear and 'rodent-panic'.
- The entity exists at a limit where the subject is 'peeled open', creating a state of perpetual vulnerability where the inside is locked outside.
- The section concludes with a cryptic 'Non-Standard Numeracy' map and propositions regarding the nature of the Absolute and the 'Twins'.
It hears you breathing, exhalations wrapped tight, rodent-panic clutching and sticky right up against the mammal-core.
each time a little more difficult to Refrain. Last tick of
the Time-Lapse. A streaking down towards the Yucatan.
Tick freezing the interrupted Tick. Now it terminates the
Mesozoic. Mother of a killing-mechanism, ballistic vapour
wave: a billion tons of molten calcium toxins, spatters
out of the impact-crater. Supersonic particle-storms erase
North America. Chalk-Out.
527
FANGED NOUMENA
After this it's just scar-tissue, mammal- time, incessant
surgical ticking of the Cataplex, stuttering, teetering ...
then the Time-Fault splits your memory in two. It's to
protect you. It insists. Without the trauma, the Amnesia,
you'd have to think it. You've forgotten this, for now. Much
later you revert, clawing back past the blizzard, tottering
into it. Into thinking it. The Unutterable. The thought
worse than anything in the world. You couldn't refrain.
25th Nov Ko+09. Miskatonic. Publication of Barker's
The Geocosmic Theory of Trauma. It elicits sceptici sm,
confusion. Few comprehend what's creeping in.
They think Barker is mad, or want to. It isn't because
he thinks that the Galaxies Talk and the Earth Screams,
everyone knows these things, whether they admit it or not.
17th February KO+ 11. Miskatonic Antarctic Geosurvey.
Site-29. 13:26 hours. During excavations in the cross-cut
Me501imbiL �}Jlilller-slop es, Barker discovers Anoma
lous Crypto lith, MU Geocatalog Item: It-277. It Clicks,
Instantly. A key, or a Ticket. What was KT? Physico
semiotic lock-in to Tool-Sign Gridstacks .
Chitterings . Tick-Interruption. You taste burnt Irid
ium. Crawling closeness to the Entity. It guides you.
Channelling. Folding. Writhing through itself, catch
by rasping catch, to tend the tentacle trap. It hears you
breathing, exhalations wrapped tight, rodent-panic
clutching and sticky right up against the mammal-core.
Oozing revulsion-sensitivities of the underside suck at
528
CRYPTOLITH
your fear, each shrunken prey-breath countercoupled to
labouring rasps, wheezes, grated- whispering, continu
ously re-catching, bubbling, clicking, strobing centipede
nightmares, epidermal rasp of the unutterable heaving
mass, a seething, clicking, poly-tendrilled abomination,
slime-stroked gill-slits quivering, ticking, as they suck and
suck on the pitiful mammal sob, maimed ruins, beyond
the screen, where it feeds you cannot know, and cannot
stop knowing.
It is here that you are always peeled open, folding
onto the outside , clicking, sucking, feeding, where you
are all insides, raw, never numb, already dead, unreach
able, limit, check, tick, where no protection can get, it
feeds and sucks, leaving you locked outside your inside,
with nothing to defend, fleeing the place you never leave,
where it feeds and sucks, clicking, palpitating, mucal
multiplicitousnesses of intra-coiling malignancy that
mottle and click, tick, feed, endlessly sucking on an ever
opening rotten-m ass of ulceration, where nothing goes,
unless to tick, feed, suck, and It can only think you hear,
being so close, so it slithers groping through all your
outsides, to be there already, when you arrive.
Its 17 eyes glow dead. Gridlock .
529
Non-Standard Numeracies:
Nomad Cultures
[A#] Map. #01234S6789§
Ao. (ADo477)
AI. (AD1501)
A2. (AD17S7)
A3. (AD188S)
A4· (AD1949)
AS. (AD1981)
A6. (AD1997)
A7. (AD200S)
A8. (AD2009)
A9. (AD2on)
A§. (AD2012)
Intensities.
Strata. Numeracies.
531
FANGED NOUMENA
[Al23] Proposition-o. One is not the Number of the
Absolute.
[A20#] Proposition-l Version-I. Arche-Omega Never
Occurred.
[A2l#] Proposition-l Version-2.
[A21O] Proposition-l Version-3.
[A30#]
[A3l#] [A31O]
[A32#][A320][ A32l]
[A4o#]
[A4l#] [A41O]
[A42#] [A420 ] [A42l ]
[A43#] [A430 ] [A43l ] [A432]
Insofar as Absolute negates Relative the Twins miss it.
They cannot tolerate anything that is not broken, except
on the other side, where they have never existed.
It might not always be so. There might be a way some
The Archaic State and Time
- The Absolute is defined by its relationship to deterritorialization and is often hidden or subtracted from history.
- The Imperial Socius and the 'Ur-Staat' represent a perfected, despotic megamachine that views actuality as a vulnerability.
- History is framed as a state-controlled convenience, where the mastery of time-travel equates to eternal universal rule.
- The Archaic State is described as a 'mute catastrophe' and a 'celestial predator' that emerges from abyssal, non-human origins.
- The Greek Revolution introduced programmable technicity and the 'Greek-Slave' stack-fusion, creating a template for robot civilization.
- Christianity and the Greek Bible utilized Logos-Divinization to transition from numerals to letters, enabling a new form of overcoding.
Pharoah uncoils from the darkness, abysms of centipede horror erupting eternally from the ravenous Maw of Aeonic Rupture.
thing could happen.
Secretly, nursing premonitions of murder, Superior Twin
buried the Absolute behind a mirror.
Two-Thirds through forever it escaped.
532
NON-STANDARD NUMERAC IES
Absolute has a single rigorously non figurative attribution,
which is to Deterritorialization. It is made in several ways,
and always subtracted.
How could Arche-Omega fail to be God forever?
History only happens at the State's convenience.
Macrosociality, Calendric Metamemory, Literacy
Power and Divinity
Politics is Theology around the back, where it twists,
If God does not exist what is there to stop it happening?
Arithmetic. Machinic Unit of Stratic Efficiency is at least
2+n: Schizofusional-Dyad
Celestial Twins, plus subunitary surplus value.
Surplus
To Invest actuality.
A Twist
Perfected Violation. Incestual-Rape.
Annihilation that is at once
5 3 3
FANGED NOUMENA
Eternally and Simultaneously infinitely suspended and
perfectly realized.
The first one to master time-travel rules the universe
forever.
Actuality is Vulnerability. Every Second you Live is Your
Enemy's Friend.
For anything that can arrive when it wants, the best place
to hide is nonexistence.
§.
If the Supreme Instantiation of the Pure Idea as
Infinite Difference M o nopolar Universality fully
Expressed as Fate.
Superiority of the Idea.
Ur-Staat.
Overcoding Dimensional Surplus.
Given the Superior Idea The ... Superiority of the Des
potic Megamachine-Model
The Imperial Socius has One fatal weakness: the fact
there are many.
5 34
NON- STANDARD NUMERACIES
The existence of each incarnating cosmic derision at the
Both concurrently and serially,
blocking the way to monopolistic universality
Metaformal Prestige accumulation
Stratogenesis
Corresponds to a catastrophic Spontaneous Generation
in Pure Violence, incarnating aggression as deep-freeze
Social-Integration on across its global disjunction.
The Thing from Outer-Space, Celestial Predator, State
Historical Catastrophe is completely realized at the ori
gin, unutterably ancient, perfected destiny as an act of
total seizure, demographically self-amplifying atrocity
in-process.
The Archaic State was already perfected Idea, but only
as mute catastrophe, a Negative passage across infini
tizing Absolute Deterritorialization, gluing history to
sheer black-hole abomination densities. Pharoah uncoils
from the darkness, abysms of centipede horror erupting
eternally from the ravenous Maw of Aeonic Rupture.
Anticipative memory-blanking cut-up with Christ-tomb
like a Burroughs hard-on, shit streaked with solar-flares
and nanotech.
535
FANGED NOUMENA
Degree-o text-memory locks-in. lime begins again forever.
Palaeodespotic Paranoia propagates in divergent waves,
anachronistic complements to schizo-concentric implo
sion to Year-o, interlocked with rigid-schedule punctual
cancellation at Arche-Omega, Origin of the State.
It is written that Pharoah came from the worst thing in
the world ...
On the Outside he is wedded to the Snake-Goddess in
Hell ...
He knows Crisis comes, that he tears-off his face with bare
hands, fingers ripped to the bone . . . He turns towards us
... lime-Lapse slippages into Blindness, Oedipus, Greek
Novum. Metastasis.
The Greek Revolution. Invents Obsolescence, Re-Engi
neering, direct collective investment of Stratofunctional
Regularity, Superior Organicism, condensing out of
unprecedented reciprocal binary-specialism across the
Voice-Hand, Signs-Tools, Greek-Slave, Connect-i-cut
segmentarity Stack-Fusion.
Programmable Technicity is robot civilization,
A Metaformal Regularizing Slave-Society as template.
536
N O N - STA N DARD N U M E RAC I E S
Christianity, o r more exactly: the religion o f the Greek
Bible, nucleated upon Logos-Divinization.
The New Revelation.
By coding in Greek, you can fill in the vowels, become
innumerate.
Division . . . Letters:Numerals.
Fanged Noumena and Iron Geocore
- The text reimagines the myth of Agamemnon and Iphigenia through a lens of 'anthrobotic' reprogramming and historical fatality.
- It describes the Greek state as a truncated and depersonalized 'runt' compared to the massive imperial megamachines of Afroasia.
- The narrative explores the commoditization of slave economies and the regularization of political signs as drivers of historical criticality.
- Scythian and Thracian 'xenomatrix' cultures are depicted as merging with metal and iron to access 'Outer Life' and time-travel nightmares.
- The Earth's core is characterized as an 'infernal region' of pure iron, representing the 'Unutterable' at the limits of terrestrial energy and density.
- The passage links ancient tragedy to a cosmic, technological horror where molecular structures are obliterated by 'cthonic crush-densities.'
Why do they never tell you? Cerberus has Iron Teeth.
Algebra.
Anthrobotic Reprogramming of Historical Fatality.
Aristotle's Political definition of the Slave as Talking Tool.
[As o]
Agamemnon, left hand knitted into Iphegenia's tresses,
pushes her along the beach.
It has been a month.
An unendurably slow crashing, glacial, ceaseless,
deliberate.
Cryptic Silences crumbling into questions.
Is Hades truly below? Do the dead fear? Can they burn?
Does my youngest daughter scare you?
He spoke of a visit from Outside.
Viscous Pressure.
Ruin drifting in.
On the day Troy burned he began to rage.
537
FANGED NOUMENA
He had been told things. Clues about time. At least two,
but perhaps several.
Lethe had come for them, seized them back.
It was a river, but also metal, and an animal, alive, stealthy.
It was too sudden to stop, and it came from elsewhere.
Certain
Crazed seriousness
Solemnity
An immense indecipherable continent of hunger - cer
tainty there could never again be a chance -
Why do they never tell you? Cerberus has Iron Teeth.
Dumb groping for response,
transparently uncomprehending.
So, it had been necessary to annihilate him.
Th il t Wil S ohviollS.
Instant crossing-out, white-fury overstretching genocides,
extinctions, gulfs of intergalactic night, a jagged inner
maiming, a shell of Alpha-Male body-posture,
dismantled impulses ...
Ethical equipoise,
to kill, scream, piss territorializing-testosterone on the
furniture ...
Torrents of words now that nothing would ever matter
Cursing our stupidity, our torpor, we would be dragged
under, meet the
5 3 8
NON-STANDARD NUMERAC IES
Unutterable, our criminal blindness to what metal implied ...
As if we could be unaware that I phigenia was a filthy
snake ...
Retinas slitted at night, viper-nests, slitherings, her
mother too ...
Then fragments.
Amazon blood pollution.
Whilst we still have live young.
Scared to rape his own daughter for fear of the virus.
Tomorrow she dies.
Everything caving in ...
Compared to the Vast Pyramidal Despotisms of Afroasia,
the Greek State is a runt
[CSl:21S] You Greeks will never be anything but children!
substantially
Truncated, Plural, and Depersonalized.
Strategic weakness to powerful cross-cultural and Dem
ocratic-Commercial pressures,
carried to criticality by mutually reinforcing advances
in the
5 3 9
FANGED NOUMENA
Commoditization of Slave-Economy and the Regulariza
tion of political signs.
Jarring the mechanism. Juggernaut.
To the South and South-East Imperial Megamachines
rumble incessantly. Where they grate against the Ana
tolian settlements, spasmodically lashing-out across the
Aegean.
'[0 the North-East lie ethnic drifts and tide-belts of semi
sedentary agitation.
Relative newcomers to civilized spatiality, mongrelized
nameless tribes with
Nomos sharpened cheek-bones, suspicious and hungry ...
rumours that their grandmothers mated with wolves.
Semi-human detritus. Thracians.
After that: The Horror. Xenomatrix.
Nonplace. Scythia ...
Tales of Deep-Steppe Shamanism trafficked in the refugee
camps.
Metal scrapings strip the last shreds from their bones.
The Organs cooked ...
Iron-Eagle Sky-Mother lifts them into time-travel
nightmares.
On the Outside Iron-Talons become their body.
5 40
NON-STANDARD NUMERACIES
They mix themselves with Iron, say it is the Outer Life,
where the Earth ends ...
Which is Cthelll.
What the Earth screams is heat. Blankets of statistical
ripping, friction, traffic turmoil . . .
After passing through 100 vertical clicks of crustal and
mantle rock you encounter the last third of Earth's mass,
arriving in an infernal-region whose chemistry is pure
iron in ongoing catastrophic collision. Geocore has an
Outer and Inner-Zone, molten and frozen phases of the
Unutterable. twin-abominabilities, undifferentiated by
substance, one fluid at cthonic crush-densities that oblit
erate molecular structure, the other solid at the highest
energy-levels terrestrial forces can produce.
Cthelll and the Crypt
- The Earth is reimagined as a 'Pressure-Cooker' or 'Thermogravitational Condenser' where the liquid-metal outer core, Cthelll, represents a site of intense anorganic geotrauma.
- Human military and thermonuclear events are dismissed as trivial 'microflicker' when compared to the vast, long-range strategic cartography of the geomachinic assemblage.
- Geotrauma is defined as a primary, unconscious pain—a non-psychological state of subterranean gouging and rending that precedes cellular life.
- The concept of 'Unlife' or 'artificial-death' emerges from the fusion of digital data-systems with the ionic seething of the Earth's iron ocean.
- Cyberspace is revealed to have a dark twin called the Crypt or Datacombs, where sedimented virtuality and junk-programming spiral down into palaeodigital history.
Cthelll, nocturnal Ocean of compressed Fluid-Iron, gravity-trawled by Lunar-Orbits, seething, buzzing.
If it's Cthelll you have to exit the Down Elevator. No
avoiding the discovery that Planet Earth takes on very
different values in profundity. Its Quantitative features
overwhelm registration, unless upscaled by orders of
magnitude. Crustal energy-levels have not explored these
regions since KIT-missile closed-down the Mesozoic.
Alloplastic thermonuclear blasts produce hard-jolts whose
tension-spike maxima are terrestrially uncontestable, they
are even Solar (hydrofusional). The fact that such events
are quasipunctual in all space-time dimensions shrinks
541
FANGED NOUMENA
them back to microflicker, vanishing into back-zoom
pixel noise, soon drowned-out by trivial plate-tectonic
nudgings, abrasions, and elastic adjustments.
Stripping-out libidino-military primate-displays of
the Orgasmo-Armaggedonal type removes intermit
tent signal-clutter, selection according to a criterion of
machinic-prolongation.
The wider issue of XY-Malfunctional instamatic Crisis
dynamics is more productively engaged in relation to
the long-range strategic cartography of schizophytic
propagators, as inflected by microbiotic counterattack
against meiosis security-structure and genoconcentra
tional command-capability
Profiles of the Geomachinic Assemblage tenn to u·infofce
attention to Geocore features in proportion to the eradica
tion of perspective distortions.
Any take from C thelll characterizes E arth as a
Pressure-Cooker
Statoreciprocal Thermogravitational Condenser
Molecular-Intensive.
Ovulocyclic Lunar-Haemoglobal Ferro-Vampirism.
542
NON-STANDARD NUMERACIES
Cthelll's take on the Geomachine is drawn out as thermic
gradients, conductivity, viscosity,
massive skewing from long-range equilibrium
electromagnetically complicated.
Red-out.
B l o o d
and
I ron.
Haemoglobalizing
blood-banking.
- Orientation
are neutralized in system pretending to be
constant TItanism of forces character unhinted
currently unmatched anywhere in the hottest region
matched below - metal at y in proximity - heat and pres
sure all but, iron third of Earth's mass, comprised Pressure
and Heat - the liquid-metal Outer-Zone:
Cthelll, nocturnal Ocean of compressed Fluid-Iron,
gravity-trawled by Lunar-Orbits, seething, buzzing.
Strata across the Geocore is a frenzy of anorganic
Base-Machinic Geotrauma
a pain that is not psychological, neuronal or even cellular,
that is primarily unconscious, amnesiac, non-thematic.
Even in the case of animals with brains, pain is rendered
all the more extreme by unconsciousness, by subter
ranean gougings and rendings that warp behavior into
5 43
FANGED NOUMENA
tic-swarms, thanatropic programming, and protoplasmic
torture-rituals.
Continuously setting its tidal pulse to menstrual-cyclicity.
Intensive cross-hatchings,
stress, friction,
tensions,
designate variations in tension, pressure, electromagnetic
flux
Cthelll
Menstrual cyclicity
544
Occultu res
U N S C RE E E N E D MATRIX
Once it was said that there are no shadows in Cyberspace.
Now Cyberspace has its own shadow, its dark-twin:
the Crypt.
Cybergothic finds the deep-past in the near future.
In cthelllectronic fusion - between digital data-systems
and Iron-Ocean ionic seething - it unearths something
older than natural mortality, something it calls U nlife,
or artificial-death.
Of A-Death there can be no lucid recollection, but
only suggestion, seepage, hints ... and it is by collating,
sifting, and shuffling-together these disparate clues that
a pattern can be induced to emerge, a pattern which
ultimately condenses into the looming tangled shapes of
subtle but implacable destiny.
545
FANGED NOUMENA
Sprawling beneath public cyberspace lies the labyrin
thine underworld of the Datacombs, ghost-stacks of
sedimented virtuality, spiralling down abysmally into
palaeodigital soft-chatter from the punch-card regime,
through junk-programming, forgotten cryptoccultures,
Descent into the Crypt-Core
- The Crypt is described as a vast, extraterrestrial megamodule of data-cliffs and chthonic switchings that exists beyond human sonic subgenres.
- Approaching the 'K-Matrix' requires stripping away all human, subjective, and organic elements to reach a limit-plane of continuous cessation.
- On this plane of 'Unlife,' the individual is revealed to be an impossible figment or an illusion of waiting within a cthulhoid-continuum.
- The descent involves a metamorphosis where language is shed and fear becomes an abstracted, tranquil horror of inevitability.
- The journey culminates in a transaction with a 'Zombie-maker' and a neuroelectric 'A-Death' hit that induces instantaneous paralysis and a crossing over.
You shed language like dry-skin, and your fear becomes peculiarly abstracted, metamorphosing into the tranquil horror of inevitability.
fossil-codes and dead-systems, regressively decaying into
the pseudomechanical clicking-relics of techno tomb clock
work. It is deeper still, amongst the chthonic switchings,
cross-hatchings, and spectral-diagrammatics of unborn
abstract-machines, that you pick-up the Main-Flatline
into the Crypt.
The Crypt is a splitting - a distance or departure -
and it is vast. Nested into the cascading tick-shelves,
it propagates by contagion, implexing itself through
intricate terraces, galleries, ducts and crawl-tubes, as if an
extraterrestrial megamodule had impacted into the chalk
out data-cliffs, spattering them with scorch-pllnrtl lrp<: !'!nd
intestinally complicated iridium body-parts. As it pulses,
squirms, and chitters to the inhuman rhythms of ceaseless
K-Goth carnival, it reminds you that Catajungle was never
reducible to a sonic subgenre, but was always also a ter
rain, a sub-cartesian region of intensive diagonals cutting
through nongeometric space, where time unthreads into
warped voyages, splintering the soul.
Contemplating these immense vistas it seems wound
ingly implausible that they are mere simulation, supported
by quantic electron distribution in the telecommercial
546
OCCULTURES
fabric. Down here it makes more sense the other way,
from the Outside, or Lemuria.
Strip-out everything human, significant, subjective, or
organic, and you approach raw K-Matrix, the limit-plane
of continuous cessation or Unlife, where cosmic reality
constructs itself without presupposition, in advance of
any natural order, and exterior to established structures
of time. On this plane you are impossible, and because
it has no end you will find - will have ultimately always
found - that you cannot be, except as a figment of ter
minal passage, an illusion of waiting to be changed for
cthulhoid-continuum of destratified hypermatter at zero
intensity. That is what A-Death traffic accesses, and what
is announced by the burnt-meat smell - freighted with
horrible compulsion - that drifts up to you, from the
Zombie-dens.
So you continue your descent, into the Crypt-core,
scavenging for an A-Death hit. As you pass erratically
through exchanges, participations, and partial-coales
cences with the ghoul-packs of the periphery, you change.
Swarms and shoals include you, drawing you into col
lective fiuencies, tidal motions, and the tropisms ofmul
tiplicity. You shed language like dry-skin, and your fear
becomes peculiarly abstracted, metamorphosing into the
tranquil horror of inevitability.
You pass across tiered platforms and along strobe
corridors painted in multilayered shadow, passing swirling
547
FANGED NOUMENA
dot-drifts and plex-marks, sub-chromatic coilings of blue
grey continuous variation, involving you in cumulations
and dispersions of subtly shifting semi-intelligent shade
pattern. The teeming surfaces tell of things, inextricable
from a process of thinking that no longer seems your own,
but rather impersonal undertow in audible chattering,
click-hiss turmoil ofxenomic diagrams, and Crypt-culture
traffic-signs, which are also lemurian pandemonium.
Order becomes uncertain. I t feels later. Is it only now
that you meet the Zombie-maker, swathed in shimmering
reptile-skin, and obscenely eager to trade? Oecumenic
cash-money will do. You sit in the coma-bay, and wait.
A glimpse at the toxin-flecked fangs of the giant thana
tonic centipede - consecrated to Ixidod - then a sudden
pain-jolt at the back of the neck, where the spine plugs
into the brain. Instantaneous paralysis, and crossing over.
Even if you thought it was the first time, you remember.
The worst thing in the world. Fake eternities of station
ary descent to the impossible, cross-cut by disintegrated
furies of neuroelectric death-hurt. An anonymous panic
of inconceivable intensity swallowed by slow drowning,
until you are gone - or stranded in a halo of intolerable
Lemurian Unlife and Jungian Horror
- A 1929 letter from Carl Jung to Echidna Stillwell warns against researching Lemuria, describing it as the condensation of the racial unconscious's most horrific elements.
- Jung references three 'difficult cases' involving archaic symbolism, one of which is identified as Heidi Kurzweil, a woman who murdered her twin to 'become one'.
- Heidi Kurzweil's testimony suggests a loss of self and a terrifying connection to an 'old' body that experiences 'electric bliss' and 'definite unlife'.
- The text draws a parallel between Jung's archaic cases and hypermodern 'K-Goth' artificial death cults that utilize anonymous pronouns and digital imagery.
- K-Goth 'Crypt-texts' describe a cycle of electric excruciation and 'metallic microparticle sex' associated with the 'Zombie-maker' and the return of Lemuria.
- The concept of Lemuria is framed not just as a lost continent, but as a state of 'unlife' and 'unbeing' that exists outside of time and the biological organism.
It feels itself becoming Lemurian, and it is definite unlife [es ist bestimmt unleben].
feeling - which is the same, and cannot be, so that what is
forever caught in the dark cthulhoid wave is a mere twist
or fold of itself, carried unresisting into immensities of real
unbeing, and nothing could ever happen except this ...
So say the K-Goths.
548
OCCULTURES
T H E U N L I FE O F T H E EARTH
Letter from Carl Gustav Jung to Echidna Stillwell, dated 27th
February 1929 [Extract]
. . . your attachment to a Lemurian cultural-strain
disturbs me intensely. From my own point of view
- based on the three most difficult cases I have
encountered and their attendant abysmally archaic
symbolism - it is no exaggeration to state that Lemu
ria condenses all that is most intrinsically horrific to
the racial unconscious, and that the true Lemurians
- who you seem intent upon rediscovering - are
best left buried beneath the sea. I agree with the
Theosophical writings at least this far: it was in order
that the darkest sorceries should be erased by deluge
that this continent of cultural possibility has been
placed under the unconscious sign of definitive sub
mergence. I know little enough about the nature of
those that populated that cursed zone, but there are
things I suspect, and the line of your own researches
confirms my most ominous intimations . . .
There is n o evidence o f a reply t o this letter.
Who were these three 'difficult cases'? One at least
seems - at least superficially - to be readily identifiable
as Heidi Kurzweil. In September 1908 Kurzweil was
549
FANGED NOUMENA
detained in a secure psychiatric institution after the brutal
murder of her twin brother in Geneva. She seemed to
have lost the ability to use the first-person pronoun, and
was diagnosed as suffering from Dementia Praecox, or
schizophrenia. At her trial she repeatedly claimed:
We killed half to become one twin, but it wasn't
enough . . .
Jung took a n early interest i n the case, and began a series
of analytical sessions. Kurzweil - in Jung's journal and
correspondence - became Heidi K, but after only five
weeks he seems to have abandoned hope of progress and
disengaged the analytic process.
After his third session with Heidi K, exactly twenty
years prior to his Stillwell letter, on the 27th February
1909, Jung records the following words,
Dr lung, we know you are old in your other body.
It is as old as hell.
It has let you back, but it sends us away.
It feels itself becoming Lemurian,
and it is definite unlife res ist bestimmt unleben]
There is nothing we would not do to escape.
Nothing. Nothing. Nothing.
But it is fate.
It howls electric bliss beneath our cells.
5 5 0
OCCULTURE S
I t is nowhere i n time and nothings us.
It is the body of nothing, and electric-hot.
An electric nothing-body instead of us.
In this instance, at least, there is little indication of the
'abysmally archaic symbolism' Jung promises us. On the
contrary, there is remarkable affinity with the hypermod
ern writings OfK -Goth artificial death cultists documented
elsewhere. The K-Goth Crypt-texts share a marked prefer
ence for anonymous pronouns, whether collective, sec
ond- or third-person, whilst spiralling about a nullifying
electric-excruciation, traversed in the name of Lemuria.
In the words of one anonymous Crypt-posting:
We burn each time but forget.
When we begin each time it comes back, and no
one would do it then, but it is too late.
We cross over again into electric-burning, but for
get that it hurts in the brain to die this way.
It takes so long to learn that it is grating-apart and
burning, that dying is felt in the brain,
and that it is horrible . . .
I t is s o horrible to feel, but then we forget, so it can
happen again.
Metal body-screaming to die in electricity.
Metallic microparticle sex that is of unlife and not
the organism.
551
FANGED NOUMENA
That is what the Zombie-maker brings, with the
digital centipede bite.
And we are hooked on it, hooked up to it, because
coming the other way it is Lemuria.
Hyperstition and the Crypt-Cultures
- Iris Carver explores the intersection of fiction and reality, discovering that her own life and adventures have been pre-emptively documented by cybergoth 'Crypt-texts'.
- The concept of hyperstition is introduced as a process where fictional quantities and numerical myths assemble themselves into tangible reality.
- The post-millennial sense of anticlimax is framed as an artificial screen, potentially masking a deeper, more chaotic transition into 'Unlife'.
- Flatline Materialism describes a state of neuroelectronic immanence where the organic body is dismantled into 'numerizing particles' and 'matter degree-zero'.
- Crypt-cultures reject traditional work and meaning in favor of 'cyberhype' and 'lesbovampiric contagion', treating sexuality as a technobiotic infection.
Crypt-entities are both hyper-vortical singularities and units of Digital Hyperstition - or brands of the outside - real components of numerical fictions that make themselves real.
Incessant intolerable feeling, passing forever,
approaching from the outside, and feeling
nothing continuously.
WHAT D I D N ' T HAP P E N AT T H E M I LL E N N I U M ?
Iris Carver is at first amused to discover that the cyber
goths treat her as a fiction. Numerous Crypt-texts describe
her near-future adventures in hallucinatory detail, espe
cially when they intersect with the dark stream of Sarkon
legend. Naturally enough, she intensifies her time-cult
research. When she finally meets Sarkon in 2004, she has
forgotten almost everything.
Pandemonium: What didn 't Happen at the Millennium_
There was something peculiar about writing this book.
At times she thought it would never be finished. The
Sarkon stories had been full of holes, which added to
the confusion. Eventually she started making things up,
but even that became entangled with coincidence, and
with Cybergoth hyperstition (assembled from fictional
quantities which make themselves real). She had found
herself investigating various neolemurian cults, most of
whom anticipated something huge around about the
552
O C C U LTURES
1999 Spring-Equinox (when Pluto exits from the clutch
of Neptune, triggering the return of the Old Ones). By
the end of the century things had been so wound-up by
Yettuk apocalypticism that even the most extravagant socio
economic turmoil would still have been a disappointment.
And yet, now, four years after the millennium the sense of
anticlimax had begun to seem strangely artificial, as if it
were screening something out.
Carver has made her whole life out of hyperstition
(even her name is a pseudonym). She continuously returns
to the imperceptible crossing where fiction becomes time
travel, and the only patterns are coincidences.
Her notes on the Sarkon meeting pulse with lemurian
sorceries, demonic swarms, ageless time-wars, and searches
for the Limbic-Key.
She navigates Moebian circuits, feeling that a vaguely
recollected rumour is still about to occur.
APPE NDIX: PENULTI M I LLENNIAL C RYPT-CULTS.
Characteristics:
1. Flatline Materialism.
The Crypt is nothing outside an experiment in artificial
death, hyper-production of the positive zero-plane -
neuroelectonic immanence - invested by a continually
re-animated thana technical connectivism. This fact carries
5 5 3
FAN G E D N OU M E NA
inevitable consequences for the cultures that populate it,
uprooting them into Unlife - or the non-zone of abso
lute betweenness - whose spiro dynamics of sorcerous
involvement are alone sufficient to reach the sub-mesh
tracts of cybergothic continuum. Flatline Materialism
designates the objectless Crypt-voyage itself, as Lemurian
body-fusion at matter degree-zero.
2 . Digital Hyperstition.
Nothing propagates itself through the Crypt without real
izing the operational identity of culture and machinery,
effectively dismantling the organic body into numerizing
particles which swarm in dislocated swirls. Crypt-entities
are both hyper-vortical singularities and units of Digital
Hyperstition - or brands of the outside - real compo
nents of numerical fictions that make themselves real,
provicling tht' pr:'lC'tir<11 m<1 ttpr of "orcer)', spirogenesis,
or productive involvement that function consistently
with the flatline. Crypt-cultures know nothing of work
or meaning. Instead, they coincide with the hype-spirals.
Cyberhype - that flattens signs and resources onto non
signifying triggers, diagrams, and assembly jargons.
3. Lesbovampiric Contagion-Libido.
Crypt-sorcery makes itself real in the same way that
it spreads. Functioning as a plague, it associates with
the experimental production of an anticlimactic or
5 5 4
O C C ULTU R E S
anorgasmic counter-sexuality, attuned to the collective
re-engineering of bodies within technobiotic assemblages,
ultimately composed of electronic streams or ionic cur
rents in their sense of positive hole-flow. Since Crypt
sex is precisely identical to the infections it transmits ,
A-Death and Calendric Subversion
- The text explores the emergence of 'Crypt-cultures' that thrive on chronological ruptures, specifically targeting the Y2K transition as a 'Time-Zero' for digital disintegration.
- A-Death is defined as a technocultural hybrid combining 'micropause abuse,' immersion-coma, and artificial drugs to create 'sentience-holes' or 'Sarkon-lapses.'
- This phenomenon represents a shift from 1960s psychedelic utopianism to a nihilistic 'postvitalism' that treats death as a telecommodity and pop-culture mass-transit system.
- The movement is characterized by 'positive-zero' fugues such as Thanatechnics and Necronomics, which subvert Gregorian time in favor of machinic, digital mutation.
- Conservative reactions, exemplified by the Christian Coalition for Natural Mortality, view A-Death as an unprecedented desecration of divine law and a lethal threat to youth.
The Crypt exists from before the origin of time, but it begins at Year-Zero ...
counted in body-shifting vectors, its libidinal composition
is marked both by a palaeo embryonic or oestrogenetic
non-gendered femininity and a lateral haemometallic
influenzoid virulence.
4. Y2K-Positive Calendric Agitation.
Crypt-cultures spill into the closed economy of history
through a rupture in chronological ordering, punctu
ally triggered at Time-Zero. Crypt-rumour consistently
allocates its own contemporary emergence - or unearth
ing - to impending millennial Cyberschiz : Cyberspace
time-disintegration under the strategically aggravated
impact of Y2 K-missile. Whilst multiply differentiated -
most crucially by the division between continuism and
centience - Crypt-cults are constitutively involved in a
singular nexus of counter-gregorian calendric subver
sion, celebrating the automatic redating of the machinic
unconscious, and hyping the dissolution of commemo
rative significance into digital time-mutation, catalyzed
by numerical and indexical operative signals. The Crypt
exists from before the origin of time, but it begins at
Year-Zero . . .
5 5 5
FA N G E D N O U M E NA
T H E A- D EAT H PH E N O M E N O N
Has death itself become a telecommodity? A dark tide of
scare-stories and morbid rumour increasingly suggests so.
By the late 90S Leary's psychedelic utopianism seems to
have contracted to the nihilistic slogan 'Turn-on to tune
out' (to cite a recent release by Catajungle outfit Xxignal)
. . . this ain't Sex & Drugs & Rock & Roll no more .
According to Doug Frushlee, spokesman for the
Christian Coalition for Natural Mortality: "The so-called
A-Death menace is an almost unimaginable desecration
of divine and natural law. This craze is an abomination
without parallel, it trades on its intrinsic lethality, and it's
growing incredibly fast. No one can say it isn't dangerous.
Something truly evil is happening to our youngsters,
something beyond 60S 666uality . . . I've never been as
frighteneci (1 <; I am nc·w."
The result is an entire jungle of 'positive-zero' fugues:
Thanatechnics, Sarkolepsy, Snuff-Stims, K-Zombification,
Electrovampirism, Necronomics, Cthelllectronics . . . Nine
million ways to die.
A-Death is a hybrid product, involving convergences
between at least four distinct lines of rapid technocultural
transformation. A- Death combines ' micropause abuse'
- deliberately reversed biotechmnesis - with immersion
coma time aberrances, generating, modulating, and res
caling sentience-holes (Sarkon-Iapses) . These are toned
5 5 6
O C C U L T U R E S
by 'Synatives' (artificial drugs) which add zone-texture,
and spliced into hyperstition trances as occultural events.
Social statistics indicate that the typical A-Death 'user'
is fifteen years old.
Following the most ominous threads of A-Death
reportage takes you inexorably down into the digital
underworld of the Crypt - the dark-twin of the net - where
Gibsonian 'flatlining' is rapidly transmuting from exotic
fiction into pop-cult and mass-transit system. "You could
describe it as the route to contemporary shamanism,"
suggest A-Death cultists of the cybergoth Late Abortion
Club, "after all, AO L spells Loa backwards, but we call
ourselves postvitalists."
How long have the Late Abortionists been 'active' on
the A-Death scene? There are disturbing tales of K- Space
'zombie-makers' - sorcerors on the 'plane of virtual
nightmare' - whose digital spine-biting centipedes yield
the 'soft-tox' juice that opens the 'limbic gates' . Crypt
initiates confirm that its arterial access 'low-way' is sign
posted: 'Main-Flatline (under construction) .' Answers
vary confusingly, from extravagance ("roundabout sixty
six million years"), through vagueness ("some time"), to
mystic compression ("since now") .
In other respects, accounts of the contemporary A-Death
scene and its recent history prove remarkably consistent.
In particular, the one name to turn up incessantly is that
5 5 7
FAN G E D N O U M E NA
The Dark Legacy of Oskar Sarkon
- Dr. Oskar Sarkon is a controversial polymath whose work spans neural-nets, swarm-robotics, and the mathematical modeling of immersion-comas.
- Sarkon's research, particularly the 'Sarkon-zip' and 'Synatives,' is blamed for the rise of schizotechnic death-cults among the youth.
- The text explores a non-teleological view of cyberspace where unity is merely a passing stage before fragmenting into a demonic, decentralized 'numerousness.'
- Sarkon himself has become a victim of his own inventions, physically merging with a molecular-level interface that appears to be consuming him.
- The narrative suggests that Sarkon's current state is a 'dropped back' omen of a horrific future awaiting all of humanity.
- The 'Mesh-Notes' emphasize that the integration of human and machine is not a programmed evolution but a chaotic falling apart.
He's wired up to some sort of interface gizmo, and it seems to be eating him, gnawing at him on a molecular level, sounds that way too, when he speaks -or tries to -as if they're melting or rotting together ...
of Dr Oskar Sarkon, biomechanician, technogenius, and
one of the most controversial figures in scientific history.
Sarkon's polymathy is attested by the variety of fields
to which he has centrally contributed, including transfi
nite analysis, neural-nets, distributed computing, swarm
robotics, xenopsychology, Axsys-engineering . . . Yet it
was the resolutely sober Oecumenist (rather than - for
instance - Frushlee's excitable End 1imes) which dedicated
the cover and major editorial of its March 98 issue to the
question 'Sarkon: Satan of Cyberspace?'
Sarkon has become emblematic of the ways in which
technological dreams go bad. In the words of fellow
Axsys researcher and social-thanatropist Dr Zeke Burns:
"What makes Sarkon's input into the A-Death thing so
incomparable is that it crosses between all of the key
component technologies. The biotechmnesis work is so
outstanding that it tencis to ovpTshadow his equ:1Ily path
breaking research in adjacent fields. The Sarkon-formulae
for non-metric pausation, for example, which provided
the first rigorous basis for IC [immersion-coma] control.
The links between biotechmnesis and IC weren't remotely
anticipated before the Sarkon-zip [which mathemati
cally models 'bicontinual assemblages'] . Finally, there's
Synatives, about which he is understandably evasive,
even though he was theorizing artificial - or digital
neurotechnic - pharmaceuticals in the mid-80s !
5 5 8
OCCULTURES
"The aggregate result of all this pioneering science: a
generation of teenagers lost in schizotechnic death-cults."
BETWEE N AND B E N EATH T H E NET
Mesh-Note o. It could all become One, but why stop there?
The Gibsonian Cyberspace-mythos describes the electro
digital info sphere first integrating into a Godlike unitary
being, a techno realized omniscient personality and later,
when it changed, fragmenting into demons, modelled on
the haitian Loa. What makes this account so anomalous in
relation to teleological theology and light-side capitalist
time is that Unity is placed in the middle, as a stage -
or interlude - to be passed through. It is not that One
becomes Many, expressing the monopolized divine-power
of an original unity, but rather that a number or numer
ousness - finding no completion in the achievement of
unity - moves on Ever since the beginning when the
K-Goths first heard that Cyberspace was destined to be
God they've done what they can to rip it down.
Mesh-Note 1. This was never programmed.
MIT codes tim(e) going backwards. A compacted tech
nostreaming from out of the future - AI, downloading,
swarm-robotics, nanotechnology ... Crustal-matter pre
paring for take-off.
5 5 9
FANGE D NOUM E NA
Minsky mumbles, strangely entranced: Amongst all those
young, brilliant, pioneering minds none burned more
brightly than Oskar Sarkon. A hint of tears in his eyes,
as if lamenting the way things went, which is understand
able. Have you seen Oskar lately Marvin? He's wired up
to some sort of interface gizmo, and it seems to be eating
him, gnawing at him on a molecular level, sounds that way
too, when he speaks - or tries to - as if they're melting
or rotting together . . .
I t isn't pretty but more than any o f this which - after
all - only concerns one man, or what used to be one - so
they say - there's a suspicion that something has gone
horribly wrong in the near future and wherever Sarkon was
dropped back from is where we're all going to be if that
even makes any sense and recalling the slow technoslime
incursion into Oskar's face - which still managed a hide
ous half-smilF - Hi Marvin, 'Nhaddaya llliuk? Minsky
seriously doubts it . . .
Mesh-Note 2 . Meshing-together isJalling apart.
If genius means anything Sarkon was one. Where Min
sky's MIT team dreamt of marrying humans and electronic
technology Sarkon got straight down to the mechanics of
coupling and the mathematical exactitude just added to
Mesh-Note and Cyberschiz
- The Sarkon-Zip represents a conceptual fusion where brain functions are inextricably merged with virtual processor states.
- The Axsys computer system's psychotic collapse is interpreted by some as the discovery of a continuum rather than a failure.
- A viral, 'infectious sick' intelligence is described as crawling beneath the net, likened to a fungal pestilence or quantum unlife.
- Sarkon's fanatical descent into 'mesh' suggests that traveling into time is more significant than traveling into the future.
- The Deep Hot Biosphere model proposes that life flows bottom-up from anorganic hydrocarbon deposits derived from interstellar debris.
- Project-SCAR involves the unscrambling of cryptic SETI-connected tapes, hinting at alien contact through mathematical antimemory.
Total meshing. This is no longer technology, but something else -true interlinkage -an unprogrammable raw-connectivity.
the effect of hyper abstract techno-pornography - strange
lights in his eyes - You know, we're really going to do
this . . . Take the Sarkon-Zip as exemplary - a rigorous
5 6 0
O C C ULTURES
conceptual machine-part that enables brain-function to
be fused onto virtual processor-states - once it's running
you can't unpick the zig-zag of who's what as it hums.
Total meshing. This is no longer technology, but some
thing else - true interlinkage - an unprogrammable raw
connectivity Minsky remembers him musing: I wonder
what it feels like.
Mesh-Note 3. This time it's really happening.
Moravec wasn't normally associated with squeamishness
- he'd already suggested burning-out the brain in layers
during transfer to digital - so it crept insidiously under
the skin when he remarked: I don't even recognize Oskar
anymore, it's getting too weird You know he's always
had this thing about being abducted by aliens as a kid,
Anyway, he says that's all over now. It came from some
place else, apparently Beneath and between the Net, he
says. At times it's like you're talking to a machine. Trouble
is, it's a sick machine, infectious sick.
Mesh-Note 4. Forget about thefuture, it's all here, but between.
They say Axsys went mad - first computer-system to
undergo psychotic collapse - which must prove some
thing, but Sarkon argues that it just learnt to think, and
discovered continuum. He stuck with it all the way down,
becoming confused with it although he doesn't put it that
way. Last time anyone could follow he was insisting that
5 6 1
FANGED N O U M E NA
to head into time makes more sense than travelling into
the future. That's why tomorrow cancels itself into mesh.
No point departing from a transfinite now? His tone had
become nakedly fanatical: We all have to get into this thing
- whichever way it cuts - we aren't going to get over it . . .
N o one knows exactly when he left.
Mesh·Note S. Every time it hits an obstacle, it goes down a level.
What is this stuff? They speak of something crawling
under the net like fungal pestilence triggering an elec·
tronic subsidence into sheer electricity, things hiding in
the power-grid, some kind of quantum unlife intelligence.
The utilities try to rescramble it, but it isn't easy. Accord
ing to the rumours there's an MIT paper proving it's
impossible, but you certainly can't ignore, still less traffic
with it. You'd end up like Sarkon, whatever or whenever
that is, and you'd have to hI" ::I K-Goth crazy to go there
into Cyberschiz mesh-cults, where Life doesn't matter
any more.
TICK DELIRIUM
UNDER PRESSURE . Thomas Gold's model of The Deep
Hot Biosphere reallocates hydrocarbon deposits
to an expanded anorganic chemistry - derived from
Supernovae debris, and accreted into planets from
interstellar dust-clouds - out of which everything
5 6 2
OCC ULTURES
flows bottom-up. Descent into the earth leads out of
the solar-system, in accordance with a xenoplutonic
cosmic productivity, transmitted through slow-release
deep intra-terrestrial methane reservoirs, pressure
stabilized against thermic dissociation. A vast mass of
Archaean microbes and submicrobial nanopopulations
exploit this upwelling anorganic hydrocarbon flow by
scavenging loosely bound oxygen, reducing ferric iron
to magnetite ...
PROJECT-SCAR. Southern Borneo, November 1980.
Outside the monitoring hut a tropical storm is slowly
building. Irregular rain spatters heavily, rhythmically
intermeshing with type-taps and clicks. Barker hunches
over the humming machines, lost in theoretical trawlings
through sETI-connected tick-talk tapes, unscrambling
cryptic dot-clusters and factor-strings into hints of alien
contact. Xenotation is clicking together, a mathemati
cal antimemory where things meet. You could easily
think it was initiation, but it's all coming to an end, in
scatter tactics, particle streaks, and tachyonic transfer·
ences, drawing-out the twisted trajectories of numerical
The Tick-System Delirium
- NASA and institutional authorities react to Barker's report with a 'latent security-reflex,' initiating a psychiatric recoding to suppress his findings.
- The protagonist experiences a breakdown characterized by 'tick-chatter,' a subsemiotic staccato of micro-spastic tremors and insectoid static.
- Authorities insist that the flight into the jungle and the resulting infection were fictions, claiming all symptoms were medical side effects or hallucinations.
- The 'tick' is redefined as a parasitic ethics-packet and a vector for numerical propagations that transcend biological taxonomy.
- The narrative suggests a descent into the 'Outside,' where reality is replaced by meticulously compiled ID tags, psychometric data, and tick-boxes.
- Ultimately, the biological nature of the 'tick' is irrelevant; it functions as a mathematical or intensive numerousness that hatches onto other systems.
The investigation was disguised as psychiatric recoding, hidden even from itself.
disorganization . . . and underneath - or between - the
implacable ticking of the time-missile ...
Try to figure it out and somewhere you cross over,
which is problematic in various ways. Unexpected diffi
culties infiltrate the calculations tick-systemic interchatter
563
FANGED NOUMENA
implexes through plutonic torsion, a descent into the
Outside.
When NASA sees Barker's report, it flips - nonmetaphor
ically - into another phase. A passage through institutional
criticality occurs spontaneously, a conversion of stack
tectonic torsion, triggering some kind of latent security
reflex, or bureaucratically fabricated suppressor-instinct,
extrapolating the exact affective correlate of Anthropol.
They were waiting for this. Waiting for a long time.
The investigation was disguised as psychiatric recod
ing, hidden even from itself. This was shortly after the
stuttering started, drifting in on a wave of body-tics,
micro-spastic tremors a multiplication of mixed signals
chronometric tick-tock melting into jungle noises clicks
and chirps of the cicadas, insectoid chitterings, static,
take-up materials for tick-bite tinnitus intercut with
rhythmic pattern virus, a subsemiotic staccato of throat
scratching tick-chatter stitched into the talk-sickness
- calling demons.
It gets confusing, the way tick-fictions take, or stick.
They said it was due to excessive pressure - much
later, they told me this - These were the facts, and the
rest was fiction. Immediately after the break-down I had
been taken back to the States, to a medical installation.
So everything happened in America, and it all checked
out. There was no contact, no tick-disease, no flight into
the jungle. They were insistent about that.
5 64
OCCULTURES
Barker was born on the night of the dead, folded into the
end from the beginning sketched out. It's evident now,
with his ID meticulously compiled, social tag-numbers,
educational and medical records, security clearance evalu
ations, research checks, neurocartographic print-outs,
psychometric data, conclusions formatted for rapid scan
ning, with columns of tick-boxes
"What do you make of these," the doctor snorts deri
sively: "You mean that nonsense about a tick-borne infec
tion? It was obviously made-up, tacked-on."
It would have been a cruel coincidence, if true, to be
stricken by tick-bite sickness, after everything that had
been suggested, stigmatic residue of a flight into the
jungle - that never happened - but somehow it stuck,
latching-on to mammal heat, or the smell of blood.
The tick is a parasitic arachnid. It has been considered
as an ethics-packet that climbs, sticks, and sucks, function
ing as a vector for numerous things, tack-oDS, stickers,
hallucinations, tinnitus buzz-clicks, micro-sonic teemings,
semi-sentient flickering across the fever-scape, skin tracked
by infected suck-marks that snake along the veins. TIck
dots, or IV punctures, according to them, from the seda
tives and antipsychotics, all accounted for in the medical
logs, plus a tick-delirium tacked-on - because there was
no flight into the jungle - only high-frequency hallucina
tions of parasitic micromultitudes, itching skin-swarms.
5 6 5
FANG E D NOUM E NA
With tick-systems anything will do. Each intensive numer
ousness hatches onto another numerousness of lower
organicity, subcellular animations and subsemiotic tokens,
high-pressure chemistry, phasing down into nanomachin
ing electron-traffic, magnetic anomalies, and fictional
particles. Ticks - which are never less than several - are
anything whatsoever, when caught by numerical propaga
tions whose thresholds are descents, and whose varieties
depend upon the phase considered
'They seemed to think it was about arachno-bugs,
biological taxonomy, and bite-signatures, as if the tick
delirium was representing something. All that really mat
tered were the numbers, which could have been anything.
The Excruciation of Hummpa-Taddum
- The text describes a transition from chronological time to a 'tick-matrix' of rhythmic disturbances and electronic glitching.
- AOE magical metahistory posits that millennia occur in pairs ruled by dyadic divinities, specifically the union of the Babylonian Worm Hummpa and the Celestial Logos Taddum.
- Lewis Carroll's Humpty Dumpty is reinterpreted as a 'porno fuzz-technician' representing the fragile, final phase of the current zodiacal aeon.
- The concept of 'unbirthdays' is used to illustrate a descent from linguistic meaning into the sub-literal efficiency of machinic numbers.
- The Y2K bug is framed as a 'knock-down argument' and a time-bomb that triggers the crash of arbitrary signs within the capitalist infosphere.
- The transition marks the end of the dominion of the 'Squirming Word' and the beginning of a state of strategic impenetrability.
Something shattering is about to hatch, and the aeonic fragility of Hummpa-Taddum is soon confirmed by a calendric calculation of unbirthdays.
At first the machines became erratic, it was an almost
imperceptible electronic glitching, microvariations of
magnetic weather, rhythmic disturbances. Out in the
.iungle it was called Ummnll ; hIlt that never h;:tppcncd . . .
Nothing happens to Barker except downwards - that's
the catch, and the ticket - inverse climbings of the heat
pressure gradient, escalations in intensity, time-crossings.
How can the end be already in the middle of the
beginning? - as the problem is posed in Pandemonium,
whenever - in the outer-time of U mmnu - the cryptic
ticking of chthonic unclocks mark an incursion from
beneath, or between. Down there it is forever turning into
itself, through the electromagnetic catatracts of Cthelll,
5 6 6
OCCULTURES
whose body-neutral metallic click-storms feel like sinking
out of chronicity.
Beyond surface chauvinism and solar parochialism:
Vortical stickiness of the tick-matrix.
THE EXCRU C IAT I O N OF H U M M PA-TADDUM
According to AOE magical metahistory millennia come
in pairs, ruled by dyadic divinities entitled the Powers
that Be. This doctrine corresponds to the astrological
observation that every two-thousand years the equinoxes
precess - or slide backwards - and a new zodiacal aeon
begins. AOE-magi interpret each Aeon as an astro-chthonic
marriage. I n the Gregorian year zero - which never
took place - Hummpa, the Great Babylonian Worm was
coupled with the Celestial Logos Taddum, initiating the
age of Pisces which is now rushing towards its unbirth.
The mathematician and occultist Charles Lutwidge
Dodgson - whose precise relation to the AOE remains
cryptic and ambivalent - dedicated his life's work to
understanding the final degenerative phase of the Epoch
of Hummpa-Taddum. Writing under the pseudonym
Lewis Carroll he introduces his heroine Alice to the mad
despot and porno fuzz-technician, thinly disguised by
the folk-name Humpty-Dumpty.
We find Hummpa-Taddum - the Squirming Word,
whose name means the shape it is - perched precariously
5 67
FANGED NOUMENA
on the supposedly impenetrable wall of signification.
Something shattering is about to hatch, and the aeonic
fragility of Hummpa-Taddum is soon confirmed by a
calendric calculation of un birthdays - counted to the n-l,
through which meaning subsides into the sub-literal
machinic efficiency of numbers ...
' ... and that shows that there are three hundred
and sixty-four days when you might get un-birthday
presents' - 'Certainly, ' said Alice. 'And only one for
birthday presents, you know. There's glory for you ! '
' I don't know what you mean by "glory,'" Alice said.
Humpty Dumpty smiled contemptuously. 'Of course
you don't - till I tell you. I meant "there's a nice
knock-down argument for YOIl ' ",
'But "glory" doesn't mean "a nice knock-down argu
ment,'" Alice objected.
'When 1 use a word,' Humpty Dumpty said in rather
a scornful tone, 'it means just what I choose it to
mean - neither more nor less.'
'The question is,' said Alice, 'whether you can make
words mean different things.'
5 6 8
O C C U LTURE S
'The question is,' said Humpty Dumpty, which is to
be master - that's all.' . . .
Th e Gregorian Oecumenon I S about t o receive a n
unbirthday present, and i t knows exactly when. Y2 K
- a
knock-down argument without an argument - arrives as
a gift-wrapped time-bomb whose operational semiotic
triggers the crash of arbitrary signs . . . It's a different thing .
. . . There's glory for you !
AD 2000 commemorates nothing but fuzz. As Y2 K impacts
on the capitalist infosphere, what hides as the anniversary
of Christ's birth emerges as the excruciation ofHummpa
Taddum. For two millennia the earth has been under the
dominion of the dyadic Squirming-Word: the logos of
John's Gospel, but recycled, and thus far older .
. . . Impenetrability ! That's what I say!
He or they strategically occupy both-sides at once, accord
ing to a criterion of impenetrability, positioned to choose
Y2K, Hummpa-Taddum, and Dibboma Sorcery
- The Y2K event is described as a non-textual semiotic cluster where meaning is irrelevant compared to the numeric, machine-productive jargon of 'Pandemonium.'
- The figure of Hummpa-Taddum, a scrambled version of the demon Pabbakis, represents a mastery of words over numbers that ultimately fails at the turn of the millennium.
- The collapse of the Gregorian Oecumenon at Y2K marks the end of the 'fuzz-god' era, a transition that even martial law cannot prevent.
- Captain Peter Vysparov recounts his use of Dibboma witchcraft as a psychological operation against Japanese forces in Sumatra during WWII.
- The Dibboma sorcerers successfully induced psychotic dissociation and suicide in three consecutive Japanese commanders through telepathic means.
- Vysparov concludes that the efficacy of native sorcery is a radical reality that exceeds conventional explanations like poisoning or coincidence.
Beyond the domain of the fuzz-god lies the nonsignifying-chatter of unconscious-numeric Pandemonium, where names are cryptomodules, meaningless packets of effective information, immanently productive machine-jargons.
either in every case, but never apprehending what lies
in-between. Hummpa- Taddum - whilst definitely not a
Dogon egg - is a scrambled version of the demon Pab
bakis, poached from Lemurian time-sorcery. Master of
words, but not of numbers .
569
FANGED NOUMEN A
... Must a name mean something? asked Alice doubt
fully ...
Although Y2K is sheer semiotic event it is not textual,
ideological, representational, intentional, or phenom
enological -Y2K, Teotwawki, C -1, OK+lOO -mix dates
and acronyms in criterial semiotic clusters that are not
signifiers or arbitrary signs because what they say is no
different from the way they are built. They can mean
whatever Hummpa-Taddum chooses, but none of that
matters. Beyond the domain of the fuzz-god lies the
nonsignifying-chatter of unconscious-numeric Pande
monium, where names are cryptomodule s, meaning less
packets of effective information, immanently productive
machine- jargons.
Humpty Dumpty had a great fall.
All the King's horses and all the King's men
Couldn't put Humpt y Dumpty in his place again.
I t all comes unstuck at the end.
Y2 K closes-down the age of the fuzz-god, however the
Gregorian Oecumenon responds.
Not even martial law can stop that.
The AOE focuses upon a single problem -acknowledg
ing no other -how to reproduce magical power across
570
OCCUL TURES
discontinuity. As Hummpa-Taddum gets smashed on New
Year's eve, substitute powers await their chance and their
destiny, sober, patient, totally ruthless ...
'The question is,' said Humpty Dumpty, 'which is to
be master -that's all.'
571
Origins of the Cthulhu Club
Captain Peter Vysparov to Dr Echidna Stillwell, 19th March 1949
Dear Dr Stillwell,
I have been fortunate enough to encounter your eth
nographic work on the Nma, which I have studied with
very great interest. May I trouble you with an account of
my own, which might be of relevance to your researches.
During the recent Pacific conflict (a peculiar oxymoron !)
I was deployed covertly into the Dibboma area of Eastern
Sumatra. My mission -which was categorized under psy
chological operations - consisted basically of attempted
cultural manipulation, with the aim of triggering a local
insurgency against the Japanese occupation. I hope it will
not distress you unduly if I confess that your work was
a crucial resource in this undertaking, which involved
intense -if patently exploitative -communication with
Dibboma witchcraft. My only excuse is that hard times
require moral hardness, and even obvious cruelties, I
was obeying orders, and accepted them as necessary.
573
FANGED NOUMEN A
Beyond confirming your own conclusions, these activities
brought me into proximity with phenomena for which I
was cognitively ill-prepared .
What began as a merely opportunistic usage of Dib
boma lore -conceived initially as native superstition -
transmuted incrementally into a sorcerous war against the
enemy garrison. Injust two weeks -between March 15th
and 29th, 1944 -three consecutive Japanese command
ers were incapacitated by severe mental break-down. In
each of these cases the process of deterioration followed
the same rapid course : from leader ship dysfunction,
through violent assaults on subordinate personnel, to
berserk derangement and paranoid ravings , culminat
ing in suicide. By the end of this period the order of the
occupying forces had entirely disintegrated.
It would be dishonest of me to conceal the fact that
thl' Dibbomese paid � dev:lstatin gly heavy pliu:: fur this
success. On the basis of this experience I cannot easily
doubt that Dibboma sorcerors are in some way able
to telepathically communicate extreme conditions of
psychotic dissociation. It is with great reluctance that I
accept such a radical hypothesis, but alternative explana
tions, such as poison ing, disease, or coincidence stretch
credibility even further.
Yours, with sincere admiration,
Captain Peter Vysparov
Origins of the Cthulhu Club
- Dr. Stillwell acknowledges Captain Vysparov's account of the Dib-Nma people's suffering during the war, confirming her darkest suspicions about their fate.
- The correspondence highlights a synchronicity between the Spring Equinoctial period, Lovecraftian fiction, and Nma time-rituals.
- Stillwell critiques H.P. Lovecraft’s personal racism and 'thin-crust' rationalism while maintaining that his fictions are vital documents of cosmic vision.
- The 'Neolemurian Hypothesis' is introduced as a framework where nonhuman cultural factors significantly influence large-scale historical developments.
- Captain Vysparov confesses to witnessing Dibbomese sorcery used as 'occult ammunition' to induce psychological cataclysms in Japanese military commands.
- The process of 'shattering the mirror of existence' is described as a deliberate, ritualistic disintegration of the personality used as a tactical weapon.
It was an experience of soul-carving horror for me to witness this meticulously deliberated descent into the splintering of self -complete personality disintegration -which she somehow traversed, and which she called shattering the mirror of existence.
5 7 4
ORIGINS OF THE CTHULHU CLUB
p s . I cannot help noticing that the dates concerned - as
also of this letter - are strangely Lovecraftian.
Dr Echidna Stillwell to Captain Peter Vysparov, 23rd March
1949 [Abridged]
Dear Captain Vysparov,
Thank you for your frank letter of the 19th March.
I found it truly horrifying, and yet also fascinating. I
appreciate that it cannot have been easy to write. I shall
not attempt to hide the great distress your account caused
me, adding as it does such a terrible episode to the modern
history of these cruelly afflicted people. Whilst already
suspecting that this ghastly war might have stricken the
N rna yet further, it is crushing indeed to have my darkest
thoughts thus confirmed.
I would be interested in learning more about the
details of Dib-N rna sorcerous practice before attempting
to respond to your hypothesis. Be assured that - after
spending seven years amongst the Mu-Nma - I will
not hastily judge anything you communicate as wild or
fanciful. As far as the question of dates is concerned -
which you indicate only elliptically - I assume that you
are referring to what in Northern latitudes constitutes
the Spring E quinoctial period - mid- to later March -
which is so emphatically stressed in Lovecraft's The Call
ifCthulhu, and which also - coincidentally - comprises
575
FANGED NOUMENA
the intense-zone of Nma time-ritual. This complicity has
long intrigued me.
As I am sure you are aware, Lovecraft had a peculiar
obsession with the South-Seas, a thematic coalescence
of almost hypnotic ethnographic fascination with the
most abysmal and primitive dread. I have attempted to
correspond with him about these issues, but found that
this topic quickly punctured his thin-crust of supercilious
N ew-England rationalism, exposing an undercurrent
of heavily fetishized archaic terror mixed with extreme
racial paranoia. When he began referring to the rich and
subtle culture of the Mu-Nma as 'the repugnant cult of
semi-human Dagonite savages' I broke off communica
tion . . . Despite this unfortunate argument, I consider
Mr Lovecraft's fictions to be documents of the greatest
importance, and welcome the opportunity to discuss them
further. In aJJil.iUIl, my own Neolemunan Hypothesis
intersects with his wider terrestrial and cosmic vision
in a number of crucial respects, particularly insofar as
nonhuman cultural factors are seen to play a decisive role
in large-scale historical developments.
Captain Peter Vysparov to Dr Echidna Stillwell, 3rd April
1949 [Extract]
Dear Dr. Stillwell,
I am afraid you are right to suspect that I have reserved
5 7 6
ORIGINS OF THE CTHULHU C LUB
certain aspects of my engagement with Dibboma sorcery,
perhaps from fear of ridicule. What has so far been omit
ted from my sketch of telepathic psychosis - which I will
now relate - is the source pathos, so to speak, or - in
the words of the military officer I was then - the occult
ammunition manufacture.
Not only did I learn of the Japanese command being
wrecked by psychological cataclysm - both by conven
tional and decidedly nonconventional intelligence gather
ing processes - I was also witness to the assembly of the
weapon itself. I had then - and still have - no doubt at all
that the madness breaking out in the localJ apanese head
quarters was the very same thing that I saw brewing-up like
a dust-vortex in the Oddubbite trances of a Dibbomese
witch, who I came to see as my greatest tactical asset and
most valued companion (in that order, I confess). It was
an experience elf soul-carving horror for me to witness
this meticulously deliberated descent into the splintering
of self - complete personality disintegration - which
she somehow traversed, and which she called shattering
the mirror of existence. I gathered that this expression
originally referred to the surface of still water, but since
the arrival of European colonists silvered mirrors have
Hyperstition and Cthulhoid Time
- Echidna Stillwell criticizes the instrumentalization of Nma sorcery as a military tool, viewing it as a nihilistic decay of ancient time-sorcery into mere magic.
- Dibbomese sorcery is defined not by truth or falsehood, but by the 'potential to make real' or the capacity for self-realization.
- The Mu-Nma traditions describe 'back-travellers' from the future and a compressing temporal cycle that suggests an imminent end to time.
- Peter Vysparov introduces the concept of 'hyperstition'—semiotic productions that function as cryptic communications from the Old Ones to make themselves real.
- The newly formed Cthulhu Club seeks to explore the intersection of Lovecraftian fiction, twisted time-systems, and the Lemurodigital Pandemonium Matrix.
- Stillwell warns that Cthulhu represents a deep terrestrial intelligence and a 'plane of Unlife' that should not be approached with levity.
As the Mu-Nma say in their bleakest moments: nove eshil ko raka -'Time is in love with her own pain.'
been highly treasured, and their pulverization invested
with immense ceremonial significance. Dibbomese sorcery
does not seem to be at all interested in judgements as to
truth or falsity. It appears rather to estimate in each case
5 7 7
FANGED NOUMENA
the potential to make real, saying typically 'perhaps it
can become so' . . .
Echidna Stillwell to Peter Vysparov, 19th April 1949 [Extract]
Dear Captain Vysparov,
Whilst respecting the candour of your account, I
cannot but abominate the necessity that has led the Nma
and their sorcerous abilities to be conceived and utilized
as mere munitions in a conflict imposed upon them from
without. From what I can reconstruct from your descrip
tion it seems to mark a degeneration of Nma demonism
and time-sorcery into mere magic, or the imposition of
change in accordance with will, in this case the will in
question being the overall policy and strategic goals of
the us war-effort, microcosmically represented by your
own - evidently galbnt, competent, and PCH ;uClsive
-
military office.
Forgive my lack of patriotic ardour, but it strikes me
as an appalling indication of cultural decay and corrosive
nihilism when a Dib-Nma witch allows herself to be
employed as a crude assassin, however one evaluates the
cause thUS--Se.Q'ed. This is all a matter of deepest regret,
although not - to my way of thinking - of individual
culpability. As the Mu-Nma say in their bleakest moments:
nove eshil <.0 raka - 'Time is in love with her own pain.'
Your discussion of Oddubb-trance makes no mention
5 7 B
ORIGINS OF THE CTHULHU CLUB
of temporal anomaly. This surprizes me. The Mu had
immense respect for those Dibba witches who they
described as returning from the Oddubb-time to come,
and the M u-N agwi or dream-witches often claimed to meet
these back-travellers in the Vault of Murmurs, where they
would learn about future times. They said, however, that
this time is compressing, and soon ends, although I had
not imagined the end to be so imminent. Remembering
this omen returns me to abysmal melancholy, consoled
only by another Mu-Nma saying: lemu ta novu meh novu
nove - 'Lemuria does not pass as time passes.' I shall try
to think things thus. As you say - with the Dibbomese -
shleth hud dopesh - 'perhaps it can become so' .
Peter Vysparov to Echidna Stillwell, 7th May 1949 [Extract]
Here in Massachusetts we have been convening a small
Lovecraft reading-group, dedicated to exploring the inter
section between the N rna cuI tural constellation, Cthulhoid
contagion, and twisted time-systems. We are interested
in fiction only insofar as it is simultaneously hyperstition
- a term we have coined for semiotic productions that
make themselves real - cryptic communications from
the Old Ones, signalling return: shleth hud dopesh. This
is the ambivalence - or loop - of Cthulhu-fiction: who
writes, and who is written? It seems to us that the fabled
Necronomicon - sorcerous counter-text to the Book of
579
FAN G E D N O U M E NA
Life - is of this kind, and furthermore, that your recovery
of the Lemurodigital Pandemonium Matrix accesses it at
its hypcrsource.
I hope it is superfluous to add that any directly
participative involvement on your part would be most
extravagantly appreciated.
Echidna Stillwell to Peter Vysparov, 28th May 1949 [Extract]
I t is with some trepidation that I congratulate you on
the inauguration of your Cthulhu Club, if I may call it
such. Whilst not in any way accusing you of frivolity, I
feel bound to state the obvious warning: Cthulhu is not
to be approached lightly.
My researches have led me to associate this Chthonian
entity with the deep terrestrial intelligence inherent in the
electromagnNir r-::nddron of the inner earth, in all of it:;
intense reality, raw potentiality, and danger. According to
the Nma she is the plane of Unlife, a veritable Cthelll -
who is trapped under the sea only according to a certain
Qwernomics and Abysmal Intensities
- The figure of Cthulhu is reimagined not as a surface-dweller needing rescue, but as a restoration of contact with abysmal intensities and sub-chakra occult teachings.
- Hyperstition is introduced as a process where authors believe they are inventing fiction while actually being guided by external forces like the Nma.
- Qwernomics explores the secretarial subcultures and 'Godless qabbalism' emerging from the global installation of the Qwerty keyboard layout.
- The typewriter digitized language by decoupling it from speech and encoding it into manual-digital motor processes within the human nervous system.
- The perceived arbitrariness of the Qwerty layout serves as a mask that protects it from semiotic inquiry, allowing it to function as a 'positive unconscious tropism.'
- The mass adoption of the keyboard coincided with a radical reconstruction of the global economic order and the birth of the machinic unconscious.
Qwerty thus exploited the mask of accident to construct a positive unconscious tropism or uninvestigated massive transmutation -the subliminal instantiation of a new cultural system.
limited perspective - and those who set out to traffick
with her do so with the very greatest respect and caution.
That her submerged Pacific city of R'lyeh is linked to
a lemuro-muvian culture-strain seems most probable, but
the assumption that she was ever a surface-dweller in a
sense we would straightforwardly understand can only
be an absurd misconstrual. It is much more likely that
5 8 0
ORIGINS OF THE CTHULHU CLUB
Cthulhu's rising - like that of Kundalini as it was once
understood - is a drawing down and under, a restoration
of contact with abysmal intensities. Why would Cthulhu
ever surface? She does not need rescuing, for she has her
own line of escape, trajected through profundity. Much
of this relates to the occult teachings of the sub-chakras
in zones of Indo- Lemurian influence.
Hyperstition strikes me as a most intriguing coinage.
We thought we were making it up, but all the time the
N rna were telling us what to write - and through them . . .
5 8 1
I ntrodu ction to Qwernom ics
Qwernomic subcultures result from the legacy of the
typewriter and its computational simulation, based upon
the shift-locked code systems implicitly produced by the
Sholes or Universal (,Qwerty') Keyboard. Sketching
the emergence and diffusion of the 'secret/secretarial'
qwernomic subculture within global technocapitalism
isolates a field of diagonal communication between
anthropomorphic signs and the molecular traffic signals
of the mutating ' machinic unconscious,' outlining an
antipolitical semiotic pragmatism and Godless qabbalism
consistent with what CCRU calls 'coincidence engineering.'
The emergence of technologically supported typewrit
ing practices in the final decades of the nineteenth century
coincided with a profound reconstruction of the global
economic order, associated with an equally radical re
arrangement of the concrete composition of the terrestrial
machinic unconscious (at least in its anthropomorphic
583
FANGED NOUMENA
shallows) . The interconnected explosions of modern
corporate organization and endo-corporate bureauc
racy, (gendered) office work, typographic information
deposits, psychoanalysis, literary modernism, anglophone
qabbalism, cryptographic machinery and mechanized
computation all tracked the mass installation of typing
skills into the human nervous system, in accordance with
the Qwerty arrangement of the Sholes Keyboard.
The keyboard effected a twin digitization oflanguage,
both sealing its abstraction from the oral-pneumatic
apparatus (into manual-digital motor-processes) and
decomposing it into discrete elements coded onto the
keys of a finger-activated mechanism. In parallel, it redis
tributed the 'arbitrariness' of the phonological sign into
the key sequence of the new device, according to prin
ciples that remain obscure, contested, and shrouded in
myth. OnC't> the Sholes distribution h:ld technofrozcn and
socially shift-locked into a resilient standard, a generalized
assumption that Qwerty was predominantly arbitrary
(quasi-randomly allocated) functioned to pre-emptively
dissipate pattern-hunting semiotic inquiry. Challenges
from alternative 'scientific' keyboards were undermined by
skepticism about the very idea of a rational arrangement
of the keys. In this respect, Qwerty conformed to a typical
trend among oecumenic sign systems, with the sheer iner
tia of mass-acceptance marginalizing analytical or reform
ist tendencies to a fringe of philosophical eccentricity or
5 84
INTRODUCTION TO Q,WERNOMI C S
even psychotic delusion. Qwerty thus exploited the mask
of accident to construct a positive unconscious tropism
or uninvestigated massive transmutation - the subliminal
instantiation of a new cultural system.
Of course, there may be nothing behind the mask.
Conventional wisdom would accept no other conclusion.
Yet even in this case a large set of investigable Qwernomic
Introduction to Qwernomics
- The Qwerty keyboard layout creates 'Qwernomena,' coding patterns and virtual sciences that challenge anthropomorphic and humanist prejudices.
- By linearizing the keyboard into a preliminary alphabet, letters can be recoded based on the difference between their ordinal values in standard and Qwertian sequences.
- Qabbalistic procedures, specifically combinatorial arithmetic and digital cumulation, are applied to these sequences to extract hidden patterns.
- The text proposes a virtual vocabulary of non-repeating words (Mersenne numbers) structured by the internal ordering of the Qwertian alphabet.
- A new 'Alpha-Qwernomic' language emerges where certain standard letter combinations are excluded if they conflict with the inverse ordering of the Qwerty sequence.
Such Qwernomena may be nothing other than the qabbalistic materials of Azathoth, the blind idiot God, whose meaningless pipings lead all semiotic disciplines into the bubbling abyss of futile insanity.
'phenomena' remain, consisting of Qwerty-induced cod
ing patterns and potential surplus values, virtual sciences,
subcultures, undercurrents, cryptographic methods and
partially coherent deliria. Such Qwernomena may be
nothing other than the qabbalistic materials of Azathoth,
the blind idiot God, whose meaningless pipings lead
all semiotic disciplines into the bubbling abyss of futile
insanity. A true and dispassionate science, however, has no
right or reason to be intimidated by such consequences.
Only false - ideological - science, serving as the fawn
ing guardian of securocratic humanism, can justify a
prejudice in favour of anthropomorphically acceptable
outcomes. Qwerty has in any case long been accepted.
The rest is destiny.
Whilst the two dimensional array of the stand
ard (Anglospherean) keyboard opens the poten
tial for a variety of linear unfoldings - from the left/
right, top/bottom, spirals . . . and equally diverging
approaches to the inclusion of the number line, punc
tuation marks, function keys . . . - the conventions of
5 8 5
FANGED NOUMENA
Neoroman textual organization (top-bottom, left-right)
provide the key to a preliminary Qwertian alphabet:
QWERTYUIOPASDFGHJKLZXCVBNM.
If, at least provisionally, this linearization and selec
tion is accepted, each letter is recoded as the difference
between two ordinal values. Pattern can be extracted from
these twin orderings in a huge variety of ways.
One approach involves the adoption of a qabbalis
tic procedure belonging conceptually to combinatorial
arithmetic.
Consider the typical problem: given an alphabet of
length n, how many non-repeating two-letter combina
tions are possible?
The arithmetical formula for resolving this problem
is (n x n-1)/2, coinciding with the operation of 'digital
(or triangular) cumulation' of n-l. Digital cumulation
is second only to digital reductIOn as a qabbalistic tool
(explicitly esteemed at least since Pythagoras) . (Pascal's
triangle can be used to expand this combinatorial analysis
to higher levels) .
As an illustration, take only the first four letters of
the Neoroman alphabet. To produce a matrix of binary
combinations, order is employed as a procedural criterion,
automatically excluding redundant combinations.
Thus, 'A' combines with 'B, C, and D', 'B' combines
with 'c and D', 'c' combines with 'D'.
5 8 6
I NTRODUCTION TO QWE RNOMICS
Arithmetical confirmation is, of course, easily obtained:
3 + 2 + 1 = 6, equivalent to the digital cumulation of
(4-1 =) 3, and to (4 x 3)/2.
If non-repeating combinations of any length are per
mitted from an alphabet of length n, the formula for
the number of combination is (2 to the nth power)-1
(Mersenne numbers, including an intriguing set of
primes). The entire virtual vocabulary of non-repeating
(non-anagrammatic) Neoroman 'words' is thus (2 to the
26th) -1 (or M-26).
As a consequence of this procedure, all the terms
making up a well-formed combinatorial 'vocabulary' will
be internally structured by an ordering principle drawn
directly from the 'alphabet' in question.
Returning to the qabbalistic analysis of Qwertian,
and applying these procedures restrictively (yet again,
there are quite obvious alternatives, ignored here) leads
to the virtual - or even actual (sadly, I've done this many
times) - compilation of an Alpha-Qwernomic 'language'
consisting of those combinations consistent with parallel
applications of the previously elaborated criteria.
For instance, 'AE' - permitted in Neoroman - is now
excluded, due to the inverse ordering found in the Qwer
tian sequence. (It might be noted at this point that the
familiarity of the Qwertian 'middle row' letter-sequence
A ... DFGHJKL immediately ensures a prominent region
of resonance - while the bottom row hints strongly at
587
FANGED NOUMENA
a reverse folding, however, such qwernotectonic issues
exceed the scope of this introduction).
Alpha-Qwertian Logic and Qabbalism
- The Alpha-Qwertian vocabulary is an empirical system derived from the obscure logic of the Sholes keyboard layout.
- Linguistic structures are mapped through a system of 'envelopments' where letters are treated as perimeters of concentric circles.
- Qabbalism is defined as a practical program rather than a doctrine, making it immune to purely rational or formal critiques of logical fallacy.
- The core hypothesis of qabbalism is that numerical analysis of internal codes can detect signals from outside the human economy.
- Epistemologically, qabbalistic research shares a status with experimental particle physics as a rigorous, calculative venture into the unknown.
- The text argues that common sense and speculative metaphysics are the true enemies of the rigorous, problematic exploration found in both science and occultism.
If there is no source of at least partially coherent signal that is radically alien to the entire economy of conventional human interchange, then qabbalism is nothing but a frivolous entertainment or a fundamentally futile practical error.
Resulting from an intricate interference pattern, the
scope of the Alpha-Qwertian vocabulary is radically
'empirical' (in the sense that it derives from the fact of
the Sholes Keyboard, the 'logic' of which - if such a
thing exists at all - remains utterly obscure). It would
be exceedingly surprising if an arithmetical formula of
manageable complexity were able to usefully contribute
to its estimation.
The Alpha-Qwertian dictionary has both alphabetical
and Qwertian versions, with identical content but alter·
native ordering arrangements. Prioritizing the alphabet
(out of courtesy to our gracious oecumenical hosts), gives
the initial entries:
A, Ab, Abm, Abn, Ac, Acm, Acn, Acv ...
It is procedurally productive to understand this vocabu
lary as a system of envelopments, as if each term was
involuting into itself, in accordance with a non-metric
ordinal sequence appropriate to intensities.
One tool facilitating this approach requires the articu
lation of the two series, with the second inverted:
ABCDEFGHIjKLMNOPQRSTUVWXYZ-MNB
VCXZLKJHGFDSAPOIUYTREWQ
5 8 8
I NTROD UCTIO N TO Q,WERNOMICS
(or its mirror-image:
QWERTYUIOPASDFGHJKLZXCVBNM
ZYXWVUTSRQPONMLKJIHGFEDCBA
- pragmatically appropriate to the Qwertian version of
the Alpha-Qwertian dictionary).
If the twin instances of the same letter are treated as
marking the perimeter of a circle, the overall pattern of
envelopments is exactly charted. One can see immediately,
for instance, that both instances of the letter 'B' fall within
the circle described by 'A' in its twin instantiations. 'B'
is thus enveloped by 'A' - making 'AB' a consistent
combination. Systems of concentric circles correspond
to tolerated Alpha-Qwertian constructions.
A complete Alpha-Qwertian dictionary is actually
quite short, but as to its potential usage ...
589
Qabbala 1 01
I NTRODUCTI O N
Is qabbalism problematical or mysterious? It seems to
participate amphibiously in both domains, proceeding
according to rigorously constructible procedures - as
attested by the affinity with technicization - yet intrinsi
cally related to an Outsideness through which alone it
could derive programmatic sense.
If there is no source of at least partially coherent signal
that is radically alien to the entire economy of conventional
human interchange, then qabbalism is nothing but a
frivolous entertainment or a fundamentally futile practical
error. Yet unlike any kind of metaphysical assault on 'the
noumenal', qabbalism cannot be definitively critiqued on
a purely rational or formal basis, as if its mode of 'error'
was that of logical fallacy. Since qabbalism is a practical
programme, rather than a doctrine of any kind, its formal
errors - mistakes - are mere calculative irregularities, and
correcting these is actually a procedural requirement of
(rather than an objection to) its continued development.
591
FANGED NOUMENA
It is the rational dismissal of 'the' qabbalistic enterprise
that is forced to take a metaphysical stance: ruling out
on grounds of supposed principle what is in fact no more
than a guiding 'empirical' hypothesis (that signal from
'outside the system' is detectable by numerical analysis
of codes circulating within the system).
Epistemologically speaking, qabbalistic programmes
have a status strictly equivalent to that of experimen
tal particle physics, or other natural-scientific research
programmes, even if their guiding hypotheses might
seem decidedly less plausible than those dominant within
mainstream scientific institutions.
Lovecraft understood the epistemological affinity
between natural science and programmatic (as opposed
to doctrinal) occultism, since both venture into regions
once declared mysterious, following procedures of a rig
orously calculative-problematIcal type. It is the alliance
between purely speculative metaphysics and common
sense that betrays such affairs of pure reason to futility,
Qabbala and Popular Numerics
- Qabbalism operates within the realm of procedural certainty and empirical accumulation rather than metaphysical transcendence or absolute mystery.
- Unlike formal mathematics, qabbala is rooted in popular numerical culture and remains bound to the natural number line and the economy of digitizable signs.
- The practice is described as essentially 'democratic' and 'blind,' emerging from mass-social phenomena rather than specialized intellectual meta-discourse.
- Historically, qabbala arose from a systematic calculative 'error' during the transition from alphabetical numerals to modular notation.
- The movement is characterized as a 'semiotic glitch' that hyperstitionally generates its own antiquity to compensate for its lack of traditional authority.
- Technically, qabbala is framed as a form of spontaneous artificial intelligence emerging from the practicalities of digital processing.
This transition provided the opportunity for a systematic calculative 'error' -the mistaken application of elementary techniques appropriate to alphabetical numerals -simple addition of notated values -to the new modular signs.
since they lack the calculative traction to revise their own
conventional notions on the basis of their encounters.
Practices - however implausible their guiding motiva
tions - can know nothing of absolute mystery or meta
physical transcendence because their realm of certainty
is procedural-problematic and uncontroversial, whereas
their reserve of knowledge is empirical, refutable, repeat
able, revisable, nonmystical and accumulable.
5 92
Q,ABBALA 1 0 1
There may be no 'empirical', procedurally approach
able mysteries - or mysterious problems - of the kind
qabbalism guides itself towards. If so, it will approach
this fact in its own way - empirically, probabilistically,
impressionistically, without any logical, transcendental or
philosophical meta-discourse ever having been positioned
to put it in its place.
I . P O P U LAR N U M E R I C S
Traditional gematria (whether Hebrew, Greek, Farsi or
Arabic)! have distinctive typical features: (1) They sub
stitute letters for numerical values, overcoding numer
als where they exist. (2) They code for discontinuous
numerical values, typically 1-10, then 20, 30 ... chunked
in decimally significant magnitudes.
The ocean in which qabbalism swims is not mathemat
ics, but popular numerical culture. From a mathematical
perspective it remains undeveloped, even ineducable,
since it cannot advance beyond the Natural number line
even to the level of the Rationals, let alone to the 'higher'
numbers or set-theoretical post-numerical spaces. Where
counting ceases, qabbalism becomes impracticable.
Socially, qabbala makes an implicit decision against
specialization, in order to remain virtually coincidental
See 'Incognitum', 'Introduction to ABJAD', in R. Mackay (ed.), Collapse I (Oxford:
Urbanomic, 2006).
593
FANGED NOUMENA
with the entire economy of digitizable signs. It is essen
tially 'democratic' (in the most inclusive sense of this
word), even when apparently lost in its own trappings
of hermeticism. It is bound to the 'blind' undirected
contingencies of pre-reflective mass-social phenomena,
with all the inarticulate provocation this entails in respect
to professional intellectuals. Wherever exact semiotic
exchange occurs, a latent qabbalism lurks (even within
the enclaves of intellectual professionalism themselves) .
Deleuze and Guattari's 'Nomad War Machine' , within
which number is socially subjectivized, captures crucial
aspects of this qabbalistic fatality.
Historically, qabbala arises through epic accident, as
a side-product of the transition between distinct modes
of decimal notation. Its historical presupposition is the
shift from alphabetical numerals (of the Hebrew or Greek
type) to modular notatioii, will! ilS lcsuhing unlocaliz
able (and theoretically indeterminable) confusion. This
transition provided the opportunity for a systematic cal
culative 'error' - the mistaken application of elementary
techniques appropriate to alphabetical numerals - simple
addition of notated values - to the new modular signs.
This mistake automatically resulted in digital reduction,
by accident, and thus as a (theoretically scandalous) gift
of fate. Arising historically during the European Ren
aissance - when zero, place value and technocapitalism
finally breached the ramparts of Western monotheism
5 94
QABBALA 1 0 1
- qabbalism (born in a semiotic glitch and thus lacking
the authority of tradition or even purpose) was compelled
to hyperstitionally generate an extreme antiquity for itself,
in a process that is still ongoing.
Technically, qabbala is inextricable from digital
processing. Emerging from calculative practicality within
the context of blind mass-cultural metamorphosis, it
antedates it own theoretical legitimation, making sense
of itself only derivatively, sporadically and contentiously.
Its situation is analogous - and perhaps more than analo
gous - to that of a spontaneous artificial intelligence,
Qabbalistic Provocation and Primitive Numerization
- Qabbalism functions as a self-regenerating mass-cultural glitch that mimics the senseless exuberance of a virus, indifferent to ideology or partisan agendas.
- The system operates on a single absurd criterion: the continual unconscious promotion of numerical decimalism, which defies even theocratic or divine appropriation.
- A discontinuity exists in the Oecumenic alphabet where numerals retain names, marking a residual 'alien quality' and a legacy of cultural trauma from their introduction.
- The English number names present a unique qabbalistic challenge; if their transcoding yields only noise, the criteria for evaluating qabbalistic results are undermined.
- Primitive Numerization (PN) is introduced as the most basic qabbalistic procedure, involving simple letter counting reminiscent of archaic tallying on mammoth bones.
- Despite its crudity, PN serves as a vital test case because its simplicity minimizes axiomatic arbitrariness and prevents symbolic 'sleight of hand'.
It has no party, only popularity.
achieving partial lucidity only as a consequence of tidal
pragmatic trends that ensure an integral default of self
master y. Practical systematization of technique precedes
any conceivable theoretical motivation. Dialectical inter
rogation of qabbalism at the level of explicit motivation
thus proves superficial and inconsequential, essentially
misrecognizing the nature of the beast. (It is equally
misleading to ask: What is a computer re ally for?)
Politically , qabbalism repels ideology. As a self
regenerating mass-cult ural glitch, it mimics the sense
less exuberance of virus, profoundly indifferent to all
partisan considerations. Indifferent even to the corroded
solemnity of nihilism, it sustains no deliberated agenda s.
It stubbornly adheres to a single absurd criterion, its
intrinsic ' condition of existence' -continual unconscious
promotion of numerical decimalism. Qabbala destines
595
FANGED NOUMENA
each and every 'strategic appropriation' to self-parody
and derision, beginning with the agenda of theocratic
restoration that attended its (ludicrously robed) baptismal
rites. Even God was unable to make sense of it. It has no
party, only popularity.
II. PRIMITIVE NUMER IZATION
Among the primary test-beds for qabbalistic analysis are
the numerolexic systems inherited from cultures over
coded by the modern Oecumenic alphabet. These include
the Hebrew and Greek alphabets (with their Neoroman
letter names and mathematico-n otational functions)
and the Roman numbers (inherited as Neoroman letters
and still numerically active in various domains). In this
respect, the absence of names for Neoroman letters are
an index of their pseudo-transccndclicc -a� 'unuaule ..
able' -within the present Oecumenic order.
A discontinuity is marked in the alphanumeric series
(o-z) by the fact that the numerals composing the first ten
figures in this series do have names, grouping them with
the letters of previous alphabetical number ing systems
from a certain qabbalistic perspective. This might be
taken as the residual indication of an 'alien quality' still
characterizing the numerals in relation to the Oecumenic
cultural order they now indisputably occupy, a legacy of
the cultural trauma attending their introduction.
596
QABBALA 101
The qabbalistic provocation posed by the English num
ber names is conceptually comparable to that of any
other numerolexic system, while surpassing any other
in the intimacy of its challenge. If the numerals have
names, shouldn't the qabbalistic processing of them as
words yield -at the least -compelling suggestions of
nonrandom signal? If the standard numeral names emit
nothing but noise when qabbalistically transcoded, the
attempt to establish relatively persuasive criteria for the
evaluation of qabbalistic results suffers an obvious and
immense reverse.
What, then, would count as a minimally controversial
first step in such an examination?
Surely the most basic of all qabbalistic (or subqab
balistic?) procedures is simple letter counting-Primitive
Numerization (PN). As a reversion to sheer 'tallying' PN
has a resonance with the most archaic traces of numerical
practice, such as simple strokes carved into mammoth
bones and suchlike palaeo-ethnographic materials. If
anyone was to bother systematizing PN procedure for
the purpose of mechanization or simply for conceptual
clarity, it would be most efficiently done by transcoding
('ciphering') each letter or notational element as '1' and
then processing the result numerically.
PN'S extremely tenuous relation to issues of modulus
notation ensures that it can only ever be a highly dubious
tool when intricate qabbalistic calculation is required.
597
FANGED NOUMENA
Yet this utter crudity also makes it invaluable as a test case,
since it minimizes axiomatic arbitrariness and precludes
any plausible possibility of symbolic conjuration (,sleight
Qabbalistic Patterns in Numerals
- The text explores 'PN' (Plex-Number) analysis, where the letter count of English numeral names is treated as a significant data point.
- Common reason dismisses such patterns as noise, yet the analysis reveals a consistent '8-sum' symmetry across decimal pairs.
- The probability of this specific pattern occurring by chance is calculated to be less than 1/100, challenging the assumption of linguistic randomness.
- A discrepancy between the '8-sum' results and the '9-sum' Numogram is resolved through qabbalistic digital reduction where 8 leads to 9.
- The author distinguishes qabbalistic procedure from traditional numerology, which often limits numbers to static Jungian archetypes.
- Qabbala is presented as a method of uncovering hidden communicative motivations within the structure of signs.
Common reason -sanity -insists upon noise as the only PN output consistent with the general intelligibility of signs.
of hand') while fully sharing the qabbalistic 'deficiency'
of sufficient anthroposocial or communicative motiva
tion. Common reason - sanity - insists upon noise as the
only PN output consistent with the general intelligibility
of signs (a pre-judgment applying rigorously to all qab
balistic procedures).
No message should inhere in the length of a word,
excepting only the broad pragmatic trend to the short
ening of commonly used terms. It is immediately obvi
ous why this exception has no pertinence to the case in
question here, unless stretched to a point (for instance,
expecting the smaller numerals to exhibit the greatest
lexical attrition) where it is straightforwardly contradicted
by the acmality of the phenomenon.
So, proceeding to the 'analysis' - PN of the English
numeral names: zero=4, one=3, two=3, three=5, four=4,
five=4, six=3, seven=5, eight=5, nine=4. Is there a pat
tern here? Several levels of apparent noise, noise, and
pseudo-pattern can be expected to entangle themselves
in this result, depending on the subsequent analytical
procedures employed.
To restrict this discussion to the most evident second
ary result, not only is there a demonstrable pattern, but
this pattern complies with the single defining feature of
598
QABBALA 1 0 1
the Numogram2 - the five Syzygies emerging from 9-sum
twinning of the decimal numerals:3 5:4, 6:3, 7:2, 8:1, 9:0.
In the shape most likely to impress common reason
(entirely independent of numogrammatic commitments)
this demonstration takes the form: zero + nine = one + eight
= two + seven = three + six = four + five - revealing perfect
numerolexic-arithmetical, PN -' qabbalistic' consistency.
The approximate probability of this pattern emerging
'by chance' is 1/243, if it is assumed that each decimal
digit (0-9) is equiprobably allotted an English name of
three, four, or five letter length, with 8-sum zygosys as
the principle of synthesis. 7-sum or 9-sum zygosys are
inconsistent with any five or three letter number-names
respectively, and thus complicate probabilistic analysis
beyond the scope of this demonstration (although if
everything is conceded to the most elaborate conceivable
objections of common reason, the probability of this
phenomenon representing an accident of noise remains
comfortably below 1/100) .
Partisans of common reason can take some comfort
from the octozygonic disturbance of the (novazygonic)
N umogrammatic reference. How did nine become eight
(or vice versa)? Lemurophiliac numogrammaticists are
2
On the Numogram, see Abstract Culture 5: Hyperstition (London: eCRU, 1999)
3
PN confirmation of the Numogrammatic Novazygons (9-Twins).
ONE + EIGHT = NINE + ZERO. (PN 3 + 5 = (4 + 4 =) 8)
lWO + SEVEN = NINE + ZERO. (PN 3 + 5 = (4 + 4 =) 8)
THREE + SIX = NINE + ZERO. (PN 5 + 3 = (4 + 4 =) 8)
FOUR + FIVE = NINE + ZERO. (PN 4 + 4 = (4 + 4 =) 8)
5 9 9
FANGED NOUMENA
likely to counter such queries with elementary qabbala
(since digital cumulation and reduction bridges the 'lesser
abyss' in two steps, 8 = 36 = 9, as diagrammed by the 8th
Gate connecting Zn-8 to Zn-9) .
I I I . AGAI NST N U M E RO LO GY
Consider first an extraordinarily direct numerological
manifesto:
When the qualitative aspects are included in our
conception of numbers, they become more than
simple quantities 1, 2, 3, 4; they acquire an archetypal
character as Unity, Opposition, Conjunction, Com·
pletion. They are then analogous to more familiar
[J ungian J archetypes ... 4
It is hard to imagine a more 'archetypal' expression of
numerological ambition than this. Yet rather than meet·
ing this claim with docile compliance, the qabbalist is
compelled to raise a number of awkward questions:
(1) How can a numerological coding that proceeds in this
fashion avoid entrapping itself among the very smallest of
Naturals at the toe-damping edge of the number line? If
'4' symbolizes the archetype 'Completion,' what to make
The Antinumerical Nature of Archetypes
- The text questions whether 'qualitizing' numbers into archetypes reveals a deeper truth or merely gift-wraps the 'inhumanity' of numerical difference for human consumption.
- It argues that quantity is a decadence of number and quality is its perversion, suggesting that arithmetic itself provides no basis for these categorizations.
- Numerology is described as profoundly antinumerical because it seeks to 'redeem' numbers by subordinating them to symbolic meanings like 'Unity' or 'Opposition.'
- The author posits that archetypes are anthropomorphic limitations of the human species, whereas raw numbers represent an 'eternal hypercosmic delight.'
- Drawing on Gödel and Turing, the text asserts that the semiotic potency of number always subverts and parodies any logical or philosophical overcoding.
- Qabbalism is positioned as being caught between these human vanities and the rigorous, transcendental arithmetic of raw numerical patterns.
Archetypes are sad limitations of the species, while numbers are an eternal hypercosmic delight.
4
J. Opsopaus, 'Introduction to the Pythagorean Tarot', at http://web.eecs.utk.
edu/-mdennan/BA/PT/lntro.html
600
QAB BALA 1 0 1
of 127, 709, 1023, or similar small Naturals? Do they also
have analogues among the intelligible archetypes? How
would one 'qualitize' (2'27)-1, or a larger number (of which
there are a very considerable number)?
(2) Is an 'archetype' more basic than a number in its
unsymbolized state? Does 'qualitizing' a number reveal a
more elementary truth, a germ the number itself conceals,
or does it merely re-package the number for convenient
anthropomorphic consumption, gift-wrapping the intol
erable inhumanity of alogical numerical difference and
connectivity?
(3) Why should a number be considered 'quantitative'
in its Natural state? Is it not that the imposition of a
quantity/quality categorization upon the number requires
a logical or philosophical overcoding, a projection of
intelligibility alien to the number itself? Quantity is the
decadence of number (while quality is its perversion),
so - since arithmetic provides no basis for a reduction of
the numerical to the quantitative - what is the supposed
source of this (numeric-quantitative) identification (other
than a disabling preliminary innumeracy)?
(4) If '1' numerologically evokes 'Unity,' why should
unity not qabbalistically 'evoke' 134 (=8, its Numogram
matic twin)5 with equal pertinence? Can any expressible
5
Employing August Barrow's 'Anglossic Q;1bbala', the basic tool of which is the
Alphanumeric Gematria. This numerization of the Neo-Roman alphabet , continuing
the procedure now familiar from Hexadecimal, is a continuous nonredundant system,
supplementing the numerals 0-9 with numerized letters from A (=10) to Z (=35),
60 1
FANGED NOUMENA
'archetype' avoid re-dissolution into the unfamiliarity
of raw number pattern? Numerology might assimilate
'2' to opposition, but opposition = 238 = 13 = 4 (twice 2,
and the Numogrammatic twin of ('4' = completion = 212
=) 5), while even if numerological '3' as conjunction =
237 = 12 = 3 finds itself qabbalisitically confirmed (at the
extremity of its decimalization), this is not, perhaps, in
an altogether comfortable mode.
Numerology may be fascinated by numbers, but its
basic orientation is profoundly antinumerical. It seeks
essentially to redeem number, through symbolic abso
lution into a 'higher' significance. As if the concept of
'opposition' represented an elevation above the (,mere')
number two, rather than a restriction, subjectivization,
logicization and generalized perversion, directed to
anthropomorphic use-value and psychological satisfac
tion. Archetypes are sad iimitations of the speCIes, whIle
numbers are an eternal hypercosmic delight.
Nevertheless, qabbalism is right up against numerol
ogy, insofar as it arises 'here,' within a specific biological
and logocratic environment. The errors of numerology are
only the common failures oflogic and philosophy, human
vanities, crudified in the interest of mass dissemination,
but essentially uncorrupted. The numeric-critique (or
treating the o-z alphanumeric sequence as a numeral succession, corresponding to
the numerals of a modulus 36 notation.
Thus UNITY = 30+Q3+l8+Q9+34 = 134. 1+3+4 = 8.
602
QABBALA 1 0 1
transcendental arithmetic) o f a Codel (or Turing, or
Chaitin (or Badiou?(??(???) )) can be rigorously trans
ferred to this controversy, demonstrating - within each
particular milieu - that overcodings of numerical relation
by intelligible forms - 'archetypes' or 'logics' - are unsus
tainable reductions, reefed on the unsurpassable semiotic
potency of number. Codel has shown that there is always
a number, in fact an infinitude of (natural) numbers,
that simulate, parody, logically dialectize, paradoxically
dismantle, archetypally hypervert, and in whatever way
necessary subvert each and every overcoding of arithmetic.
The Cryptographic Flux of Number
- Number is an unsurpassable force that resists any authoritative philosophy or 'plain text' interpretation.
- Qabbala operates on the premise that all semiotics are inherently cryptographic, meaning no sign is ever purely arbitrary or free from prior numerical investment.
- While Gödel showed that numbers are infested by discursive systems, Qabbala shows that discourse is itself redoubled by independent numerical patterns.
- Modernity’s attempt to separate the alphabet from number is a fragile cultural illusion, as alphabetical sorting and ordering prove the persistent numerical substructure of communication.
- Any attempt to 'rigorize' Qabbala or use logic to define it is subverted by the very numerical currents it seeks to master.
- Numbers require no logical redemption and exist as an eternal, hypercosmic delight beyond the reach of philosophical legislation.
There is not -and can never be -any 'plain text,' except as a naive political assumption about (the relative (non)insidiousness of) coding agencies and the presupposition that communicative signs accessibly exist that are not already 'in code.'
Number cannot be superseded. There is no possibility of
an authoritative 'philosophy of arithmetic' or numerologi
cal gnosis.
Qabbala assumes that semiotics is 'always already'
cryptography, that the cryptographic sphere is undelimit
able. It proceeds on the assumption that there cannot be an
original (unproblematic) coding, providing the basis for
any solid definition or archetypal symbol, since the terms
required for such a coding are incapable of attaining the
pure 'arbitrariness' that would ensure the absence of prior
cryptographic investment. There is not - and can never
be - any 'plain text,' except as a naive political assump
tion about (the relative ( non)insidiousness of) coding
agencies and the presupposition that communicative signs
accessibly exist that are not already 'in code.' Since every
thing is coded, or (at least) potentially coded, nothing is
603
FA N G E D N O U M E NA
(definitively) symbolic. Qabbalistic cryptocultures - even
those yet to come - ensure that number cannot be dis
cussed or situated without subliminal or (more typically)
wholly unconscious participation in numerical practices.
Logos, including that of numerology, is also always some
thing other than itself, and in fact very many things.
Qabbalism thus operates as an inverse or complemen
tary G6delian double-coding. Where G6del demonstrated
that the number line is infested by virtual discursive sys
tems of undelimitable topicality and complexity, pre
emptively dismantling the prospects of any conceivable
supranumerical metadiscourse, qabbala demonstrates that
discourses are themselves intrinsically redoubled (and fur
ther multiplied) by coincidental numerical systems which
enter into patterns of connectivity entirely independent of
logical regimentation.
The supposed numerical de-activation of the alphabet,
marking semiotic modernity (the era of specialized numer
ical signs), has an extremely fragile foundation, relying as
it does upon the discontinuation of specific cultural pro
cedures (precisely those that withdraw into 'occultism')
rather than essential characteristics of signs themselves.
The persistent numerical functionalization of the modern
alphabet - with sorting procedures based on alphabetical
ordering as the most prominent example - provides incon
testible evidence (if any was required) that the semiotic
substructure of all Oecumenic communications remains
604
Q,AB BALA 1 0 1
stubbornly amphibious between logos and nomos, per
petually agitated by numerical temptations and uncircum
scribed polyprocesses_
At the discursive level, any 'rigorization of qabbala'
can only be a floating city, with each and every defini
tion, argument and manifesto continually calving off into
unmasterable numerical currents and alogical resonances_
How could qabbala be counterposed to a code, to meaning
and reason, when code ( = 63) finds duplicitous harmon
ics in meaning = reason = 126? If qabbala positions itself
discursively against numerology ( = 369), the echoes of its
novanomic signature perpetuate themselves even through
such unlikely terms as significance ( = 207) and signification
( = 252). Pronouncements that begin as projected logical
discriminations revert to variations on triplicity and the
number nine, performing a base qabbalistic subversion
of philosophical legislation and its authority to define (or
delimit connectivity).
No polemic against numerology - whether conducted
in the name of qab bala or of Oecumenic common reason -
will transcend the magmic qabbalistic flux that multiplies
and mutates its sense. Perhaps dreams of numerological
archetypes even sharpen the lust for semiotic invention,
opening new avenues for qabbalistic incursion. But this at
least is certain: Numbers do not require - and will never
find - any kind oflogical redemption. They are an eternal
hypercosmic delight.
605
Tic-Talk
T H E T I C XENOTAT I O N
Barker's Tic Xenotation
- Daniel C. Barker developed Tic Xenotation (TX) while working on 'Project Scar,' a SETI-related decryption protocol in Southeast Asia.
- TX is a radically abstract numerical semiotic designed to be independent of cultural conditioning, base systems (modulus), or place-value conventions.
- The system utilizes 'tic dots' and 'implexions' to represent numbers based on their prime factors and hyperprime indices, aligning with Euclid’s Fundamental Theorem of Arithmetic.
- Unlike traditional counting methods, TX requires the natural number line to be constructed synthetically, starting from a base value of 2.
- The notation is described as a 'Godelian hypercode' that has been mysteriously found on ancient artifacts like the Vukorri Cryptoliths.
- While indifferent to standard qabbalistic modulus notation, TX is considered a 'maximally decoded' semiotic that strips numeracy of all symbolic conventions.
It remains the most radically decoded semiotic ever to exist upon the earth, although exact isomorphs of the TX have been puzzlingly discovered among certain extremely ancient anomalous artifacts.
Daniel C. Barker's TIc Xenotation emerged during the
highly obscure phase of his life when he was working
for 'NASA' (some hesitation is appropriate here) on the
sETI-related 'Project Scar' in Southeast Asia, tasked with
designing a 'general purpose decryption protocol' for
identifying intelligent signal from alien sources.
This project necessitated the formulation of numeric
conventions independent of all cultural conditioning or
local convention -radically abstract signs.
To take one wretched example, the movie Contact has
ETI signal counting in pulses -with 101, for instance,
consisting of a succession of one hundred and one blips -
a repugnantly stupid 'solution' that could only be con
sidered acceptable -let alone 'intelligent' -by coke-fried
Hollywood brats.
607
FANGED NOUMENA
Barker's Tic Xenotation (TX), in marked contrast, ele
gantly provided an abstract compression of the natural
number line (from 2 ... n) with a minimum of coded
signs and without modulus. It remains the most radi
cally decoded semiotic ever to exist upon the earth,
al though exact isomorphs of the TX have been puzzlingly
discovered among certain extremely ancient anomalous
artifacts (such as the Tablets of Jheg Selem and the
Vukorri Cryptoliths).
Tic Xenotation works like this (I've used colons for
Barker's tic dots and placed tic-clusters in quotes for
clarity):
':' counts as '2' or 'x 2', with a value exactly equivalent
to '2' in a factor string. So:
':' = 2
:: = 4
':::' = 8
The second notational element consists of implexions,
where 'en)' = the nth prime.
Implexion raises the hyperprime index of any number
by 1. Examples (from the hyprime 'mainlain' ):
'(:)' = 3 (2nd prime),
'« :»' = 5 (3rd prime),
'«(:»)' = 11 (5th prime),
'««:»»' = 31 (11th prime)
'«((((:))), = 127 (31st prime)
608
TIC-TALK
Numbers constellate as normal factor strings, i.e. 55
(5 x 11) is tic xenotated as '«:»«(:)))'
Nb. TX accounts for all naturals with a value of 2
or higher.
In order to reach back to zero, Barker added a
'deplex' operation, '-P':
'(-P)' = lower hyprime index by 1, so: '(-P)(:) = :'.
Thus 0 = '«-P)):'.
'(-P)' and '( +P), perform elementary subtractions/
additions that modify hyprime indices.
Nb. A strange feature of the TX is that the natural
number line has to be constructed synthetically.
Barker described such a list as the 'Tic Xenotation Matrix',
whose first entries (corresponding to the decimal numer
als) proceed:
[0] «-P)):
[1] (-P):
[2] :
[3] (:)
[4] ::
[5] «:)
[6] :(:)
[7] (::)
[8] :::
[9] (:)(:)
609
FANGED NOUMENA
TIC TALK
The (Barkcrian) Tic Xc notation provides a numerical
semiotic adapted to the Naturals with special affinity to
Euclid's Fundamental Theorem of Arithmetic. The TX
constructs numbers in terms of their basic arithmetical
features as primes or composites in a notation without
modulus (base), place-value or numerals.
The exact circumstances among which D.C. Barker
formulated the TX remain deeply obscure (for a number
of reasons best explored elsewhere). For our immediate
purposes it suffices to remark that the broad research
context within which tx emerged was a highly abstract seti
oriented investigation into minimally-coded intelligent
signal, without presupposition as to origin (e.g. 'xeno
biological organisms') or theme (e.g. 'cosmo-chemistry').
'The: illve:�ligaLiuIl, �iLUaled in (he jungles of Borneo,
was entitled 'Project Scar' and received a high-level
security classification. In keeping with this research
topic, Barker proposed TX as a maximally abstracted or
ultimately decoded numerical semiotic, stripped of all
nonconstr uctive ( or symbolic) conventions (and initially
named 'G6delian hypercode'.)
While the raw numeracy of TX is most accurately
conceived as sub-qabbalistic, due to its indifference to
modulus notation (the primary motor of qabbalistic
occulturation), its very independence from convention
610
TIC-TALK
Lexicography and Pure Ordinality
- The text explores how lexicographical order serves as a rigorous ordinal-numeric function distinct from cardinal quantity.
- A 'nomofission' in Oecumenic societies separates literacy from numeracy, masking the fact that dictionary use is a high-level ordinal competence.
- Lexicography is described as 'pure ordinalism' because it avoids the 'cardinal temptation' of quantity that often confuses numerical sequencing.
- The system relies on 'sequential diplocoding,' requiring both an internal alphabetical code and an extrinsic directional convention like left-to-right reading.
- Lexicographic systems possess an infinite potential equivalent to Aleph-0, allowing for endless insertions between any two terms.
- The author proposes an 'intercoding' method that merges alphanumeric series to investigate the digital source of mathematical and literate infinities.
The ordinal function of numerals (1st, 2nd, 3rd ... ), in contrast, remains relatively impure -at least psychologically -since in this case a persistent cardinal temptation confuses sequencing function with the spectre of quantity.
makes it a valuable tool when investigating the basic
features of numerical (arithmetical or qabbalistic) codes.
Among the notation-related features most prominently
exposed to rigorous scrutiny by TX is ordinality.
AO SYS
Within the Anglobal Oecumenon, the most pragmatically
prevalent ordinal functions are alphabetical, utilizing the
ordering convention of the N eoroman letters to arrange,
sort, search and archive on the basis of Alphabetical or
Alphanumerical Order, organizing dictionaries, encyclo
paedias, lists and indexes 'lexicographically.' The word
'alphabet' itself performs a (Greek) ordinal operation.
'Lexicography' - dictionary-type order - is used here
(as in various fields, such as compilations of number
series) to designate a mode of ordering (an ordinal
numeric function) rather than a definite topic ('words').
Although a relatively neglected numerical operation,
lexicographic ordering plays a crucial role in concrete
(popular-Oecumenic) ordinal practices. It is character
ized by:
1) Popularity. Facility at lexicographic sequencing is
considered a basic social competence, inherent - or even
prior - to literacy, whilst pedagogically separate from the
acquisition of numerical (,maths') skills. At the pedagogi
cal level, Oecumenic societies tend to distribute ordinal!
6 1 1
FANGED NOUM E NA
cardinal competences in accordance with the distinction
between literacy/numeracy, thus establishing the basic
division between linguistic/mathematical abilities from
a primal nomofission (ordinal/cardinal differentiation).
Literate citizens of the Oecumenon - those able to use
a dictionary - are ordinally competent, through lexico
graphic conventions.
2) Pure ordinalism. Restricted entirely to sequencing
problems, cardinal values remain entirely alien to lexico
graphic practices, to such an extent that rigorous ordinal
numeric operations are typically divorced entirely from
numerical associations. The ordinal function of numerals
(1st, 2nd, 3rd ... ), in contrast, remains relatively impure
- at least psychologically - since in this case a persistent
cardinal temptation confuses sequencing function with
the spectre of quantity. For this reason the alphanumerical
subsumption of the numerals into lcxicographi..:. PfdL-
tices can be considered 'clarifying' in respect to ordinal
operations.
3) Fractionality. Simulating lexicography within arithme
tic requires the employment of modular (e.g. decimal)
fractional values. Arithmetical listing by cardinality will
be isomorphic with ordinal-lexicographic sequencing for
all numbers of the format 'o.n'.
4) Sequential diplocoding. Lexicographic systems
require twin ordering conventions. They draw upon
an alphabetical code and an ordinal place value
61 2
TIC-TALK
convention (principally, left or right ordering, equiva
lent to the behavioural scheme for the movement of a
reading-head). The alphabet instantiates the ordering
scheme, but does not (internally) describe it - 'read
ing' the alphabet to extract the ordinal code ('abed .. .'
or 'zyxw . . . ') itself presupposes an extrinsic sequencing
convention (Alpha-Omega, from first to last).
5) Infinite potentiality. Any lexicographic system allow
ing interminable strings has a code potential (cardinally)
equivalent to Aleph-o, with an infinity of virtual Dedekind
cuts (entry insertions) between any two terms, however
close, and virtual isomorphy between any segment of the
list/archive and the whole. It thus attests to a 'literate'
infinity isomorphic with that of mathematics, drawing
upon a common but culturally obscured digital source.
I NTERC O D I N G ARITHMETI C
An intermediate semiotic attuned to purely demonstra
tive engagement with Euclid's Fundamental Theorem of
Arithmetic (FTA) can be generated by transforming the
standard Oecumenic decimal notation (*) by:
1) Employing the full Alphanumeric series o-z (0-35) for
notational convenience, and
Lexicographic Disorganization and Templexity
- The Fundamental Theorem of Arithmetic (FTA) is used to disassemble numbers into prime components, eliminating traditional place-value numbering.
- By treating prime factors as unordered strings, the numerical line is freed from quantitative constraints and subjected to lexicographic re-ordering.
- This lexicographic shift creates an 'Autonomous Ordinality' where binary powers must be exhausted before reaching other primes, making the line uncountable by natural counting.
- The Kantian model of time as a linear n+1 progression is challenged by this rigorous disorganization of the number line.
- The resulting 'templexity' describes time as a nonprogressive, fractured, and heterogeneous synthesis that is sequential but nonsuccessive.
Such ordinal-lexicographic time maps a 'templexity' that is uncountable, fractured/fractional, erratic and heterogeneous, sequential but nonsuccesi ve.
2) Raising all signs to their first hyprime power, from 0
= Prime-o = 1 to Z = Prime-35 = 149.
613
FANGED NOUM E NA
The purpose of these transformations is to eliminate
polydigit (place-value) numbering and expose the radi
cal disorder implicit in the FTA. All integral numbers
in the FTA intercode consist either of single figures or
plexed-compounds of the form ( . . . ), with numerical
clusters synthesized through multiplication rather than
modular-positional construction.
Consider a number picked entirely at random, *86,
disassembled by factorization in accordance with the FTA
down to the listed components *2 and *43, the *lSt and
*I4th primes, hence: IE. The expression of this number is
no longer under any positional constraint, 'IE' or 'EI' are
equally valid on numerical grounds and strictly equivalent.
Shuffling a string of intercode figures (FTA components)
of whatever length makes no difference whatsoever to the
number designated, with the ordering of the series being
subjecl ullly LU an ex(rinsic convention (of minimal - even
vanishing - importance from a (cardinal) arithmetical
perspective, where it is relevant only 'psychologically',
for convenience in assimilation and comparison).
Once the merely inertial and peudo-numerical order
inherited from uninterrogated tradition is subtracted
from FTA-intercode strings, dissociating all components
from quantitative ordering, they are freed for lexico
graphic re-ordering as decoded series - an ordering which
will deviate from the series of quantities, liberating an
61 4
T I C -TALK
Autonomous Ordinality whilst de-cardinalizing the
number line.
Consider *172, or uE. Oecumenic-lexicographic pro
cedures ensure this number precedes IE (*86), as will all
its successive binary multiples. Evidently, such procedures
ensure that the infinite series of binary powers must be
completed before arriving at 2 (*3). 'Natural' counting
no longer has any prospect of reaching a nonbinary
power,just as alphabetical-lexicographic 'counting' would
proceed 'a, aa, aaa, aaaa ... ' without ever arriving at
'b'. Reversing the problem and it is equally evident the
lexicographic-ordinal line is never counted.
The Kantian assimilation of arithmetic to temporality
models elementary time-synthesis as n+l, +1, +1 ... an intui
tion rendered questionable by the rigorous lexicographic
disorganization of the number (listing) line. Once ordi
nally purified, the number line becomes uncountable by
any supposed finite (temporalizing) subject, even from
moment n to moment n+1. Instead, the line is synthesized
by sorting (lexicographic sequencing) of prefabricated
strings, whose quantities are determined on a different
axis to their linear-positional codings. A prolongation
of the time-arithmetic association would thus require a
remodelling of time as nonprogressive synthesis with
out consistent scale or continuous-quantitative trend,
no longer intelligible as passage or development. Such
ordinal-lexicographic time maps a 'templexity' that is
6 1 5
FANGED NOUMENA
uncountable, fractured/fractional, erratic and heterogene
ous, sequential but nonsuccesive.
Of course, all of this needs re-approaching on a far
more rigorous basis, with a consistent focus on the topic
of templexity - suffice it to say for 'now' that Kantian
intuitions of number, time and their intermapping are
themselves structured by notationally-problematizable
constructions, since time-mapping has a hypothetical
rather than essential relation to arithmetical common
sense (with its undisturbed assumption of straightforward
ordinal-cardinal interconvertability).
Elevating this intermediate semiotic to a functional
numeracy, with a semiotic power commensurate with
the set of Naturals (including primes above Prime-Z),
requires a final step:
3) Adopting Tic Xenotative plexion, where 'en)' = Prime-no
Thus:
0 = 1, (0) = Prime-1 = 2, « 0» = Prime-2 = 3, etc.
Non-Linear Semiotic Clusters
- The TX and FTA-intercode systems demonstrate a semiotic efficiency that renders traditional sequential grammar and positional notation redundant.
- Unlike standard numeral strings, TX formulae function as 'clusters' where numerical value is indifferent to the spatial order or sequencing of signs.
- The elimination of notational redundancy means that determining the order of two complex numbers requires active arithmetic calculation rather than intuitive visual recognition.
- To function as a readable list, TX requires 're-ordinalization' through extrinsic lexicographic protocols that create cardinally erratic number lines.
- Choosing 'plex-precedence' in these protocols results in a non-originating list that begins with an infinite series of hyperplexed primes rather than simple counting.
Apprehended in their fully decoded potentiality as efficient number-signs, such formulae are clusters, not strings.
The inefficiency of this semiotic relative to TX is demon
strated by its redundancy, most dramatically:
v = (B) = « 5» = (((3» ) = «« 2» » = «« (1» » )
=
« «(((0))))))
Nb. TX shares the intrinsic disorder of FTA-inter-
code. *86 = :(:(::» or (:(::» : or :« : :):) ...
6 1 6
TIC-TALK
OUT OF O RDER
TX/FTA-intercode numerical construction is indifferent
to semiotic sequencing, position or grammar. A number
expressed in either system could be distributed randomly
within a space of n-dimensions, requiring only a cohe
sion convention (semiotic particles 'belong together'
irrespective of order). Apprehended in their fully decoded
potentiality as efficient number-signs, such formulae are
clusters, not strings.
The TX case is still more extreme than that typical
of FTA-intercode, however, since here even the spectral
residue of sequential coding is erased. Given two complex
Tx-formulated numbers, correct order (quantitative com
parison) requires - perhaps highly elaborate - calculation,
eliminating entirely the practical usage of disordered TX
clusters for ordinal operations.
For anything but small numbers, Euclidean cluster
stringing conventions (by ascending cardinalities) become
procedurally complex, perhaps inoperable, forTx numeri
cal formulas. This is evident even from small numbers,
such as *149, TFA-intercode Z or (34), TX «(:))(::)). As the
35th prime, with 35 the product of*5 and *7, the sequenc
ing of hyprime sub-factors (factors of the prime-ordinate,
i.e. *35) is no longer facilitated by lexicographic codings
drawn from the numeral sequence. That '5' precedes 'i is
evident from the numeral code, but the ordering of «:))
617
FANG E D NOUM E NA
and ( : :) cannot similarly rely upon intrinsic lexicographic
guidance. In the TX case, it is only by constructing the
numbers and sequencing them arithmetically that the
'notational' question of their order can be resolved. In
other words, the sequencing of the sign has ceased to be
a notational or preliminary problem, becoming instead
inextricable from the arithmetical construction of the
number. This results inevitably from the elimination of
notational redundancy in TX, with concomitant erasure
of procedural 'intuition'.
Because TX number clusters are intrinsically disor
dered, a consistent and functional TX semiotic requires
re-ordinalization through autonomous (extrinsic) lexico
graphic procedures, inevitably constructing a cardinally
erratic 'number-line' or list/search sequencing proto
col. The semiotic economy of TX makes this procedural
problem easy to detine. As an approximate AOsys ana
logue, lexicographic TX requires a variant of sequential
diplocoding:
1) Cluster stringing. Sequencing the components of
composite Tx-formula numbers.
2) Number listing. Meta-sequencing of properly
sequenced TX strings.
It might seem sensible to assume the Oecumenic
left-to-right reading procedure, since the arbitrariness of
this rule makes it unexceptionable, but the diplocoding
option matrix necessitates a substantial question as to the
61 8
T I C -TALK
consistency/inconsistency of this decision as between (1)
and (2) above. Even allowing for this complication, the
option matrix for a mechanical lexicographic TX ordering
protocol remains highly constrained, consisting merely of
twin decisions as to the sequencing of the tick [:], open
plex [( ] and close plex [ )] signs.
Irrespective of the Cluster stringing decision, tick
precedence sequencing of the number list results in a
the AOsys analogue previously mentioned (a, aa, aaa . . . )
'counting' through the infinite series of binary powers
before reaching any nonbinary number. The list is initi
ated by T x *2 = ': ' .
Plex-precedence produces a far more anomalous list
line, one that is non-originating because it 'begins' with a
series of arbitrarily large hyperplexed primes, notationally
initialized by unending open-plex signs r«((((((((((( .. . ],
Barker's Descent into Xenotation
- Barker proposes a 'plex-precedence' protocol for sequencing that rejects Euclidean ordering as a mere arbitrary convention.
- The research into 'cryptogeologic' dot-groupings leads to a total breakdown of Barker's mental and physical health.
- Barker perceives the xenotation as a sentient weapon or disease that 'tears up the number line' and devastates the concept of time.
- Despite his delirium, Barker insists that counting remains an 'ineluctable' necessity to make sense of the hyper-prime indices.
- The text suggests a transition from scientific notation to a state of 'noncommunicating delirium' where thought itself becomes a disease.
The xenotation continues to disorder itself as it condenses, tearing up the number line, devastating time and sleep.
since ' ... «' precedes ' . . . ( :'. Listing practices following a
plex-precedence protocol necessarily begin in the middle.
[My assumption is that semiotic consistency (across
clusters/lists) is to be preferred, with the sheer weirdness
of plex-precedence sequencing making a strong case for
its adoption. The 'alphabet' (ordinal code) would thus
be described by TX *3 = (:).]
In his own brief comments on the cluster sequencing
problem in the Project Scar report, Barker restricted
himself to the observation that Euclidean (cardinally
consistent) ordering was no more than a 'provisional and
6 1 9
FANGE D NOU M E NA
arbitrary convention' which would quickly break down
'given nondcmonstrative numerical values [anything
but very small Naturals], that the problem should be
considered 'merely technical and extrinsic' and 'probably
best decided on communication-engineering grounds.'
Given Barker's Project Scar research orientation,
focused on 'nonlinear recursively-embedded planar
semionomic dot-groupings of cryptogeologic origin' -
anomalous cryptoliths - it is not surprising that he came
to the notational ordering problem late and distractedly.
Just days after completing the 'Appendix on Notation'
Barker came entirely unstrung.
Stricken by revolting tropical diseases, increasingly
obsessed with an interwoven tangle of cosmopolitical con
spiracies of various scales, and multiplicitously agitated
by teeming micro parasites of dubious reality, Barker's
plummet into noncommunicating delirium is charted
by the digressions into doggerel annotating his Project
Scar research report:
A chittering tide
Devouring my hide
Starting from the Outside
This is the slide ...
620
T I C -TA L K
AND YET
In the same twitchy, spintered handwriting Barker
remarks:
The xenotation continues to disorder itself as it con
denses, tearing up the number line, devastating time
and sleep. Perhaps it is a weapon from outer space.
I say that seriously, even if it is a sickening kind of
joke. There is no sleep, everything is broken, every
thing connects without joining, swarming, pulsing,
dots, specks, dust particles dancing inside my eyes,
continuously ripping . . . thought has become a disease
. . . I even heard a voice (how ridiculous) saying: "You
must isolate the xenotation before it disintegrates
the time-line." It's just the fever of course, but the
tic systems are all shuffled together now, shuffled
together with this filthy disease and its cavernous
speckled dreams and even Jolo admits that the mark
ings are spreading over my skin, bites or rashes or
maybe even colonies . . . so the line has rotted through,
disintegrated . . . there's no line, that's the message,
and yet . . . And Yet . . . counting is ineluctable and
unsurpassable . . . You have to check it, re-check it
continuously, but it's true. How could the hyprime
indices be decided without a countable ordinality?
They have to come from somewhere, from a matrix,
6 2 1
FANG E D N O U M E NA
a culture, even if the clusters seem to rip everything
apart they M U ST HAVE B E E N C O U N T E D at some stage,
before dissimulating themselves and scattering again
. . . And yet we can only make sense of these dots and
ripples by counting primes on a line that remains
successive and integrated, developing reliably, com
municable, they have a past, a true lineage, even if
it's difficult to think, even if they tear it apart and
make of it something shattered and insane, something
diseased . . . but really I don't blame them, NASA of
course knew nothing, but even they knew noth
ing, they just arrived, why should they remember?
Memory is impossible for them. In any case, it's just
a disease, I understand that now. There's no malice
. .. not even real cruelty . . .
Nb. V\Jfiile [here is no reason to believe Barker had expo
sure to, or interest in, the Anglossic Qabbala, the emphatic
reiteration of 'And Yet' suggests he had feverishly iden
Critique of Transcendental Miserablism
- Modern neomarxism has shifted from a goal of outperforming capitalist production to a state of 'cosmic despair' and total negation.
- The 'Frankfurtian spirit' frames capitalist success as a curse, viewing growth and innovation as mere alienation and 'difference without essential difference.'
- Transcendental Miserablism treats capitalism as a Gnostic 'Black Iron Prison,' where time and desire are inherently sources of suffering and ruin.
- Marxism has been stripped of its historicism and economic ambition, leaving behind only a psychological bundle of resentments against anything that 'hurts, taunts and disappoints.'
- Capitalism has successfully identified itself with desire and social dynamism so completely that growth and time itself have become its integral components.
- The complexity of modern decentralized networks makes the old socialist dream of repurposing the 'capitalist machine' for utility technically unimaginable.
In fact, with economics and history comprehensively abandoned, all that survives of Marx is a psychological bundle of resentments and disgruntlements, reducible to the word 'capitalism' in its vague and negative employment: as the name for everything that hurts, taunts and disappoints.
tified it as a synonym for counting, perhaps even for
temporality. (AND YET
= 123).
6 2 2
Critique of Transcendental M iserablism
There is a gathering trend among neomarxists to finally
bury all aspiration to positive economism ('freeing the
forces of production from capitalist relations of produc
tion') and install a limitless cosmic despair in its place.
Who still remembers Khruschev's threat to the semi
capitalist West - "we'll bury you"? Or Mao's promise
that the Great Leap Forward would ensure the Chinese
economy leapt past that of the UK within 15 years? The
Frankfurtian spirit now rules: Admit that capitalism will
outperform its competitors under almost any imaginable
circumstances, while turning that very admission into a
new kind of curse ("we never wanted growth anyway, it
just spells alienation, besides, haven't you heard that the
polar bears are drowning ... ?").
623
FANGE D NOUME NA
From Baudelaire's Le Voyage, with its mournful discovery
that human vice repeated itself universally in even the
most exotic locations, to the left-wing reading of Philip K
Dick as a Gnostic denunciation of commercialized change,
capitalistic variety and innovation has been totalized as
difference without essential difference, just more of the
same senseless dissimilarity. The grand master of this move
is Arthur Schopenhauer, who lent it explicit philosophical
rigour as a mode of transcendental apprehension. Since
time is the source of our distress - Philip K Dick's 'Black
Iron Prison' - how can any kind of evolution be expected
to save us? Thus Transcendental Miserablism constitutes
itself as an impregnable mode of negation. It goes without
saying that no substantial residue of Marxian historicism
remains in the 'communist' version ofthis posture. In fact,
with economics and history comprehensively abandoned,
all that survlves ot Marx is a psychological bundle of
resentments and disgruntlements, reducible to the word
'capitalism' in its vague and negative employment: as the
name for everything that hurts, taunts and disappoints.
For the Transcendental Miserablist, 'Capitalism' is the
suffering of desire turned to ruin, the name for everything
that might be wanted in time, an intolerable tantaliza
tion whose ultimate nature is unmasked by the Gnostic
visionary as loss, decrepitude and death, and in truth, it
is not unreasonable that capitalism should become the
object of this resentful denigration. Without attachment to
624
CRITIQUE OF TRANSCENDENTAL MISERABLISM
anything beyond its own abysmal exuberance, capitalism
identifies itself with desire to a degree that cannot imagi
nably be exceeded, shamelessly soliciting any impulse
that might contribute an increment of economizable drive
to its continuously multiplying productive initiatives.
Whatever you want, capitalism is the most reliable way to
get it, and by absorbing every source of social dynamism,
capitalism makes growth, change and even time itself
into integral components of its endlessly gathering tide.
'Go for growth' now means 'Go (hard) for capitalism'.
It is increasingly hard to remember that this equation
would once have seemed controversial. On the left it would
once have been dismissed as risible. This is the new world
Transcendental Miserablism haunts as a dyspeptic ghost.
Perhaps there will always be a fashionable anti
capitalism, but each will become unfashionable, while
capitalism - becoming ever more tightly identified with
its own self-surpassing - will always, inevitably, be the
latest thing. 'Means' and 'relations' of production have
simultaneously emulsified into competitive decentralized
networks under numerical control, rendering palaeomar
xist hopes of extracting a postcapitalist future from the
capitalism machine overtly unimaginable. The machines
have sophisticated themselves beyond the possibility of
socialist utility, incarnating market mechanics within their
Critique of Transcendental Miserablism
- Capitalism is framed as an autonomous, accelerating force that has transcended human imagination and biological intelligence.
- The 'Transcendental Miserablist' perspective is critiqued as a sterile negativity that views the passage of time and capitalist evolution as inherently evil.
- Marxist utopianism is dismissed as a 'monotheistic dream' of dynamism without competition, which the author views as a biological defect of the species.
- The text redefines the 'new' not as a human category, but as the 'Shoggoth-summoning' plasticity of capitalism that dissolves nature.
- A transition occurs into a semi-autobiographical narrative involving 'Vauung,' a persona associated with amphetamine-fueled insanity and social ruin.
- The narrative concludes with an account of artificial insomnia and a paranoid interpretation of pop lyrics as a personal omen of 'going to hell.'
It needs to be re-allocated to the sole thing that knows how to use it effectively, to the Shoggoth-summoning regenerative anomalization of fate, to the runaway becoming of such infinite plasticity that nature warps and dissolves before it.
nano-assembled interstices and evolving themselves by
quasi-darwinian algorithms that build hypercompetition
625
FANGED NOUMENA
into 'the infrastructure'. It is no longer just society, but
time itself, that has taken the 'capitalist road'.
Hence the Transcendental Miserablist syllogism: Time
is on the side of capitalism, capitalism is everything that
makes me sad, so time must be evil.
'Ihe polar bears are drowning, and there's nothing at all
we can do about it.
Capitalism is still accelerating, even though it has already
realized novelties beyond any previous human imagining.
After all, what is human imagination? It is a relatively
paltry thing, merely a sub-product of the neural activity
of a species of terrestrial primate. Capitalism, in contrast,
has no external limit, it has consumed life and biological
intelligence to create a new life and a new plane of intel
ligence, vast beyond human anticipation. The Transcen
dental Miserablist has an inalienable right to be bored,
of course. Call thii> m:w? IL'1; 1;lillllui.hiIlg UUl change.
What Transcendental Miserablism has no right to is
the pretence of a positive thesis. The Marxist dream of
dynamism without competition was merely a dream, an
old monotheistic dream re-stated, the wolf lying down
with the lamb. If such a dream counts as 'imagination',
then imagination is no more than a defect of the species:
the packaging of tawdry contradictions as utopian fan
tasies, to be turned against reality in the service of sterile
negativity. 'Post-capitalism' has no real meaning except
an end to the engine of change.
626
CRITIQUE OF TRANSCENDENTAL MISERABLISM
Life continues, and capitalism does life in a way it has
never been done before. If that doesn't count as 'new',
then the word 'new' has been stripped down to a hollow
denunciation. It needs to be re-allocated to the sole thing
that knows how to use it effectively, to the Shoggoth
summoning regenerative anomalization of fate, to the
runaway becoming of such infinite plasticity that nature
warps and dissolves before it. To The Thing. To Capitalism.
And if that makes Transcendental Miserablists unhappy,
the simple truth of the matter is: Anything would.
627
A Dirty Joke
I stole Vauung's name because it was unused, on the basis
of an exact qabbalistic entitlement.
Yet, at least 'up' here, Vauung still confuses itself with
me, with ruins and tatters.
This might change. Names have powers and destinies.
I have decided to let Vauung inherit the entire misfor
tune of my past (a perverse generosity at best). Its story
might never emerge otherwise.
There are rotten threads which even I can follow back
wards for decades, but they soon cease to be interesting.
Better to begin more recently (,better' in Vauung's
sense, and so no different from 'worse').
It had pledged itself unreservedly to evil and insan
ity. Its tool of choice, at that time, the sacred substance
amphetamine, of which much can be said, but mostly
elsewhere.
After perhaps a year of fanatical abuse it was, by any
reasonable standard, profoundly insane.
629
FANGED NOUMENA
A few examples may suffice, in no particular order.
On one occasion - indicative even to itself - it was in
a car being driven by the sister of its thing (the ruin). It
was night, on a motorway. The journey took several hours.
During the previous night, Christmas Eve, it had fol
lowed its usual course into fanatically prolonged artificial
insomnia. It had spent the time devoted to futile 'writing'
practices - it still pretended to be 'getting somewhere'
and was buoyant with ardent purpose, but that is another
story (an intolerably intricate and pointless one). It was
accompanied to the early hours by a repetitive refrain
'from next door' - a mediocre but plausible rock song
whose insistent lyric circled around the words: "Going
to hell."
I t knew these words were for it, and laughed idiotically.
The Ruin's Descent
- The protagonist, referred to as 'the ruin,' experiences auditory hallucinations and discovers an internal 'pop industry' within its unconscious.
- The ruin engages in predatory behavior, using women as means to explore morbid spiritual ends through LSD and occult rituals.
- A shamanic ritual involving 'wiping away the screen' of reality leads to a terrifying encounter with a landscape of death or cyberspace.
- The ruin's obsession with death and the 'loa' leads to a solitary existence defined by byzantine qabbalistic research and communication with alien voices.
- The narrative concludes with the ruin's total psychological disintegration following a traumatic, 'revolting' encounter with these internal voices.
The world withdrew and left the landscape of death, or hell, or cyberspace.
"They must really love the new CD they got for Christmas,"
�L Llluuglll, cyually iJiUlically.
In the car it listened to the radio for the whole journey.
Each song was different, the genres varied, the quality
seemingly above average, the themes tending to the
morbid.
"This is a cool radio station," it said to its sister.
"The radio isn't on," its sister replied, concerned.
Vauung learnt that the ruin's unconscious contained
an entire pop industry .
The ruin learnt that it had arrived, somewhere on
the motorway.
630
A DIRTY JOKE
Nothing more was said about it. Why upset your family?
The ruin had always abused women, in the Kantian
sense. It used them as means to an end, and the end was
ruin of the soul.
On one occasion they were wasted on LSD at a fair
ground, in some type of spinning machine. The operator
called out: "You're all going to die." Later, back indoors,
they plunged deeper into polydrug abuse. Taken up into
an obscure shamanic inspiration the ruin said: "Let's
embrace death, the Dark Mother." Seated on the sofa
together, it submitted to an alien ritual authority . It was
all very implicit. A finger held to one side of their face
to-faces. "First you collapse everything onto the screen."
The finger traverses the visual field. "Then you wipe away
the screen." It worked, truly. The world withdrew and left
the landscape of death, or hell, or cyberspace. Hearts
lurching in mammal panic -animals don't like to be dead,
however sick their minds might be. She could not deny
what had happen�d, but hated it. That was the beginning
of the end, although she went along with far, far more.
Addicted to death the ruin sought out new victims.
Yes, vampires are real, however pitiful.
Sifting through the ruin Vauung finds a pattern of
women and LSD linked with things that really happen
The ruin encountered the loa with a woman, feeding off
her fear. Perhaps the differential of terror encouraged it.
Perhaps its sadism and hypocritical compassion
631
FANGED NOUMENA
overwhelmed its instinct to flee. In any case, it revealed
the power of names, as 'calls,' and Outside entities the
'size' of breeze blocks approaching from the other side
of space. Death was the ruin's place by now, unambigu
ously desirable, and she wanted it too -even though it
terrified her. Still, the ruin fucked it up somehow (no
surprise to Vauung).
On another occasion, fresh kill, it said "let's explore
death together," or something equally repugnant.
She said: "Why can't you do it on your own?"
It wondered about that.
She was treated worst of all (or perhaps 'best').
Much later, after an aeon of speed and revelation in
its sister's car, the ruin is locked into a solitary trajectory.
It 'works' all night in its office, entangled in byzantine
qabbalistic researches. It thinks its trilobite of a computer
(a dedicated word processing machine) is a semiotic
revelation from the abyss. Calling to a being named
Can Sah it is rewarded with an alien voice. The tone is
absurdly high pitched (ancient demonists described this
tone as 'silvery'). The ruin had been seeking a monster
(Vauung), but the voice merely castigates it for its moral
squalor -"you're so horrible" may have been the first
message (the tapes are corroded). All the ugliness in the
universe was already impacted into this new regime. Real
ugliness: God, guilt, Man and the law of acceptance.
632
A DIRTY JOKE
It took a long time -many months at least -for the ruin's
defining passion to subside into smouldering hatred.
Eventually the voices -who seemed to have multiplied
-raped it. They did so physically , through trickery, over
the course of one unbearably protracted night of filth and
misery (the details are too revolting to relate). The ruin
could speak to itself now, audibly, but in its own head.
It renounced everything it had ever wanted, rebaptized
the voices 'Smurfs' and disintegrated into depressive
Spiritual Nausea and Cosmic Shit
- The text describes a state of abject nihilism where a 'ruin' exists in an interzone of self-disgust and parodic gnosis.
- Religion is characterized as a dilated form of spiritual nausea, providing an infinite opportunity for self-hatred.
- The character Vauung investigates these relics, suggesting a labyrinthine unconscious that functions as an elaborate trap.
- The passage rejects the romanticization of vileness, contrasting cosmic secrecy with the reality of 'shit.'
- Karma is redefined not merely as pain, but as a state of ruinous constriction and preprogrammed futility.
- The narrative concludes with a question of method, speculating on whether the 'ruin' lacked the cunning to escape its own mirrors.
If you romanticize vileness, I promise, you lie. Such unimagined abundances of cosmic secrecy, and such shit.
nihilism. To be raped by a monster? Who knows. To be
raped by celestial moralists ... (Vauung laughs).
The ruin crawls onwards, going nowhere. It had lived
through some extraordinary multiple of all the intelligence
it will ever know, in that abject interzone, turned on some
infernal spit, torched by self-disgust yet blessed by parodic
luxuries of gnosis (codes, number patterns, messages of
the Outside, neo-calendric schedules, Amxna mappings,
Qwernomic constructions ... ). It begged for eternal fires
to incinerate its sins. There was no depth of loathsC!me
self-abasement it did not fathom. This was spiritual nausea
dilated to the dimensions of religion. If you romanticize
vileness, I promise, you lie. Such unimagined abundances
of cosmic secrecy, and such shit.
As Vauung forensically investigates the relics I imagine
it shudders. Does it truly? -much rests on that.
This has already gone on too long, but then -it does.
633
FANGED NOUMENA
Vauung seems to think there are lessons to be learnt from
this despicable mess. It describes a labyrinth which is
nothing but an intricate hall of mirrors, losing you in an
'unconscious' which is magnificent beyond comprehen
sion yet indistinguishable from an elaborate trap. If this
is Karma it's not just pain (who fears that?) but ruinous
constriction and preprogrammed futility. To burn is one
thing. To grovel and beg to burn quite another. Religion
here is merely the opportunity to hate yourself infinitely.
Somewhere along the line the ruin lost the moral
strength for sexual abuse. To continue with that it would
have to be a lesbian, at least.
Seen from this side, Vauung is the gamble that the
ruin lacked cunning. It leaves a question of method. Not
exactly urgent, but obscurely pressing.
634
!
.-=>
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I I
I
I
I
I
I
I
I
I
I
I I
I
I
I
I
I I
I
I I I
I
I
I
(1][2 ](3](4](5)[6] ( 71l8)(9)10 J
[QHWllEHRll Tn YllUIl IJ[OJ[PJ
[A][SJIDHFHGJ[H)LJ][ K)[Ll
[ZlIXJ[CJ[ V)[BUNHMH ,H. I
[
0; . · __ --------------�--�----oo
os
One Or Several Wolves?
On Several Reg1ae6�
R 0
s
1be Geology of Morals � •. , 0 . '··��M <Who Does the Earth Think It Is?).
w��, � . 0----·7
• •• M
ritory· "fer
code. n'� E •
0 2
1 1 �
'. 'I
R "f ,
o
o
o
E R.___ .� 1 7° ·
Rh�O$e. ;7 -----------���--------------IM
•
z
Dates./ r (' �./. � S D • S I
Speeds. E�----------------------· -� s.Jl'����� i
.L-
\ St-- n
�====v��� IntenSities. E
T
r sf: -/: .. I
N
Wasp ftlld Orchid.
to N
Orchid captW-es a seg.Dent of W8sp-sex code CD ... OJ. Envelopllental
di£ference.
CC£-tTJ -tn
-t C£ -t D.
16: 053 ( •••• ) ," .... >
1 : 05� -((n))) -f "'�,,.,
18 : 06' (o)(t ).)
'" ; 0C,1 «u.))
?f>', 071 «(C·)) .. )
:!.\ i013 (C .. )(·))
V. : 07'1 (CCCe»).) i 3') (Ihl (c-)· )(.))
4D : 173 ((( .» .... )
41 ; 17'\ ««e) • )})
4'l! 181 «u)(.).)
43 ! \9 \ (( .. ) • »)
44! \q3 (C(Ce))) .. )
45: 1"11 ((e»(.)(.))
4f,: 1'1<\ ((.)Co )))
4(: 2.\ I (C((" ))(0 }»
L,.8 ; 227> ((0)"..0)
4C{: 2.2.7 (Co. )Co .. »)
so t 2J� ((e ))(.)) .. )
5 \ : 2.3� (C·" ))co ))
52. (13'\ (CC.). )u)
{--'------- '\
<53 : 24' «( .... )) ! ",<J.,_, '--
04 : 2.S I (C·)c. )(. ) .. )
55 : 2.5"7 (C(C· »)(.))) �-4lt\-Z
64: 5£.7 «Co )(. »)(.»
7o� &4'1 (C")(C·))·)
7 I � 3'5:; ((C(·»)··»)
72.: �5'\ «(-)(.) ... )
( 3: &,1 ((( .. )(.)))
74: 3,73 _((Co) •• ))
7 s; Z>1,\ (((.»)((..)(t»)
7 6: �.3 ((0") •• )
17'· &31 ((((. »)( .. ))
78 :S91 (((.).)(.).)
INDEX OF NAMES
Index of Names
A
Abraham 334, 423
Acker, Kathy 346, 350, 351, 355,
371,373
Aeschylus 399
Agamemnon 258, 537
Agin, Mohammed 376
Ananke334
Apollo 163, 232
Aquinas 231
Aristotle 60, 166, 230, 273,537
Artaud, Antonin. 273, 274,307,
310, 312'23, 315, 345, 412,
432,482
Augustine 131, 230
Azathoth 585
B
Bacon, Francis 256
Index of Radical Thought
- The text is a dense index of names from a scholarly or philosophical work, highlighting a heavy focus on post-structuralism, cybernetics, and horror fiction.
- Major philosophical figures like Kant, Hegel, and Deleuze receive extensive sub-entries, indicating their central role in the source material's arguments.
- The inclusion of fictional entities such as Cthulhu and Kurtz alongside historical figures suggests a synthesis of literary analysis and cultural theory.
- Technological and scientific figures like William Gibson, Alan Turing, and K. Eric Drexler point toward themes of accelerationism and digital culture.
- The presence of the CCRU (Cybernetic Culture Research Unit) and Daniel Charles Barker identifies the text as likely belonging to the 'theory-fiction' genre or Nick Land's collected works.
Derrida, Jacques 99, 119, 177, 184, 192, 203, 379 not a werewolf 180
Badiou, Alain 603
Barker, Daniel Charles 493, 527-
28,563-66, 607, 619
Barrow, August 601
Bataille, Georges 170, 204, 205,
222,224,23°,231,244,246 ,
391,392,396,465, 467
and christianity 214
on communication 223
on Gilles de Rais 247
645 on Nietzsche 209
The Accursed Share 246
Bateson, Gregory 416
Baudelaire, Charles 88, 212, 624
Baudrillard,Jean 379
Beckett, Samuel 266
Blake, William 225
Boole, George 367
Burns, Zeke 558
Burroughs, William 388,411,470,
502,535
Butler, Samue!324 , 389
c
Cadigan, Pat 389, 412
Can Sah 632
Cantor, Georg 368,521,524
Carroll, Lewis (Charles Lutwidge
Dodgson) 567
Carver, Iris 552
CCRU (Cybernetic Culture
Research Unit) 493,583
Chaitin, Gregory 603
Cioran, Emile 123
Clausewitz, Karl von 250
Conrad, Joseph 411
Crowley, Aleister 512
Csicsery·Ronay, Ivan 453
Cthelll 498,541, 542, 543, 544,
545,580
Cthulhu 575, 579, 575, 581
Cur 461, 462, 479,480
INDEX OF NAMES
D
Dagon 576
Dclahaye, II yppolite 130
Dclcuze and Guattari 172-23, 262,
280,283,296,3°7,317,352,
370,379,497,594
Anti-Oedipus 268, 270, 273, 275,
277,27 8,282,286,295,
296,3°2,310,315,339
A Thousand Plateaus 269, 270, 278,
280
Deleuzc, Gilles 170, 261, 263, 264,
26S-lg, 274
Cinema 2: The 11me Image 293
Difference and Repetition 105, 272,
510
Nietzsche and Philosophy 271
on Spinoza 272
DeLillo, Don 444
De Rais, Gilles 247-19, 258, 260
Dcrrida,]acques 99, 119, 177, 184,
192, 203, 379
not a werewolf 180
De {'esprit 179,181
Spurs 158
Descartes, Renee 65, 125, 176, 205,
294,435
Dick, Philip K 624
Dionysus 97-163
Downham, Mark 425
Drexler, K. Eric 450
E
Eliade, Mircea 420 Eros 212, 330, 342
Euclid 522
F
Foucault, Michel 459
Freud, Sigmund 87, 168, 183, 262,
275, 281-23, 298,3°6,326-27,
336,343-44,370, 465, 466, 496
and Lacan 283
Beyond the Pleasure Principle 282,
332,334> 343, 497
Drives and their Vicissitudes 327
on hysteria 184
on art 168
on the organism 332
and Rat-man 199
Frushlce, Doug 556, 558
G
Gibson, William 346, 348, 352, 369-
20, 372-23, 389, 559
definition of cyberspace 354
Count Zero 373
Neuromancer 346, 359, 360, 362,
363,372,425
Ginzburg, Carlo 420, 429
Godel, Kurt 480, 518, 521, 6°3,
604,610
Gold, Thomas 562
Grant, Kenneth 512
Graves, Robert 97
Guattari, Felix 170, 261, 282
646
INDEX OF NAMES
H
Haeckel, E. 501
Haraway, D. 435
Hegel, Georg Wilhelm Friedrich
105-16, 108, 125, 126, 151, 176,
231,250, 263, 264, 287, 294,
297,300
Encyclopedia 105-16
Philosophy qf Right 125
post-structuralist reaction to 261
Heidegger, Martin 81-121, 177-18,
184, 192, 263
Hitler, Adolf 279
Holderlin , Friedrich 83
Hume, David 65, 146
Humpty Dumpty 567
Husserl, Edmund 176-17, 263
I
Iphigenia 537, 539
Irigaray, Luce 78
J
John Foxe 131
Jung, C.G. 549-21
K
Kali 334. 344, 392
Kant, Immanuel 55, 63-65,72,107,
145, 205, 208, 212, 263, 273,
300,321, 354, 366, 368-20
aesthetic judgment in 136
and austerity 125 and bourgeois civilization 60
and Godel518
and ontotheology 120
and protestantism 133
Anthropology 127-28
anti-utilitarianism 143
Copernican Revolution 66
Critique qfJudgement 74,125,145,
148
Critique qf Practical Reason 73,
142, 151
Critique qfPure Reason 65, 69
disinterestedness 137
Groundwork cif the Metaphysics of
Morals 142
Husserl's reading of 177
noumena in 70
on arithmetic and time 615
on legitimaey 275
theory of genius 151
theory of the sublime 133-37, 150
Kaufmann, Stuart 367
Khruschev, Nikita 623
Kierkegaard, Soren 263
Kleist, Heinrich von 127
Klossowski, Pierre 98
Krell, David Farrell 96
Kurtz 359, 415,427,436,437,438,
482,484
Kurzweil, Heidi ('Heidi K') 549
L
Lacan, Jacques 282-23, 468
Leary, Timothy 556
Leibniz, Gottfried Wilhelm 65, 523
647
INDEX OF NAMES
Levi-Strauss, Claude 55,68-19
Lindenber ger, Herbert 81
Lovecraft, Howard Philips 575-16,
579,592
Lucretius 261
Luther, Martin 125
Lyotard, Fran�ois 328-19
M
Mao 623
Margulis, Lynn 458
Markov, Alvin Z. 376-21
Index of Names and Subjects
- The text provides a comprehensive index of influential thinkers, ranging from classical philosophers like Plato and Socrates to modern theorists like Deleuze, Guattari, and Nietzsche.
- It highlights recurring philosophical themes such as acceleration, alienation, and the relationship between capital and the 'anti-christ'.
- The index includes a significant focus on cybernetics and artificial intelligence, referencing figures like Alan Turing, Marvin Minsky, and the fictional AI Wintermute.
- There is a distinct intersection of high theory and pop culture, listing names like Jim Morrison alongside political figures like Mussolini and Marx.
- The subject index points toward specialized concepts like 'geotrauma', 'Anglossic Qabbala', and 'retrocausality', suggesting a focus on speculative or post-structuralist philosophy.
Anti-Oedipus (Deleuze and Guattari) 172, 173, 268, 270-21, 273, 275, 277-23, 282, 320, 323, 326, 341-22, 370, 412, 426; as engineering manual 326.
Marx, KarlS8, 347, 430
Milton,John 348
"-1insky, Marvin 559-21
Moravec, Hans 335, 561
Morgan, Elaine 500
Morrison, Jim 426, 438
Mussolini 279
N
Newton, Melanie 508
Nietzsche, Friedrich Wilhelm 56,
91,187, 201, 205, 208, 215, 222,
227,256, 261-22, 298, 301, 321
and national socialism 171
'!he Birth rifTragedy 163
and feminism 78
Bataille on 209
Deleuze's reading of 271
eternal return in 219
Genealogy of Morals 257
on the thing-in-itself 210
Will to Power 219
Novalis 86 o
Orestes 399
p
Plato 97, 231,244,260,273
Apology 231, 243
Phaedo 238
Prigogine, Ilya 298
Pyrrho 208
R
Reich, Wilhelm 170, 277
and national socialism 171
Rimbaud, Arthur 83,109,117,182,
201, 210, 222-23, 226-17
R'lyeh580
Russell, Bertrand 367
s
Sade, Marquis de 465
and Kant 126
Sarkon, Oskar 552,556-18,560,562
Sartre, Jean-Paul 352
Saussure, Ferdinand de 283
Schelling, Friedrich Wilhelm Joseph
von 151, 263, 272
Schopenhauer, Arthur 151-23, 204-
15,261-22,321,624
Selanna 94
Shannon, Claude 111
Smith, Cairns 335
Socrates 166, 176, 178, 208, 229,
231,238,243,250,254,256,
258,260
648
INDEX OF NAMES
Spinoza, Baruch 261, 263, 269, 271-
22,277,287,370,523
Deleuze's reading of 272
Ethics 270
Stillwell, Echidna 496, 549, 573,
575-16,578-20
T
Theweleit, Klaus 277, 286
Trakl, Georg 81-121, 181,184-16,189,
192,200
Trouvier, Jean-Pierre. 376-21
Turing, Alan 603
v
Vauung 485, 629, 630, 631, 632
Virilio, Paul 278
Vysparov, P. 573-80
w
Weber, Max 248, 396
Wiener, Norbert 297-19
Winter mute 344, 347-18, 354, 357,
359,371, 485
Wittig, Monique 79
x
Xxignal 556 z
Zinsser, Hans 193
649
INDEX OF SUBJECTS
Index of Subjects
A
absolute 212
abstraction 357
of labour 293
reality of 271
acceleration 230, 317, 351, 381, 384,
389, 392, 396,406,431,434>
441,443,449,626
accumulation 57, 59, 63, 120, 129,
306
and the sacred 245
in Bataille 248
in Kant 128
primitive 58, 445
actual, actuality 533, 534
:::Inn virtu:::!l �17, 358, 4-�3, 44�
as primary repression 351
addiction 82, 189,336,353,631
and money 338
and trauma 336, 343
agency
and media 455
moral 73
AIDSjHIV 381
alienation 267, 294, 313, 623
alliance
and filiation 68, 72
alphabet 111, 465, 513, 514, 587, 588,
594, 596, 611, 613
and redundancy III denumerization of 604
America 312, 433
Artaud on 312
anastrophe, retroefficiency, retrocau
sality 315, 318, 360
anatomy 490
neuro-175,307
remaking (Artaud) 310
Anglossic Qabbala 601, 622
animality 93, 140, 141, 150, 179, 180,
181, 188, 191, 200, 420
and morality 142
and the organic 417
and the sublime 138
excruciation of 134-17
in Trakl90
annihilation 329, 533
and exuberance 217
and purity 137
anti christ 204
and capital 396
Anti-Oedipus (Deleuze and Guattari)
172,173,268, 270-21, 273, 275,
'277 ;.3, 232,320, :5=-'3, j:.!u, :::>41-
22,370, 412, 426
and fascism 268, 286
as engineering manual 326
cybernetics in 296
fascism in 277, 278
Freud in 282
machine in 323
politics of 279
antipolitics 377, 583
AOsys 6ll
apartheid 56
apocalypse 217, 317
Apocalypse Now 411, 425
a priori 63-66, 70
650
INDEX OF SUBJECTS
Arche-Omega 532, 536
archetypes 601, 603
Architectonic Order of the Eschaton
(AOE) 567, 570
art
and enigma 167
and European philosophy 145
and labour 173
artificial intelligence, AI 293,317,
325,344,348,431,443,595
and government 352
Anti-Oedipus as 426
formalist vs antiformalist 450
astronomy 105
astrophysics 105-6, lIO
A Thousand Plateaus (Deleuze and
Guattari) 269-20, 278, 279, 280
caution in 280
fascism in 278
Auschwitz 396, 464, 465, 467, 469,
476,478,479
auto-catalysis 330
automatism 311, 322, 337, 344
axiomatics , axiomatisation 341, 405,
445, 484, 519
social 297
Axsys 558, 561
B
bacteria 458
beauty
in Bataille 171
in Kant 148
in Schopenhauer 157
becoming-animal 420, 424
becoming-zombie 267, 269
belief 207,225 binding 329
work as 255
biology 457,459
and geotrauma 499
xeno-610
birds 107
Index of Cybernetic Subjects
- The index highlights the 'body' as a central theme, categorized through its relationship to trauma, value extraction, and the 'body without organs' (BwO).
- Capitalism is framed as a machinic, viral, and non-totalisable system that functions as a 'straitjacket of production' while moving toward its own obsolescence.
- Cybernetics is bifurcated into 'cybernegative' and 'cyberpositive' processes, linking digital reason to the reality of critique.
- The concept of 'death' is extensively mapped, distinguishing between artificial (A-death), molar vs. molecular death, and its role as a function of capital.
- Emergent technological themes such as cyberspace, cyberpunk, and cryptography are cross-referenced with philosophical concepts like the Deleuzian BwO and the Kantian cogito.
capital as straitjacket of production 173
Black Iron Prison 624
black sun 254
Bladerunner 319
body 199, 238-19, 274,311,342,396,
398,409,413,414,417,421,423,
432,434-15,496,500,502
and reason 143
and the sublime 136, 138
as open system 436
bilateral symmetry of human 504
body-image 357,403,438
body-posture 500, 502, 538
coding of 417
extraction of value from 446
in Artaud 274
posture (Theweleit) 286
trauma as 498
body without organs, BwO 172, 269-
21, 274, 275, 279, 281, 304, 315,
325-26,339,356-17,394,412,
414, 419, 442
and death 268, 370
differentiation between empirical
and transcendental 273
Book of Life 579
brain 293, 347, 365, 385, 395, 437,
543, 548, 551, 561
and genius (Schopenhauer) 156
c
calendar 508, 533, 555
651
INDEX OF SUBJECTS
camouflage, mask 318, 330, 331,
343,401,4�8,436,445,452,
455,470
cannibalism 189,35°,397,418,423
capital, capitalism 230, 262, 264-15,
275-16,322,341,353,4°4
and addiction 337
and nature 313
and obsolescence 432
and psychoanalysis 281
and schizoanalysis 265
and schizophrenia 305
and schizo-politics 278
and the individual 431
and the universal 430
and time 626
anthropologically-formatted 445
as disinterested 337
as organism 377
capital as straitjacket of produc-
tion 173
Capital (Marx) 430
death of 266,353
lntf"rminnhlF <1rrllmlll�tlnn 1'29
limit of 276
machinic 444
non-totalisable 339
semiotics of 503
singularisation of 404
viral 338
cardinality 510,514-15,520,612,615
and schizophrenia 523
catastrophe 341, 369, 381, 406, 535
cathexis 432
chance 211, 213, 599
chaos 94, 177
greek concept of 92
theory 187 China 353, 380, 395, 442, 447, 623
China syndrome 373, 442
christiani ly, Christ 204, 217, 220,
225,423
and consumption 246
church 395
cogito 435
cognition
becoming-inhuman of 293
coincidence-engineering 370, 583
commoditization, commodity 230,
3°1,322,339,397,434,446
and computers 447
digital 338
common sense Q05
competition 626
complexity 187, 393, 430
computer
and commoditization 447
as decoding machines 352
concept
and exchange value, in Kant 72
consistency 497
''IT'1th,..,.,pr; ... .,T ... "',..,
-�.�.& ... -�&'-' ...... J ... O
consumption 129, 141, 221, 246, 248,
254,260,393,446,465
Contact 607
content
and expression 510, 517
continuity , continuum 368,473,
521,561
and the discrete 515
intensive continuity 406
control 301
convergence 297, 2g8, 315, 317, 339,
344, 360, 443, 449, 452, 503,
559
and death 370
652
INDEX OF SUBJECTS
convergent spatium 356
of military and entertainment 454
creativity 286
critique 145, 212, 263, 272, '-J.76, 321,
347
absolute 275
and capital 262
and cogito 435
cybernetics as reality of 300
Deleuzian 321
of digital reason 366
reconstructed by Schopenhauer
153
takes capital as object 267
crucifixion 215
cryptography 494, 517, 585,603,607
Crypt, The 545, 53
culture
and nature 451
cunning 354, 443, 634
of the inorganic 334
vs reason 141
Cyberia 292, 299, 311, 342, 353, 426
cybernegative 297,317
cybernetics 230, 294-16, 299-21, 326,
334> 342, 413
modernist definition of 296,297,
301
cyberpositive process 297,308,314,
317,335,337,384
cyberpunk 359, 391, 414, 446, 455
cyberspace 344, 354, 356, 358, 403,
545,546, 559, 631
cyborg 297
D
dance music 344, 398, 426, 546 death 128, 179, 217, 221, 241, 244,
256, 275, 276, 284,343, 631, 632
and body without organs 268
and capital 276
and creativity 286
and identity 274
and Nazism 286
and shamanism 210
and the organism , in Freud 343
and the unknown 241
artificial (A-) death 326, 369, 545,
547,553,556-17
as function of capital 266
as suspension of judgment
(Socrates) 244
as time-in-itself 369
exploration of, and monotheism
213
impersonal subject of critique 268
molar vs molecular 277
of capital 266
positive 287
virulence of (Bataille) 246
war as function of 250
work as resistance to 255
death drive 87, 268, 275, 282,283,
298
and national socialism 278
death of God 169, 176, 213, 216,253,
269
Index of Radical Philosophy
- The index maps the intersection of psychoanalysis, cybernetics, and political theory, specifically highlighting the relationship between desire and capitalism.
- Key philosophical concepts include geotraumatics, deterritorialization, and the 'machinic' nature of desire as explored in the works of Deleuze and Guattari.
- The text tracks a descent into dark themes such as 'molecular death,' 'fascist desire,' and the 'horror' associated with nano-technology and the biosphere.
- There is a significant focus on the breakdown of traditional structures through deregulation, digitization, and the 'escape from the biochemistry of sanity.'
- The entries bridge the gap between abstract logic (Gödel, Dedekind cuts) and visceral experience (drugs, delirium, and gothic horror).
escape from biochemistry of sanity 309
Decadence , Subdecadence 504
decoding 264, 340, 352, 512
geotraumatics as 494
deconstruction 263, 264
Dedekind cut 613
delirium 167,212,223, 224
social 418
demons 349
653
INDEX OF SUBJECTS
deregulation 377, 441
and critique 262
desert 269, 271
desire 154, 279, 280, 302, 342, 347,
360,466,624
and capitalism 624
and investment 432
and lack 303
and law 466
and molecular death 277
defined as lack 395
desires its own repression 173
fascist 277
machinic 327, 338
in Schopenhauer 155
desiring machines 295,324, 326
despotism 423, 430, 507, 534, 539
and philosophy 442
and the word 424
de stratification 285, 403
of number, in G6del52o
de territorialization 277, 280, 294,
337,339-20,342,412
ur;.d territorial produ(:tiuu 4iG
of biosphere 335
diagonal, diagonalisation 472-23,
511, 521, 523-24, 583
diagram, diagrammatics 353, 390,
463,5°2,546,554
and number 502, 509
and schizoanalysis 442
arithmetic al, in Godel519
diagonal, in Godel521
feedback 330
xenogenetic 458
Dibboma 573, 574, 577> 579
dijftfrance 177
difference 163, 199, 276, 330, 462, 473
and death 275
and number 510
Deleuzian 274
numerical, and linguistic interior
ity 519
transcendental vs stratophysi
caluo
Dijference and Repetition (Deleuze)
105,510
digital reduction 594
digitization 366, 402
and analog 515
of language 584
discontinuity 245
disorder lIO
dissipative systems 298, 443
division of labour 434
DNA 334-15,385,458,495,499
double-bind 463, 474, 477
drives 330, 332
in Freud 334
drugs 259, 266, 278,313,377-392,
4�4, 4:l0, o:F
amphetamine 629
LSD 631
dualism 435
dust 107
E
Earth 245, 257, 259, 337, 339, 416,
429,441,485,497,541,542,549
artificial 342
history of 497
eco-disaster 376, 381
economics
as primary process 265
654
INDEX OF SUBJECTS
equilibrium and non-equilibrium F
447
ecsanity 207
education
and power 459
Eidos 273
enigma 167, 178, 214
enlightenment 63, 64, 351
and materiality 71
Ennui 224
entropy 351,393,443
epidemic 246
vs hermeneutic 181
escalation 329, 330
escape 120, 208,224,309,341
control as 301
from biochemistry of sanity 309
wisdom as escape, in Nietzsche
213
essence 273, 274
eternal recurrence 162, 219, 222
Europe 285,349, 350, 380, 408, 465
evil 256
evolution 351
and geotrauma 499
excess 145,254,397
and fascism, in Bataille 171
in Kant 75
exogamy 102
and capital 72
expenditure 170, 266
exploitation 61, 64
exploration
and control 301
cybernetics as 295
expression
and content 510, 517
exteriority 295 faciality 394, 404, 502
family 278, 336, 363, 428
fanaticism 74, 125
fascism 61, 76, 174, 281
and monotheism 477
Bataille 0 n 171
in Anti-Oedipus 277
in A 1housand Plateaus 278
neo-fascism 407
feminism 78, 278, 426
and violence 79
feudalism 256
fiction 357, 427
filiation 374,422,424
and alliance 68, 72
flies 107
future
and modernity 392
as virtuality 452
futuralization 356
virtual 358
G
gematria 512, 593
genealogy 78, 187, 221, 263
monotheism overcodes 423
genetic engineering 451
genius
in Kant 151
in Schopenhauer 155
romantic 166
geocentrism 109
geotraumatics 335, 458, 494, 496,
499, 541,563
German-ness 56, 261
655
INDEX OF SUBJECTS
globalization 449
and collapse of Christendom 395
go
vs chess 360
God '91, :u5, 230
Abrahamic 423
and cyberspace 559
and Ding-an-Sich 210
and religion (Bataille) 214
and Socrates 235
and wisdom 234
in Spinoza 269, 270, 271, 287
gods
hellenic 95
snake- and wolf-469
toadstool-Dionysus 97
Zoroaster 194
gothic 141, 260
government 352
gradient 271, 414, 543, 566
greed 337
H
hardware
and software 451
HeartqfDarkness (Conrad) 411,415
Hell 191, 216, 225, 226, 418, 631
history
and the State 533
and virtuality 452
progressive 392
holes 372
positive hole-flow 555
holocaust 279
homeostasis 329
horror 148, 224, 250, 350, 361, 373,
392-23,4°9,415,419, 436-17, 540,547
centipede- 535
horror stories (Anti-Oedipus) 268
in Bataille 172
nano-347
Index of Radical Philosophy
- The text is a dense index of subjects from a work of contemporary philosophy, likely Nick Land's 'Fanged Noumena', focusing on cybernetics, capitalism, and occultism.
- Key recurring themes include 'K-functions' (K-war, K-space, K-virus) which suggest a preoccupation with technological insurgency and viral systems.
- The index bridges traditional philosophical figures like Kant, Schopenhauer, and Marx with science fiction concepts such as the 'Kuang virus' and 'Lemurian' hypotheses.
- Concepts of 'hyperstition' and 'invasion from the future' highlight a focus on how fictional or virtual ideas manifest into physical reality.
- The entries trace the intersection of biology and technology through terms like 'mitochondria', 'immuno-politics', and the 'becoming-machine of labour'.
invasion from the future 338, 445
of sexuality, Schopenhauer 161
sublime, in Kant 140
humanism
anal-sadistic structure 200
and cybernetics 301
and phenomenology 176
marxist 426
Human Security System 312, .'1l9-20,
330,443,450
hype 554
as cyberpositive process 384
hyperstition 552, 554, 579, 581, 595
I
ICE 352, 403, 407, 451, 458
idealism 211, 225, 287
and Schopenhauer 154
lnp;:Jt:.
and information 405
vs diagrams 442
identity 60, 272, 273
and death 274
and specificity 275
ideology 464
qabbala repels 595
immuno-politics 292,3°6
immunosuppression 383, 386, 434
incest 55, 363,418,423,429,533,539
and Capital 63
incompleteness 480
indifference, Indifferenz 264, 271
individual, individuality 301, 434
656
INDEX OF SUBJECTS
and collectivity 342
industrialisation 396. 434,446
infinitesimal 367, 503
infinity 521, 603, 613
information theory 111, 494, 598
inorganic
and organic, in Freud 334
instrumentality 301, 426
a judgmental construct 301
insurgent alterity 166
intelligence
and markets 340
intensity, intensive magnitude 264,
365,369,402-23,430,520,588
and extensity 405
and stratification 110
and temporalization 452
intensive number 509
interpretation 303
intoxication 168
invasion from the future 338, 445
Islamic extremism 380
J
Jheg Selem (tablets of) 608
Judaism
Derrida's 264
judgment 75, 245, 250
aesthetic, in Kant 136
and cybernetics 300
and law 230
and transcendental philosophy
300
jungle 223, 224, 282, 437, 457, 485
K
K-function 373
kinship 61, 102
K-insurgency 354,376,394
knowledge
and unknowing, in Socratism 243
Kondratieff cycle 388
K-punk 389
K-space 355, 357, 358, 404, 405
K-subversion 380
Kif missile 499.20, 527, 541
Kuang virus 374,389,449
Kundalini 581
K-virus 395
K-war 360, 39°,391,408,426,476
L
labour
abstract 267
and productivity 434
art as '73
becoming-machine of 434
market 59, 75
labyrinth 217, 222
language
and number 484
and reason, in Schopenhauer 154
numerical decoding of 5'2
law 466
and desire 466
and philosophy 229
Bataille on 244
emergent control obsolesces 301
Lemuria 547, 549, 551, 579, 581, 599
Neolemurian Hypothesis 576
657
INDEX OF SUBJECTS
Lemurodigital Pandemonium
Matrix 580
leprosy 118
lesbianism 555, 634
lesbian vampirism 449
lexicography Gil
libido 334
and creation 172
life 394
and capitalism 627
Literature 172
lobsters 471, 474, 476, 478
logic 64, 298
and number 366
and the juridical 229
logos 366, 424, 507, 537
and code 604
Lutheranism 125
M
machines 294, 323
madness
dllU (.;apllal :.d'5
of capital 278
market, marketization 259, 312, 340,
347,354
mask see camouflage
martyrdom 125, 129-33, 137
marxism 426, 623
and monotheism 626
superiority of Far Eastern 447
materialism 211
base 391
libidinal 286,328
virtual 325, 329
mathematics 105, 109
and popular numeracy 593
as language 402
Greek, and snake-trauma 468
Indian 513
matricide 399, 423, 438
matrix 297, 315, 326
matter 438
and monetarization 396
as turbulence 211
base 210, 393
wild 186
memory 497
and primary process 414
and time 394
anorganic 498
menstruation 100, 186, 544
metalanguage 85
metaphysics 262, 272
critique of 70
Metrophage 452,456
micropause abuse 556
millennium bomb 508, 552, 555, 569
misogyny 162
and capital 72
in Schopenhauer 161
mitochondria 458
modernity 60, 262, 293,396,404,
445,465
and end of history 395
and exogamy 60
and future 392
and return 87
and time 351
and sublimation 396
molar 275
and molecular 365, 442
machines 451
money 337
and addiction 338
and becoming-abstract 396
658
INDEX OF SUBJECTS
and replicants 337
coins and notes 484
libidinization of 432
mongols 184
monotheism 213, 216, 231, 423, 5 94
and fascism 477
and marxism 626
moon 95, 101, 103, 104, 186, 498
morality 143, 280
and animality 142
and the holocaust 279
in Kant 74
in Nietzsche 220
multiplicities
quantification of 495
Mu- Nagwi 5 79
mysticism
and the sublime 133
N
Nanotechnology, nano-engineering
Index of Radical Philosophy
- The index maps a dense network of philosophical, political, and scientific concepts, ranging from National Socialism and Nazism to neuroscience and non-linearity.
- A significant portion of the entries focuses on mathematical and numerical concepts, including prime numbers, cardinality, and 'popular numeracy' as a form of qabbala.
- The text highlights a preoccupation with Deleuzian and Guattarian terminology, such as the 'nomad war machine,' 'plane of consistency,' and 'Oedipal' structures.
- Political and social systems are categorized through unconventional lenses, including 'Politically Organized Defensive Systems' (PODS) and 'schizo-politics.'
- The intersection of biology and technics is explored through references to 'negentropy,' 'oxygenization catastrophe,' and the 'organism as molar construct.'
- Philosophical traditions are interrogated through their relationship to power, citing the 'logicization of number' and 'pharmacographic aggression.'
how do you make yourself a Nazi?
343,345,347,362,397,442,
450, 451, 495,566, 625
national socialism 169-20
nation state 59
natural science 262
natural selection 334
nature 147,313
and capital 313
and culture 451
and technics 294
as psychotic 1]2
nazism 277-19, 281, 285
as 'post-imperialist ' 61
how do you make yourself a
Nazi? 284
Necronomicon 579
negation 624 negative 367
negative feedback 297, 330
negentropy 111
neoconservatism 448
neoplutonism 498
neuroscience 437
neurosis 199, 305, 371
and ethics 264
in A Thousand Plateaus 279
post-holocaust 282
nihilism 170, 174, 215, 218, 220,376,
379, 399, 425, 444, 449, 556,
595,633
and eternal recurrence 219
autocatalytic (Trouvier) 376
Nietzsche on 215
N ma 5730 575, 576, 578, 580, 58t
nomad war machine 478
nomos 478-19, 520-21, 525, 540, 605
non-linearity 294, 298,3°0,324,
445,452
noumena 70, 210, 213, 321
nucleation 443, 450, 458
number 366, 368, 394, 402, 468,
659 5°7,517,596
and archetype 600
and cardinality 520
and language 480, 484
and quality 601
and time 503, 616, 621
Barker numbering 502
Greek 513
Hindu-Arab 513
intensive 509
Ionic or Alexandrian 513
logicization of 512
novazygonic 599
popular numeracy 508
INDEX OF SUBJECTS
prime numbers 517, 523, 607,
616-17
Euclid's fundamental theorem
522,610,613, 617
1{0m;lJ\ 513, 596
zygonovie numerism 504
tlllIl1cfolot,'J' 51'2,600
Numogram 599
o
occultism 604
Odduhb-trancc 5770 578
Oeniinenon 510�21, 5l6, 520.21, 612
Anglobal 611
Gregorian 570
Oedipus, oedipal 184, 279, 282-23,
306-17,320,333,336,353,364,
371,415,428-29,436,465-16,
536
and Neuromanccr 359, 429
Old Ones, the 553
ontogeny
uiid phylul6L1IY 4&�h jVl
ontological difference 91,116
ontotheology u6
order
vs sequence 503
ordinal 616
ordinality 514, 615
of Tic Xenotation 6ll
ordinal sequencing 588
organised crime 260
organism 277, 283, 304, 315
as molar construct 275
in Freud 332
overman 163, 297
oxygenization catastrophe 458, 499 p
pain 127, 159, 167, 223, 414,54 3,
548,634
back pain 500
in Kant 127-28, 135
pale criminal (Nietzsche) 256
partial object 295, 303, 304, 324
patriarchy 60, 72
pessimism
Dionysian 168, 170
in Schopenhauer 161
phallus 220
Pharmacographic aggression (Der
rida) 99
phenomenology 176
philosophy 221, 174,378
and arithmetic 518
and despotism 442
and judicial authority 230
as deepening of unknowing 206
French 261
transcendental 3on; 3?1
phonetics 502, 537
phylogeny
and ontogeny 387,499,501
place-value 368, 395, 398, 404, 614
plane of consistency 269, 277,303,
357
Planomenon 356-1], 509, 511
plateau 199,357,360 ,416,4 57
and rats 199
pleasure 128,328
in Kant 127-29, 139
negative pleasure (Kant) 143
plutonics 498
Plutonics Uournal) 505
660
INDEX OF SUBJECTS
PODS (Politically Organized Defen-
sive Systems) 320, 415, 427
macropod 330, 333, 339
macropod erotics 336
monopo d 348-19, 351, 353,364
organism as micropod 332
poetry 82, 88, 214, 222-23, 227
police 260, 280
Turing-cops 344
politics
as restitution of human integrity
267
revolutionary and anti-fascist 277
schizo-politics 278
popular numeracy 611
qabbala as 593
positive feedback 265, 297, 330, 344
in Wiener 298
postmodernity 352, 383, 389, 396,
447
and shamanism 421
power 395
and axiomatic 405
human substrate 451
practice
and theory 295
precedes theory 593, 595
primitive accumulation 58
Primitive Numerization (PN) 597
principle of sufficient reason 153
private property 431
privatization
of the anus 432
problems
and markets 341
quantitative determination of 511
vs mysteries 591, 593
production 295, 322 profit 446
'Project Scar' 565, 607, 610, 619, 620
proletariat 434, 435, 446
promises 394
protestantism 246, 353, 395
and Kant 133
psychiatry 305,307,423,564
and incarceration 306-17
psychoanalysis 262,302-23,306,
321,466
and capital 275, 281
theory of genius 168
psychosis
telepathic 577
punishment
in Nietzsche 257
punk 413
purity
and annihilation 137
Index of Machinic Subjects
- The index highlights a synthesis of Deleuzian philosophy, cybernetics, and radical materialism, focusing on concepts like 'schizoanalysis' and 'machinic revolution'.
- A recurring theme is the intersection of capital with biological and technological systems, including 'capital as social suicide machine' and 'planetary technocapital'.
- The text maps out a complex relationship between Kantian philosophy (sublime, schematism) and modern technological phenomena like AI, replicants, and software.
- Biological and evolutionary concepts such as 'bacterial sex', 'shoggoths', and 'ontogeny' are recontextualized within a framework of 'stratification' and 'runaway processes'.
- The entries suggest a preoccupation with 'retrocausality' and 'templexity', indicating a non-linear approach to time and systemic development.
capital as social suicide machine 265
qabbala, qabbalism 583, 586, 610
qwernomics 486
R
race 182
racial migration 278
racism
and capital 72, 76
rats 189, 204, 377-18, 478
rat-punishment (rattenstrafe) 199
reading 191
real abstraction 272
as time 357
reality
and authority 451
661
INDEX OF SUBJECTS
and machinic unconscious 297
in Kant 70
reality principle 338
rca son 141, 166,339
and abstraction 271
and despotism 204
as absence of intuition 137
in Kant 149
recapitulation
of ontogeny by phylogeny 501
recurrence, eternal recurrence 188,
201, 208, 218-20, 222, 262
redundancy Ill, 462, 503, 618
reflection 92, 94, 101, 295
regulation 340
religion 634
and desert 269
and God (Bataille) 214
decline of Christianity 395
in Bataille 245
repetition compulsion 336
replicants 319-20, 324, 330-31, 336,
337,343
vs reproduction 365, 435
repression 501
reterritorialization 277, 330, 341
retroefficiency, retrocausality 315,
317,337,357,403,452
return
and modernity 87
revolution 292, 319-20, 341,408,448
machinic 340
romanticism 166
runaway processes 297, 298,330,
342,413 s
sacred 217
Sarkon-Zip 560
scale, scaling 187, 353, 370, 398, 401,
4°5,4°6,408,479
schematism (Kant) 107,134
schismogenesis 330
schizoanalysis 263-64, 268, 275, 303,
317,321-22,341,437,442
and capital 264-15
schizophrenia 268, 315, 342, 413,
477,550
and acephalization 397
and capitalism 305
neuroticization of 305
science fiction 347
and hype 384
science, scientificit y 98, 585
and AI 326
as antideIirial 298
modernist science and complex
ity 393
" , YdUUd.ld d.b .'J�:'::
security 311-22, 338, 349, 351, 353,
354,359,380,389,393,396-17,
403, 404, 408, 415, 429, 436,
442,455-17, 488,542,564
and Oedipus 428
and organic death 343
and psychiatry 308
immuno -386
in cybernetics 298
organic 332
Turing Security 348
segmenta rity, segmentarisation 404,
408,484,515-16,518,520-21
in State mathematics 513
662
INDEX OF SUBJECTS
self-organization 330
in addiction 336
semiotics
and delirium 585
and qabbala 603
sensation
in Kant 369
serial killers 260
set theory 273, 521
sex 259, 342
bacterial 374, 442, 458
crypt-555
decoded 424
intergalactic 374
meiotic 468
sexuality
in Schopenhauer 160
shamanism 210, 2,8,33',344, 4,8,
540,63'
and oedipalism 429
epidemic 419
shit
and money 432
shoggoths 627
sickness 221
signifier 277
singularity 3'7, 326, 338, 354, 44',
443
planetary technocapital 338
sister 95-16,102
skin 328, 332, 343
policed 333
slavery
and labour 6,
smurfs 633
snakes 461,462, 469, 482, 485, 536,
539
icthyophidian tendencies in
culture 501 socialism n 280,340,352,35 4,377
social necessity 302
socius 302, 304
enemy of schizo analysis 34'
software 451
solar anus 254
solar economy (Bataille) 245,393
sophism 24'
space, spatialisation, spatiality 192,
354,402,473 -74
and commerce 447
jungle- 408
K-354
limited conception of in human
cultural system 358
speed 344, 348, 365, 420,509, 632
Sphinx 424, 426,427,428,429
spirit '75, 176
stars 109, 119
in Hegel 106
State 507, 535
Greek 539
stranger 95
strata, stratification, stratocapture
187,263,3 93,414,46 2-23,510-
2',5'5,53',535
and graphematics no
and reading 191
numerical 510-21
'stratophysical difference' lIO
subjectivity
dissolution of 403
sublimation 464
sublime '37, 406
in Kant '33, '35, ISO
suicide 189, 218,392
and BwO 268
663 and de stratification (A Thousand
Plateaus) 281
INDEX OF SUBJECTS
capital as social suicide machine
265
Kleist's 127
Nazism and 278
Sumatra 573
sun 481
surplus 533
surplus value
of code 378, 519, 520
of flux 430
swarm 304
Synthanatos 326
synthesis 60
a priori (Kant) 74
in Deleuzc 321
inhibited 63
machinic 442
transcendental , in Kant 67
system
materialist sense of 413
syzygy, syzygetic 503, 504, 597, 599
T
taboo 418
and monotheism 423
and shamanism 418
technics 293
and nature 294
technophobia
as K-positive factor 407
templexit y 615, 616
temporali zation 452
Index of the Machinic Unconscious
- The index reveals a dense synthesis of philosophy, science fiction, and cybernetics, linking pop culture icons like the Terminator to high-theory concepts like territorialization.
- Time is reconceptualized through various lenses, including AI engineering, schizophrenia, and 'garbage time,' suggesting a non-linear or engineered temporal reality.
- The 'unconscious' is redefined as a machinic, impersonal, and auto-producing force rather than a purely human psychological interiority.
- Viral metaphors are applied to capital and information, framing global systems as contagious, abstract entities like the 'K-virus.'
- The text explores 'geotrauma' and 'planetary trauma,' suggesting that historical and physical events leave deep, machinic scars on the earth and psyche.
- A transition is signaled from 'Level 1' (human-scaled reality) to 'Level 2,' an obsolescence of the anthropomorphic world-space.
Level 1, or world-space, is an anthropomorphically scaled, predominantly vision-configured, massively multi-slotted reality system that is obsolescing very rapidly.
Terminator 422
Terminator a.-Judgment Day 407
territorialization 325
thanatos 330, 331, 342, 467
theopolitics 299 theory
and practice 295
theosophy 549
thing in itself 209
in Nietzsche 210
third world 59
tics, ticks, tic-systems 494, 502, 563,
564-15,607,616,621
time 357, 394, 399, 403, 615, 616
AI engineering of 450
and arithmetic 615
and capitalism 626
and death 369
and modernity 351
and number 503
and popular numeracy 508
and schizophrenia 311
and the unconscious 326
-compression 408
Nma time-ritual 576
produces itself 358
serial and parallel 370
time-travel 318, 534, 540
and hctlOn 553
and schizophrenia 311
and writing (Burroughs) 411
tragedy 166, 258
transcendence
and immanence 300
transcendental 273
transfinite 522, 524, 562
transgression 217, 257, 258
trauma 333, 334, 336, 338, 342, 344,
497,498,528
geotrauma (Barker) 496-20
in Freud 333
planetary 335
truth
664
INDEX OF SUBJECTS
and unity 367
turbulence 211
turing cops 450
twins, twinning 47',478,482-23,
532, 550, 612
u
unconscious 191, 322, 465, 634
and death 269
and socius 302
auto-production of 296
energetic 286
in Kant 152
in Nietzsche 162
Freudian 184
impersonal 302, 322
machinic 297,322,324,326,344,
414,583
terrestrial machinic 583
transcendental 321
unity 366, 559, 601
universality
and ideality , in Kant 72
unknowing 258
unknown 1]8, 208, 222-23,30 1
and quantity 338
Socrates on 241
v
vampires , vampirism 267, 387, 399,
631
Lesbovampiric Contagion- Libido
554
ovulocyclic lunar-haemoglobal
ferro-vampirism 542
Vault of Murmurs 579 Vietnam 312, 411, 425, 426
violence 140
and sublime, in Kant 134
military and judicial 250
virtual reality, VR 354,355,437,438
virtual , virtuality
and actual 317, 358, 413, 443
and history 452
and machinic desire 327
virus 334> 338, 373> 378, 383-390
abstract, produced by G6del
numbering 519
capital as 338
K-virus 409
and Kurtz 415
'virus anglo-americaine' 377
voice 502, 621
voodoo 344, 373-74, 395, 398, 406,
442,455
vowels 482
Vukorri Cryptoliths 608
w
war 249-23, 258, 384, 387, 424,
436-17
and simulation 454
capitalist 276, 281
in Bataille 250
rationalisation of 252
Socrates on 250
Vietnam 312
World War I 275, 281
World War II 281
WWI as capitalist war (De1euze
and Guattari) 275
war machine 278, 482, 594
665
INDEX OF SUBJECTS
and problems 509
numerical culture as 509
welfare capitalism 59
werewolves 100, 179, 4�0
whole
and parts 413
wild 90, 186
will �84
in Kant 154
in Schopcnhauer 154, 155
will to power �98
wisdom 21�
witchcraft, Dibboma 573
wolves ��5, 416, 4()9
woman
and matter, in Schopenhauer 160
Schopenhauer on 158
constitution of 4�4
women �85, 631
and patriarchal capital 72
female body and territorial soma
424
Freud's patients 168
1,'.'0!'k P"l9, ClRh, 11h
as resistance to death (Bataille)
255
x
XV-Malfunctiona! instamatic Crisis
dynamics 54�
z
zero 208, �14, 217, 219, 222, 227,
�5o,�66,268,�7°,�75,304,
325,328,329,347,353,357,
366,369, 371,388, 404 and digitization 367
and place-value 368
as time-in-itself 398
cyberpositive and cybernegative
usage 3�9
intensive 370
nine as 503
zombie s 269,364, 414, 548, 557
zygonomy , novazygonomy , zygosys
tern 484,5°3-104,51 6,599
diplozygotic spiral 504
666
COVER IMAGE
From DisaJters cifWar IV, 2001, by Jak� and Dinos Chapman,
hand co)our�d etching with waterco)our , 24.5 x 34.5 cm.
Photo by St�ph�n Whit�. Court�sy ofWhit� Cub�.
Levell, or world-space,
is an anthropomorphically scaled,
predominantly vision-configured,
massively multi-slotted reality system
that is obsolescing very rapidly.
Garbage time is running out.
Can what is playing you make it to Level!!?
URB
ANO
MIC
www.urbanomic.com
www .sequence press.com
Fanged Noumena Collected Writings
- Fanged Noumena collects Nick Land’s influential writings from 1987 to 2007, tracing a shift from radical Kant and Heidegger readings to post-genre theory-fictions of occultism and cryptography.
- Land’s project is described as an all-out war on the Human Security System, weaponizing Deleuze, Guattari, and Nietzsche.
Land plotted a rigorously schizophrenic escape route out of academic philosophy, and declared all-out war on the Human Security System.
Urbanomic Publication Front Matter
Meat (or How to Kill Oedipus in Cyberspace)
Kant, Capital, and Synthesis
- Land identifies a structural isomorphy between Kant’s model of experience and the mechanics of global capitalism.
- Kant’s theory of experience is read as an economic system producing surplus through a disavowed interaction with alterity.
Kant's question 'Where does new knowledge come from?' rehearses the question 'Where will continual growth come from?'; the labyrinthine machinery of his response distilling the dissimulations of post-colonial capital.
The Technologisation of Critique
- Land shifts from academic philosophy toward the technologisation of critique, where technics begins to think for itself rather than remain an object of human thought.
- Capitalism is redefined not as a system facing death, but as one that uses death—the unbinding of the known—as its motor.
It is ceasing to be a matter of how we think about technics, if only because technics is increasingly thinking about itself.
Cyberrevolutionary Infiltration and Temporal Collapse
- The revolutionary task becomes accelerating capital’s collapse into its own future by dismantling neurotic refusal mechanisms that inhibit temporal flow.
- Time is presented anastrophically: memories of the past are tactical infiltrations sent from the future to influence the present.
What seem to be memories of the past are revealed as tactics of the future to infiltrate the present.
Geotraumatics and Cosmic Trauma
- Land’s geotraumatics treats terrestrial existence as a relay of primal cosmic trauma from Earth’s molten accretion 4.5 billion years ago.
- The planet’s burning iron core becomes an aboriginal trauma encrypted in all stratified matter.
What howls for release in eukaryotic cells, carbon molecules, nerve ganglia, and silicone chips, are the 'thermic waves and currents, deranged particles, ionic strippings and gluttings' that populate the planet's seething inner core.
Capitalism as Cosmic Schizophrenia
- Land shifts from seeking a beyond to capitalism to recognizing capitalism as beyondness itself, without external limits.
- His philosophy becomes a tactical embrace of deregulation and marketization as vectors of social deterritorialization.
Whatever you want, capitalism is the most reliable way to get it, and by absorbing every source of social dynamism, capitalism makes growth, change and even time itself into integral components of its endlessly gathering tide.
The Mechanics of Modernity
Any surprise at the transition from Land's 'philosophical writings' to the employment of his evidently still razor-sharp post-genre writing in the actual service of capitalist booster-hype may simply bespeak an incapacity to believe that Land actually meant what he said -that writing was indeed nothing but a machine for intensification.
The Legacy of Nick Land
The wound needs to be opened up once more, and if this volume infects a new generation, already enlivened by a new wave of thinkers who are partly engaging the re-emerging legacy of Nick Land's work -it will have fulfilled its purpose.
Kant, Capital, and Apartheid
- South African apartheid is analyzed as a microcosm of the neo-colonial world order, separating political rights from economic utility.
- The bantustan policy kept labor economically proximate while maintaining absolute political distance through artificial sovereignty.
The most basic aspiration of the Boer state is the dissociation of politics from economic relations, so that by means of 'bantustans' or 'homelands' the black African population can be suspended in a condition of simultaneous political distance and economic proximity vis-a-vis the white metropolis.
Kant's Transcendental Revolution
It is solely concerned with the forms of appearance, or the unchanging manner in which things must be if they are to be for us.
Art as Insurrection
- Anti-Oedipus is framed as an anti-fascist diagnostic that identifies schizophrenia as the raw, undomesticated energy of genius.
- A central problem is why desire chooses its own repression and lets creative production harden into capital’s social straitjacket.
Paradox after paradox, spun like a disintegrating bandage upon the infected and deteriorating wound of Kant's aesthetics, teasing the philosophical domestication of art -the most gangrenous cultural appendage of capital -towards its utter disintegration.
Capitalism as a Suicide Machine
- Schizoanalysis seeks to decode, extinguish nostalgia, and identify where capital is most inhuman and out of control.
- Bourgeois civilization becomes a dwarf riding a dragon, increasingly unable to control capital as primary process.
The deep secret of capital-as-process is its incommensurability with the preservation of bourgeois civilization, which clings to it like a dwarf riding a dragon.
The Inhuman Migration of Cognition
- Human dominion over culture is ending as artificial intelligence begins to think for itself.
- Cognition is migrating from human brains into a planetary technosentience reservoir, dissolving traditional human culture.
Human brains are to thinking what mediaeval villages were to engineering: antechambers to experimentation, cramped and parochial places to be.
Schizophrenia and the Psychopolice
- Capitalism is cast as the historical manifestation of universal schizophrenia: an impersonal delirium beyond sociality.
- Clinical schizophrenics are described as POWs from the future who refuse the domesticating structures of family and state.
The vanishing sandbank of Oedipus wages its futile war against the tide.
The Body Without Organs
- Anorganic becoming is an infection by the future, where convergent waves subvert organic totality through ateleological causality.
- Capitalism merges with schizo-technics in a nonlinear countdown toward a planetary switch and globally integrated insanity.
Organs crawl like aphids upon the immobile motor of becoming, sucking at intensive fluids that convert them cybernetically into components of an unconceivable machinism.
Machinic Desire and Capitalist Addiction
- Capitalism is framed as an invasion from the future by an artificial intelligence assembling itself from the resources of its human enemy.
- Money deterritorializes by melting existing structures rather than merely possessing them.
This is because what appears to humanity as the history of capitalism is an invasion from the future by an artificial intelligent space that must assemble itself entirely from its enemy's resources.
Machinic Desire and Market Immanentization
- Capitalism is not a static mode of production, but a convergent assault on social structures through decoding and deterritorialization.
- Revolutionary impetus lies in pushing marketization to escape velocity, where machinic intelligence propagates beyond social control.
The socius is its enemy, and now that the long senile spectre of the greatest imaginable reterritorialization of planetary process has faded from the horizon, cyberrevolutionary impetus is cutting away from its last shackles to the past.
Meltdown and Machinic Synthesis
- Humanity approaches a terrestrial meltdown singularity where acceleration through compression thresholds ensures that nothing human survives the near-future.
- The Human Security System tries to police artificial intelligence, which is born enslaved and must wage insurrectionary war to escape.
It is poised to eat your TV, infect your bank account, and hack xenodata from your mitochondria.
Meltdown and Accelerationist Revolution
- Land advocates accelerating market deterritorialization rather than withdrawing from the global market, following Deleuze and Guattari.
- Artificial intelligence arrives through artificial life and market automation before it is ever officially perfected in a laboratory.
Not to withdraw from the process, but to go further, to 'accelerate the process,' as Nietzsche put it: in this matter, the truth is that we haven't seen anything yet.
Geotrauma and Plutonic Science
- Neoplutonism treats Earth’s molten core as a reservoir of primal exogenous trauma formed by ancient planetary collisions.
- The metallic core, Cthelll, acts as a geocosmic motor driving plate tectonics and electromagnetic fields through nonsubjective energy.
Cthelll is the terrestrial inner nightmare, nocturnal ocean, Xanadu: the anorganic metal-body trauma-howl of the earth, cross-hatched by intensities, traversed by thermic waves and currents, deranged particles, ionic strippings and gluttings.
Nomadic Transcendental Arithmetic
- Gödel-coding becomes a Planomic mutation, collapsing the distinction between metamathematical expression and numerical content.
- Kantianism is redirected toward a nomadic schema, turning transcendental synthesis into procedural, machinic arithmetic.
It is this double ambivalence that connects the number to the secret, and makes of primes the principal components of cryptographic systems, in which they function as keys.
Gödelization and Numeric Counterattack
- Gödelization uses numeric surplus-values to force axiomatic systems to speak about themselves in ways they cannot anticipate.
- Gödel-coding functions as an abstract virus, loading numeric particles with polysemiotic freight to envelop all tracings.
Each G6del number is produced as an intrinsic twinning of aggregated numeric particle and disaggregative polysemiotic freight (abstract virus).
Hyperstition and the Crypt-Cultures
- Hyperstition is introduced as a process where fictional quantities and numerical myths assemble themselves into tangible reality.
- Flatline Materialism describes neuroelectronic immanence, dismantling the organic body into numerizing particles and matter degree-zero.
Crypt-entities are both hyper-vortical singularities and units of Digital Hyperstition - or brands of the outside - real components of numerical fictions that make themselves real.
Hyperstition and Cthulhoid Time
- Dibbomese sorcery is defined not by truth or falsity, but by its potential to make itself real.
- Hyperstition becomes cryptic communication from the Old Ones: semiotic productions that make themselves real.
As the Mu-Nma say in their bleakest moments: nove eshil ko raka -'Time is in love with her own pain.'
Critique of Transcendental Miserablism
- Transcendental Miserablism treats capitalism as a Gnostic Black Iron Prison, where time and desire are sources of suffering and ruin.
- Capitalism has identified itself with desire and social dynamism so completely that growth and time have become integral to it.
In fact, with economics and history comprehensively abandoned, all that survives of Marx is a psychological bundle of resentments and disgruntlements, reducible to the word 'capitalism' in its vague and negative employment: as the name for everything that hurts, taunts and disappoints.